Autophagy Alters the Susceptibility of Candida albicans Biofilms to Antifungal Agents
Abstract
1. Introduction
2. Materials and Methods
2.1. Strain and Growth Media
2.2. Biofilm Formation
2.3. Preparation of Antifungal Agents
2.4. Susceptibility Tests
2.5. Alkaline Phosphatase Activity Assay
2.6. Reactive Oxygen Species (ROS)
2.7. Mitochondrial Membrane Potential (MMP)
2.8. Transmission Electron Microscopy
2.9. RT-qPCR
2.10. Western Blotting
2.11. Statistical Analysis
3. Results
3.1. Autophagy Activator and Inhibitor Affected the Drug Resistance of C. albicans Biofilms to Antifungal Agents
3.2. Antifungal Agents Changed the ALP Activity of C. albicans Biofilms
3.3. Antifungal Agents Increased the ROS Level of C. albicans Biofilms
3.4. Antifungal Agents Changed the MMP of C. albicans Biofilms
3.5. Antifungal Agents Increased the Autophagy Level of C. albicans Biofilms
3.6. Antifungal Agents Increased the Autophagosomes of C. albicans Biofilms
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Pfaller, M.A.; Diekema, D.J. Epidemiology of invasive candidiasis: A persistent public health problem. Clin. Microbiol. Rev. 2007, 20, 133–163. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharya, S.; Sobel, J.D.; White, T.C. A Combination Fluorescence Assay Demonstrates Increased Efflux Pump Activity as a Resistance Mechanism in Azole-Resistant Vaginal Candida albicans Isolates. Antimicrob. Agents Chemother. 2016, 60, 5858–5866. [Google Scholar] [CrossRef] [PubMed]
- Alikhani, T.; Daie Ghazvini, R.; Mirzaii, M.; Hashemi, S.J.; Fazli, M.; Rafat, Z.; Roostaei, D.; Ardi, P.; Kamali Sarvestani, H.; Zareei, M. Drug Resistance and Biofilm Formation in Candida Species of Vaginal Origin. Iran. J. Public Health 2022, 51, 913–918. [Google Scholar] [CrossRef] [PubMed]
- Gulati, M.; Nobile, C.J. Candida albicans biofilms: Development, regulation, and molecular mechanisms. Microbes Infect. 2016, 18, 310–321. [Google Scholar] [CrossRef] [PubMed]
- Mayer, F.L.; Wilson, D.; Hube, B. Candida albicans pathogenicity mechanisms. Virulence 2013, 4, 119–128. [Google Scholar] [CrossRef]
- Koshikawa, T.; Abe, M.; Nagi, M.; Miyazaki, Y.; Takemura, H. Biofilm-formation capability depends on environmental oxygen concentrations in Candida species. J. Infect. Chemother. 2022, 28, 643–650. [Google Scholar] [CrossRef]
- Das, S.; Goswami, A.M.; Saha, T. An insight into the role of protein kinases as virulent factors, regulating pathogenic attributes in Candida albicans. Microb. Pathog. 2022, 164, 105418. [Google Scholar] [CrossRef]
- Perrine-Walker, F. Caspofungin resistance in Candida albicans: Genetic factors and synergistic compounds for combination therapies. Braz. J. Microbiol. 2022, 53, 1101–1113. [Google Scholar] [CrossRef]
- Campoy, S.; Adrio, J.L. Antifungals. Biochem. Pharmacol. 2017, 133, 86–96. [Google Scholar] [CrossRef]
- Prasad, R.; Shah, A.H.; Rawal, M.K. Antifungals: Mechanism of Action and Drug Resistance. Adv. Exp. Med. Biol. 2016, 892, 327–349. [Google Scholar] [CrossRef]
- Fiori, B.; Posteraro, B.; Torelli, R.; Tumbarello, M.; Perlin, D.S.; Fadda, G.; Sanguinetti, M. In vitro activities of anidulafungin and other antifungal agents against biofilms formed by clinical isolates of different Candida and Aspergillus species. Antimicrob. Agents Chemother. 2011, 55, 3031–3035. [Google Scholar] [CrossRef] [PubMed]
