Enhancing 1,3-Propanediol Productivity in the Non-Model Chassis Clostridium beijerinckii through Genetic Manipulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Media, Strains, and Growth Conditions
2.2. Plasmid Construction, Replication and Sequencing
2.3. Transformation of C. beijerinckii Br21 with pMTL83251_Ppta-ack_1,3-PDO_Cluster
2.4. Confirmation of Transformation
2.5. Bacterial Growth Experiment
2.6. Substrate and Products Quantification
2.7. Kinetic Parameters Determination
2.8. Non-Dissociated Butyric Acid Concentration
3. Results
3.1. Genetic Cluster Construction Using Modular Vector pMTL83251
3.2. Tailoring a Transformation Protocol for the Br21 Strain
3.3. C. beijerinckii Br21 [pMTL83251_Ppta-ack_1,3-PDO_Cluster] Confirmation
3.4. Impact of Overexpression of dhaB1, dhaB2, pduO, and dhaT in Glycerol Fermentation by C. beijerinckii Br21
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wei, X.; Liu, Q.; Pu, A.; Wang, S.; Chen, F.; Zhang, L.; Zhang, Y.; Dong, Z.; Wan, X. Knowledge Mapping of bioeconomy: A bibliometric analysis. J. Clean. Prod. 2022, 373, 133824. [Google Scholar] [CrossRef]
- Awasthi, M.K.; Sarsaiya, S.; Patel, A.; Juneja, A.; Singh, R.P.; Yan, B.; Awasthi, S.K.; Jain, A.; Liu, T.; Duan, Y.; et al. Refining biomass residues for sustainable energy and bio-products: An assessment of technology, its importance, and strategic applications in circular bio-economy. Renew. Sustain. Energy Rev. 2020, 127, 109876. [Google Scholar] [CrossRef]
- Ubando, A.T.; Felix, C.B.; Chen, W.H. Biorefineries in circular bioeconomy: A comprehensive review. Bioresour. Technol. 2020, 299, 122585. [Google Scholar] [CrossRef]
- Leoneti, A.B.; Aragão-Leoneti, V.; de Oliveira, S.V.W.B. Glycerol as a by-product of biodiesel production in Brazil: Alternatives for the use of unrefined glycerol. Renew. Energy 2012, 45, 138–145. [Google Scholar] [CrossRef]
- Zhao, M.; Wang, Y.; Zhou, W.; Zhou, W.; Gong, Z. Co-valorization of crude glycerol and low-cost substrates via oleaginous yeasts to micro-biodiesel: Status and outlook. Renew. Sustain. Energy Rev. 2023, 180, 113303. [Google Scholar] [CrossRef]
- Monteiro, M.R.; Kugelmeier, C.L.; Pinheiro, R.S.; Batalha, M.O.; César, A.S. Glycerol from biodiesel production: Technological paths for sustainability. Renew. Sust. Energy Rev. 2018, 88, 109–122. [Google Scholar] [CrossRef]
- Chilakamarry, C.R.; Sakinah, A.M.M.; Zularisam, A.W.; Pandey, A. Glycerol waste to value added products and its potential applications. Syst. Microbiol. Biomanuf. 2021, 1, 378–396. [Google Scholar] [CrossRef]
- Maervoet, V.E.T.; de Mey, M.; Beauprez, J.; de Maeseneire, S.; Soetaert, W.K. Enhancing the Microbial Conversion of Glycerol to 1,3-Propanediol Using Metabolic Engineering. Org. Process Res. Dev. 2011, 15, 189–202. [Google Scholar] [CrossRef]
- Wischral, D.; Zhang, J.; Cheng, C.; Lin, M.; de Souza, L.M.G.; Pessoa, F.L.P.; Pereira, N.; Yang, S.T. Production of 1,3-propanediol by Clostridium beijerinckii DSM 791 from crude glycerol and corn steep liquor: Process optimization and metabolic engineering. Bioresour. Technol. 2016, 212, 100–110. [Google Scholar] [CrossRef]
- Lee, C.S.; Aroua, M.K.; Daud, W.M.A.W.; Cognet, P.; Pérès-Lucchese, Y.; Fabre, P.L.; Reynes, O.; Latapie, L. A review: Conversion of bioglycerol into 1,3-propanediol via biological and chemical method. Renew. Sustain. Energy Rev. 2015, 42, 963–972. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Wang, Y.; Gao, H.; Wang, H.; Wan, Z.; Jiang, Y.; Xin, F.; Zhang, W.; Jiang, M. Current advances in microbial production of 1,3-propanediol. Biofuels Bioprod. Biorefin. 2021, 15, 1566–1583. [Google Scholar] [CrossRef]
- Biebl, H. Fermentation of glycerol by Clostridium pasteurianum—Batch and continuous culture studies. J. Ind. Microbiol. Biotechnol. 2001, 27, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Vivek, N.; Pandey, A.; Binod, P. Biological valorization of pure and crude glycerol into 1,3-propanediol using a novel isolate Lactobacillus brevis N1E9.3.3. Bioresour. Technol. 2016, 213, 222–230. [Google Scholar] [CrossRef] [PubMed]
- Johnson, E.E.; Rehmann, L. The role of 1,3-propanediol production in fermentation of glycerol by Clostridium pasteurianum. Bioresour. Technol. 2016, 209, 1–7. [Google Scholar] [CrossRef]
- Jiang, W.; Wang, S.; Wang, Y.; Fang, B. Key enzymes catalyzing glycerol to 1,3-propanediol. Biotechnol. Biofuels 2016, 9, 57. [Google Scholar] [CrossRef] [Green Version]
- Agu, C.V.; Ujor, V.; Ezeji, T.C. Metabolic engineering of Clostridium beijerinckii to improve glycerol metabolism and furfural tolerance. Biotechnol. Biofuels 2019, 12, 50. [Google Scholar] [CrossRef] [Green Version]
- Fokum, E.; Zabed, H.M.; Ravikumar, Y.; Elshobary, M.E.; Chandankere, R.; Zhang, Y.; Yun, J.; Qi, X. Co-fermentation of glycerol and sugars by Clostridium beijerinckii: Enhancing the biosynthesis of 1,3-propanediol. Food Biosci. 2021, 41, 101028. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Guazzaroni, M.E.; Reginatto, V. Fermentative production of H2 from different concentrations of galactose by the new isolate Clostridium beijerinckii Br21. Int. J. Hydrogen Energy 2016, 41, 21109–21120. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Schmidell, W.; Reginatto, V. Impact of glucose concentration on productivity and yield of hydrogen production by the new isolate Clostridium beijerinckii Br21. Canadian J. Chem. Eng. 2019, 97, 1092–1099. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Reginatto, V.; López-Linares, J.C.; Lucas, S.; García-Cubero, M.T.; Coca, M. Ideal conditions of microwave-assisted acid pretreatment of sugarcane straw allow fermentative butyric acid production without detoxification step. Bioresour. Technol. 2021, 329, 124929. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Reginatto, V.; López-Linares, J.C.; Lucas, S.; García-Cubero, M.T.; Coca, M. Acetic acid as catalyst for microwave-assisted pretreatment of sugarcane straw aids highly specific butyric acid bioproduction. Ind. Crops Prod. 2020, 157, 112936. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Bortolucci, J.; da Silva, T.M.; dos Passos, V.F.; de Gouvêa, P.F.; Dinamarco, T.M.; Reginatto, V. Butyric acid as sole product from xylose fermentation by a non-solventogenic Clostridium beijerinckii strain under controlled pH and nutritional conditions. Bioresour. Technol. Rep. 2020, 10, 100426. [Google Scholar] [CrossRef]
- Mermejo, B.C.; Bortolucci, J.; de Andrade, A.R.; Reginatto, V. The Non-solventogenic Clostridium beijerinckii Br21 Produces 1,3-Propanediol From Glycerol With Butyrate as the Main By-Product. Front. Sustain. Food Syst. 2022, 6, 256. [Google Scholar] [CrossRef]
- Altafini, R.M.; Martins, T.M.T.; Bruni, A.T.; Reginatto, V. Upgraded medium composition highlights the relevance of iron sulfate for 1,3-propanediol production by a Clostridium beijerinckii strain. Biocatal. Agric. Biotechnol. 2022, 43, 102388. [Google Scholar] [CrossRef]