- Song, N.; Zhou, X.; Li, D.; Li, X.; Liu, W. A Proteomic Landscape of Candida albicans in the Stepwise Evolution to Fluconazole Resistance. Antimicrob. Agents Chemother. 2022, 66, e0210521. [Google Scholar] [CrossRef] [PubMed]
- Palmer, G.E. Autophagy in the invading pathogen. Autophagy 2007, 3, 251–253. [Google Scholar] [CrossRef] [PubMed]
- Yu, Q.; Jia, C.; Dong, Y.; Zhang, B.; Xiao, C.; Chen, Y.; Wang, Y.; Li, X.; Wang, L.; Zhang, B.; et al. Candida albicans autophagy, no longer a bystander: Its role in tolerance to ER stress-related antifungal drugs. Fungal Genet. Biol. 2015, 81, 238–249. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Jiang, L.; Miao, H.; Lv, Y.; Zhang, Q.; Ma, M.; Duan, W.; Huang, Y.; Wei, X. Autophagy regulation of ATG13 and ATG27 on biofilm formation and antifungal resistance in Candida albicans. Biofouling 2022, 38, 926–939. [Google Scholar] [CrossRef] [PubMed]
- Qi, M.; Jiang, Q.; Yang, S.; Zhang, C.; Liu, J.; Liu, W.; Lin, P.; Chen, H.; Zhou, D.; Tang, K.; et al. The endoplasmic reticulum stress-mediated unfolded protein response protects against infection of goat endometrial epithelial cells by Trueperella pyogenes via autophagy. Virulence 2022, 13, 122–136. [Google Scholar] [CrossRef] [PubMed]
- Sekiguchi, T.; Ishii, T.; Kamada, Y.; Funakoshi, M.; Kobayashi, H.; Furuno, N. Involvement of Gtr1p in the oxidative stress response in yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 2022, 598, 107–112. [Google Scholar] [CrossRef]
- Hale, A.N.; Ledbetter, D.J.; Gawriluk, T.R.; Rucker, E.B., 3rd. Autophagy: Regulation and role in development. Autophagy 2013, 9, 951–972. [Google Scholar] [CrossRef]
- Reuss, O.; Vik, Å.; Kolter, R.; Morschhäuser, J. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans. Gene 2004, 341, 119–127. [Google Scholar] [CrossRef]
- Wang, T.; Shao, J.; Da, W.; Li, Q.; Shi, G.; Wu, D.; Wang, C. Strong Synergism of Palmatine and Fluconazole/Itraconazole against Planktonic and Biofilm Cells of Candida Species and Efflux-Associated Antifungal Mechanism. Front. Microbiol. 2018, 9, 2892. [Google Scholar] [CrossRef]
- Kuhn, D.M.; George, T.; Chandra, J.; Mukherjee, P.K.; Ghannoum, M.A. Antifungal susceptibility of Candida biofilms: Unique efficacy of amphotericin B lipid formulations and echinocandins. Antimicrob. Agents Chemother. 2002, 46, 1773–1780. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Xia, J.; Li, C.; Zuo, L.; Wei, X. The possible molecular mechanisms of farnesol on the antifungal resistance of C. albicans biofilms: The regulation of CYR1 and PDE2. BMC Microbiol. 2018, 18, 203. [Google Scholar] [CrossRef] [PubMed]
- Nothwehr, S.F.; Bryant, N.J.; Stevens, T.H. The newly identified yeast GRD genes are required for retention of late-Golgi membrane proteins. Mol. Cell. Biol. 1996, 16, 2700–2707. [Google Scholar] [CrossRef][Green Version]
- Wang, H.; Joseph, J.A. Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free. Radic. Biol. Med. 1999, 27, 612–616. [Google Scholar] [CrossRef] [PubMed]