- Fonseca, B.C.; Riaño-Pachón, D.M.; Guazzaroni, M.E.; Reginatto, V. Genome sequence of the H2-producing Clostridium beijerinckii strain Br21 isolated from a sugarcane vinasse treatment plant. Genet. Mol. Biol. 2019, 42, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Bortolucci, J.; Zani, A.C.B.; de Gouvêa, P.F.; Dinamarco, T.M.; Reginatto, V. A non-solventogenic Clostridium beijerinckii strain lacking acetoacetate decarboxylase assimilates acetate and accumulates butyrate. Biomass Bioenergy 2023, 172, 106780. [Google Scholar] [CrossRef]
- Biebl, H.; Zeng, A.P.; Menzel, K.; Deckwer, W.D. Fermentation of glycerol to 1,3-propanediol and 2,3-butanediol by Klebsiella pneumoniae. Appl. Microbiol. Biotechnol. 1998, 50, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Zeng, A.P. Pathway and kinetic analysis of 1,3-propanediol production from glycerol fermentation by Clostridium butyricum. Bioprocess Eng. 1996, 14, 169–175. [Google Scholar] [CrossRef]
- Joseph, R.C.; Kim, N.M.; Sandoval, N.R. Recent Developments of the Synthetic Biology Toolkit for Clostridium. Front. Microbiol. 2018, 9, 154. [Google Scholar] [CrossRef]
- Heap, J.T.; Kuehne, S.A.; Ehsaan, M.; Cartman, S.T.; Cooksley, C.M.; Scott, J.C.; Minton, N.P. The ClosTron: Mutagenesis in Clostridium refined and streamlined. J. Microbiol. Methods 2010, 80, 49–55. [Google Scholar] [CrossRef]
- Heap, J.T.; Ehsaan, M.; Cooksley, C.M.; Ng, Y.K.; Cartman, S.T.; Winzer, K.; Minton, N.P. Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic Acids Res. 2012, 40, e59. [Google Scholar] [CrossRef] [PubMed]
- Ehsaan, M.; Kuit, W.; Zhang, Y.; Cartman, S.T.; Heap, J.T.; Winzer, K.; Minton, N.P. Mutant generation by allelic exchange and genome resequencing of the biobutanol organism Clostridium acetobutylicum ATCC 824. Biotechnol. Biofuels 2016, 9, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Willson, B.J.; Kovács, K.; Wilding-Steele, T.; Markus, R.; Winzer, K.; Minton, N.P. Production of a functional cell wall-anchored minicellulosome by recombinant Clostridium acetobutylicum ATCC 824. Biotechnol. Biofuels 2016, 9, 109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, S.; Dong, S.; Wang, P.; Tao, Y.; Wang, Y. Genome Editing in Clostridium saccharoperbutylacetonicum N1-4 with the CRISPR-Cas9 System. Appl. Environ. Microbiol. 2017, 83, e00233-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wasels, F.; Jean-Marie, J.; Collas, F.; López-Contreras, A.M.; Ferreira, N.L. A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. J. Microbiol. Methods 2017, 140, 5–11. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Bouillaut, L.; Sonenshein, A.L.; Melville, S.B. Use of a Mariner-Based Transposon Mutagenesis System to Isolate Clostridium Perfringens Mutants Deficient in Gliding Motility. J. Bacteriol. 2013, 195, 629–636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Xu, S.; Chai, C.; Yang, S.; Jiang, W.; Minton, N.P.; Gu, Y. Development of an inducible transposon system for efficient random mutagenesis in Clostridium acetobutylicum. FEMS Microbiol. Lett. 2016, 363, fnw065. [Google Scholar] [CrossRef] [Green Version]
- Nora, L.C.; Westmann, C.A.; Guazzaroni, M.E.; Siddaiah, C.; Gupta, V.K.; Silva-Rocha, R. Recent advances in plasmid-based tools for establishing novel microbial chassis. Biotechnol. Adv. 2019, 37, 107433. [Google Scholar] [CrossRef]
- Schoch, T.; Baur, T.; Kunz, J.; Stöferle, S.; Dürre, P. Heterologous 1,3-Propanediol Production Using Different Recombinant Clostridium beijerinckii DSM 6423 Strains. Microorganisms 2023, 11, 784. [Google Scholar] [CrossRef]
- Wischral, D.; Barcelos, C.A.; Pereira, N.; Pessoa, F.L.P. 1,3-propanediol: Statistical optimization of medium to improve production by Clostridium beijerinckii DSM 791. J. Adv. Biotechnol. 2015, 5, 614–624. [Google Scholar] [CrossRef]
- Heap, J.T.; Pennington, O.J.; Cartman, S.T.; Minton, N.P. A modular system for Clostridium shuttle plasmids. J. Microbiol. Methods 2009, 78, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Roberts, R.J.; Belfort, M.; Bestor, T.; Bhagwat, A.S.; Bickle, T.A.; Bitinaite, J.; Blumenthal, R.M.; Degtyarev, S.K.; Dryden, D.T.F.; Dybvig, K.; et al. A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes. Nucleic Acids Res. 2003, 31, 1805–1812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Little, G.T.; Willson, B.J.; Heap, J.T.; Winzer, K.; Minton, N.P. The Butanol Producing Microbe Clostridium beijerinckii NCIMB 14988 Manipulated Using Forward and Reverse Genetic Tools. Biotechnol. J. 2018, 13, 1700711. [Google Scholar] [CrossRef] [Green Version]
- Maddox, I.S.; Steiner, E.; Hirsch, S.; Wessner, S.; Gutierrez, N.A.; Gapes, J.R.; Schuster, K.C. The cause of “acid-crash” and “acidogenic fermentations” during the batch acetone-butanol-ethanol (ABE-) fermentation process. J. Mol. Microbiol. Biotechnol. 2000, 2, 95–100. [Google Scholar] [PubMed]
- Davis, I.J.; Carter, G.; Young, M.; Minton, N.P. Chapter 3: Gene Cloning in Clostridia. In Handbook on Clostridia, 3rd ed.; Dürre, P., Ed.; CRC Press: London, UK, 2005; pp. 37–52. ISBN 978-084-931-618-0. [Google Scholar]
- Xin, X.; Cheng, C.; Du, G.; Chen, L.; Xue, C. Metabolic Engineering of Histidine Kinases in Clostridium beijerinckii for Enhanced Butanol Production. Front. Bioeng. Biotechnol. 2020, 8, 214. [Google Scholar] [CrossRef] [Green Version]
- Dower, W.J.; Chassy, B.M.; Blaschek, H.P.; Trevors, J.T. Protocols for the Transformation of Bacteria by Electroporation. In Guide to Electroporation and Electrofusion, 1st ed.; Chang, D.C., Chassy, B.M., Saunders, J.A., Sowers, A.E., Eds.; Academic Press: San Diego, CA, USA, 1992; pp. 485–499. ISBN 978-008-091-727-6. [Google Scholar]
- Aune, T.E.V.; Aachmann, F.L. Methodologies to increase the transformation efficiencies and the range of bacteria that can be transformed. Appl. Microbiol. Biotechnol. 2010, 85, 1301–1313. [Google Scholar] [CrossRef]
- Bhattacharjee, D.; Sorg, J.A. Factors and Conditions That Impact Electroporation of Clostridioides difficile Strains. mSphere 2020, 5, 10-1128. [Google Scholar] [CrossRef] [Green Version]
- Scott, P.T.; Rood, J.I. Electroporation-mediated transformation of lysostaphin-treated Clostridium perfringens. Gene 1989, 82, 327–333. [Google Scholar] [CrossRef]
- Jacyna, J.; Kordalewska, M.; Markuszewski, M.J. Design of Experiments in metabolomics-related studies: An overview. J. Pharm. Biomed. Anal. 2019, 164, 598–606. [Google Scholar] [CrossRef]
- González-Pajuelo, M.; Meynial-Salles, I.; Mendes, F.; Andrade, J.C.; Vasconcelos, I.; Soucaille, P. Metabolic Engineering of Clostridium acetobutylicum for the industrial production of 1,3-propanediol from glycerol. Metab. Eng. 2005, 7, 329–336. [Google Scholar] [CrossRef]
- Vollenweider, S.; Lacroix, C. 3-Hydroxypropionaldehyde: Applications and perspectives of biotechnological production. Appl. Microbiol. Biotechnol. 2004, 64, 16–27. [Google Scholar] [CrossRef] [Green Version]
- Przystałowska, H.; Zeyland, J.; Kośmider, A.; Szalata, M.; Słomski, R.; Lipiński, D. 1,3-Propanediol production by Escherichia coli using genes from Citrobacter freundii ATCC 8090. Acta Biochim. Pol. 2015, 62, 589–597. [Google Scholar] [CrossRef] [PubMed]
- Abbad-Andaloussi, S.; Dürr, C.; Raval, G.; Petitdemange, H. Carbon and electron flow in Clostridium butyricum grown in chemostat culture on glycerol and on glucose. Microbiology 1996, 142, 1149–1158. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liu, H.; Liu, D. Regulation of 3-hydroxypropionaldehyde accumulation in Klebsiella pneumoniae by overexpression of dhaT and dhaD genes. Enzyme Microb. Technol. 2009, 45, 305–309. [Google Scholar] [CrossRef]
- Sun, Y.Q.; Shen, J.T.; Yan, L.; Zhou, J.J.; Jiang, L.L.; Chen, Y.; Yuan, J.L.; Feng, E.M.; Xiu, Z.L. Advances in bioconversion of glycerol to 1,3-propanediol: Prospects and challenges. Process Biochem. 2018, 71, 134–146. [Google Scholar] [CrossRef]
- Wu, Z.; Wang, Z.; Wang, G.; Tan, T. Improved 1,3-propanediol production by engineering the 2,3-butanediol and formic acid pathways in integrative recombinant Klebsiella pneumoniae. J. Biotechnol. 2013, 168, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.Y.; Seo, J.W.; Heo, S.Y.; Baek, J.O.; Rairakhwada, D.; Oh, B.R.; Seo, P.S.; Choi, M.H.; Kim, C.H. Elimination of by-product formation during production of 1,3-propanediol in Klebsiella pneumoniae by inactivation of glycerol oxidative pathway. Appl. Microbiol. Biotechnol. 2009, 84, 527–534. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, Y.; Du, C.; Liu, M.; Cao, Z. Inactivation of aldehyde dehydrogenase: A key factor for engineering 1,3-propanediol production by Klebsiella pneumoniae. Metab. Eng. 2006, 8, 578–586. [Google Scholar] [CrossRef]
- Chen, Z.; Liu, H.; Liu, D. Metabolic pathway analysis of 1,3-propanediol production with a genetically modified Klebsiella pneumoniae by overexpressing an endogenous NADPH-dependent alcohol dehydrogenase. Biochem. Eng. J. 2011, 54, 151–157. [Google Scholar] [CrossRef]
- Zhao, L.; Zheng, Y.; Ma, X.; Wei, D. Effects of over-expression of glycerol dehydrogenase and 1,3-propanediol oxidoreductase on bioconversion of glycerol into 1,3-propandediol by Klebsiella pneumoniae under micro-aerobic conditions. Bioprocess Biosyst. Eng. 2009, 32, 313–320. [Google Scholar] [CrossRef]
- Zhang, Y.; Huang, Z.; Du, C.; Li, Y.; Cao, Z. Introduction of an NADH regeneration system into Klebsiella oxytoca leads to an enhanced oxidative and reductive metabolism of glycerol. Metab. Eng. 2009, 11, 101–106. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.; Chen, Y.; Jiang, K.; Zuo, W.; Luo, Z.; Wei, Y.; Du, L.; Wei, H.; Huang, R.; Du, Q. Saturation-mutagenesis in two positions distant from active site of a Klebsiella pneumoniae glycerol dehydratase identifies some highly active mutants. J. Biotechnol. 2009, 144, 43–50. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Zhang, L.; Dai, J.; Xiu, Z. Relaxing the coenzyme specificity of 1,3-propanediol oxidoreductase from Klebsiella pneumoniae by rational design. J. Biotechnol. 2010, 146, 173–178. [Google Scholar] [CrossRef] [PubMed]
- Zheng, P.; Wereath, K.; Sun, J.; van den Heuvel, J.; Zeng, A.P. Overexpression of genes of the dha regulon and its effects on cell growth, glycerol fermentation to 1,3-propanediol and plasmid stability in Klebsiella pneumoniae. Process Biochem. 2006, 41, 2160–2169. [Google Scholar] [CrossRef]
- Mera, P.E.; Escalante-Semerena, J.C. Multiple roles of ATP:cob(I)alamin adenosyltransferases in the conversion of B12 to coenzyme B12. Appl. Microbiol. Biotechnol. 2010, 88, 41–48. [Google Scholar] [CrossRef]
- Saridakis, V.; Yakunin, A.; Xu, X.; Anandakumar, P.; Pennycooke, M.; Gu, J.; Cheung, F.; Lew, J.M.; Sanishvili, R.; Joachimiak, A.; et al. The Structural Basis for Methylmalonic Aciduria: The crystal structure of archaeal ATP:cobalamin adenosyltransferase. J. Biol. Chem. 2004, 279, 23646–23653. [Google Scholar] [CrossRef] [Green Version]
- Singh, R.S.; Kaur, N.; Singh, D.; Bajaj, B.K.; Kennedy, J.F. Downstream processing and structural confirmation of pullulan—A comprehensive review. Int. J. Biol. Macromol. 2022, 208, 553–564. [Google Scholar] [CrossRef]
- Patakova, P.; Branska, B.; Vasylkivska, M.; Jureckova, K.; Musilova, J.; Provaznik, I.; Sedlar, K. Transcriptomic studies of solventogenic clostridia, Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol. Adv. 2022, 58, 107889. [Google Scholar] [CrossRef]
- Zhang, A.H.; Liu, H.L.; Huang, S.Y.; Fu, Y.S.; Fang, B.S. Metabolic profiles analysis of 1,3-propanediol production process by Clostridium butyricum through repeated batch fermentation coupled with activated carbon adsorption. Biotechnol. Bioeng. 2017, 115, 684–693. [Google Scholar] [CrossRef]
- Akama-Garren, E.H.; Joshi, N.S.; Tammela, T.; Chang, G.P.; Wagner, B.L.; Lee, D.Y.; Rideout, W.M.; Papagiannakopoulos, T.; Xue, W.; Jacks, T. A Modular Assembly Platform for Rapid Generation of DNA Constructs. Sci. Rep. 2016, 6, 16836. [Google Scholar] [CrossRef] [Green Version]
- Silva-Rocha, R.; Martínez-García, E.; Calles, B.; Chavarría, M.; Arce-Rodríguez, A.; de las Heras, A.; Páez-Espino, A.D.; Durante-Rodríguez, G.; Kim, J.; Nikel, P.I.; et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Res. 2013, 41, 666–675. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′ 3′) | Application |
---|---|---|
dhaB1/2CoTdhaT.fwd | TTAAATTTAAAGGGAGGACTCTAGAATGATAAGTAAAGGATTTAGTACC | Amplification of 1,3-PDO gene cluster |
dhaB1/2CoTdhaT.rev | GCAGGCTTCTTATTTTTATGCTAGCTTAATAAGCAGCTTTAAATATATTTACG | |
Seq1 | GGAGCTGGTGAAGTACAT | Sequencing of pMTL83251_Ppta-ack_1,3-PDO_cluster |
Seq2 | GAAACAGAAGGTCAACCG | |
Seq3 | GCGTGTCAATCATTTTGG | |
Seq4 | AGGGAAAAGCCTTCAAGA | |
Seq5 | CCATCGGCATTAAAAGGT | |
Seq6 | GATTTTGCAGTGGAGCTT | |
Seq7 | TCCAAACATTCAGCCAGG | |
Seq8 | CCAGCAGGATTAACAGCA | |
16S-27F | ATAAGCTTGGATCCAGAGTTTGATCCTGGCTCAG | Amplification of 16S rRNA |
16S-1492R | ACTCGAGGATATCGGTTACCTTGTTACGACTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bortolucci, J.; Guazzaroni, M.-E.; Schoch, T.; Dürre, P.; Reginatto, V. Enhancing 1,3-Propanediol Productivity in the Non-Model Chassis Clostridium beijerinckii through Genetic Manipulation. Microorganisms 2023, 11, 1855. https://doi.org/10.3390/microorganisms11071855
Bortolucci J, Guazzaroni M-E, Schoch T, Dürre P, Reginatto V. Enhancing 1,3-Propanediol Productivity in the Non-Model Chassis Clostridium beijerinckii through Genetic Manipulation. Microorganisms. 2023; 11(7):1855. https://doi.org/10.3390/microorganisms11071855
Chicago/Turabian StyleBortolucci, Jonatã, María-Eugenia Guazzaroni, Teresa Schoch, Peter Dürre, and Valeria Reginatto. 2023. "Enhancing 1,3-Propanediol Productivity in the Non-Model Chassis Clostridium beijerinckii through Genetic Manipulation" Microorganisms 11, no. 7: 1855. https://doi.org/10.3390/microorganisms11071855