- Smiley, S.T.; Reers, M.; Mottola-Hartshorn, C.; Lin, M.; Chen, A.; Smith, T.W.; Steele, G.D., Jr.; Chen, L.B. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc. Natl. Acad. Sci. USA 1991, 88, 3671–3675. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.H.; Wei, X.; Ma, M.; Chen, X.J.; Xu, S.B. Possible inhibitory molecular mechanism of farnesol on the development of fluconazole resistance in Candida albicans biofilm. Antimicrob. Agents Chemother. 2012, 56, 770–775. [Google Scholar] [CrossRef]
- Singh, S.D.; Robbins, N.; Zaas, A.K.; Schell, W.A.; Perfect, J.R.; Cowen, L.E. Hsp90 governs echinocandin resistance in the pathogenic yeast Candida albicans via calcineurin. PLoS Pathog. 2009, 5, e1000532. [Google Scholar] [CrossRef] [PubMed]
- Simon, H.U.; Haj-Yehia, A.; Levi-Schaffer, F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000, 5, 415–418. [Google Scholar] [CrossRef]
- Xu, D.D.; Du, L.L. Fission Yeast Autophagy Machinery. Cells 2022, 11, 1086. [Google Scholar] [CrossRef]
- Gu, X.; Zhang, L.; Sun, W.; Liu, K.; Xu, H.; Wu, P.; Gui, M.; Qu, W.A.-O. Autophagy Promotes α-Amanitin-Induced Apoptosis of Hepa1-6 Liver Cells. Chem. Res. Toxicol. 2022, 35, 392–401. [Google Scholar] [CrossRef]
- Nguyen, M.T.; Choe, H.C.; Kim, B.H.; Ahn, S.G. A new link between apoptosis induced by the metformin derivative HL156A and autophagy in oral squamous cell carcinoma. Eur. J. Pharmacol. 2022, 920, 174859. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.P.; Hu, L.F.; Zheng, H.F.; Mao, C.J.; Hu, W.D.; Xiong, K.P.; Wang, F.; Liu, C.F. Application and interpretation of current autophagy inhibitors and activators. Acta Pharmacol. Sin. 2013, 34, 625–635. [Google Scholar] [CrossRef] [PubMed]
- Mauthe, M.; Orhon, I.; Rocchi, C.; Zhou, X.; Luhr, M.; Hijlkema, K.J.; Coppes, R.P.; Engedal, N.; Mari, M.; Reggiori, F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14, 1435–1455. [Google Scholar] [CrossRef] [PubMed]
- Muhaj, F.F.; George, S.J.; Nguyen, C.D.; Tyring, S.K. Antimicrobials and resistance part II: Antifungals, antivirals, and antiparasitics. J. Am. Acad. Dermatol. 2022, 86, 1207–1226. [Google Scholar] [CrossRef] [PubMed]
- Lohse, M.B.; Gulati, M.; Johnson, A.D.; Nobile, C.J. Development and regulation of single- and multi-species Candida albicans biofilms. Nat. Rev. Microbiol. 2018, 16, 19–31. [Google Scholar] [CrossRef]
- Cocco, S.; Leone, A.; Roca, M.S.; Lombardi, R.; Piezzo, M.; Caputo, R.; Ciardiello, C.; Costantini, S.; Bruzzese, F.; Sisalli, M.J.; et al. Inhibition of autophagy by chloroquine prevents resistance to PI3K/AKT inhibitors and potentiates their antitumor effect in combination with paclitaxel in triple negative breast cancer models. J. Transl. Med. 2022, 20, 290. [Google Scholar] [CrossRef] [PubMed]
- Raiyan, S.; Rahman, M.A.; Al Mamun, M.A.; Asim, M.M.H.; Makki, A.; Hajjar, D.; Alelwani, W.; Tangpong, J.; Mathew, B. Natural compounds from Leea macrophylla enhance phagocytosis and promote osteoblasts differentiation by alkaline phosphatase, type 1 collagen, and osteocalcin gene expression. J. Biomed. Mater. Res. A 2021, 109, 1113–1124. [Google Scholar] [CrossRef] [PubMed]
- Peng, D.; Ruan, C.; Fu, S.; He, C.; Song, J.; Li, H.; Tu, Y.; Tang, D.; Yao, L.; Lin, S.; et al. Atg9-centered multi-omics integration reveals new autophagy regulators in Saccharomyces cerevisiae. Autophagy 2021, 17, 4453–4476. [Google Scholar] [CrossRef]
- Fotis, D.; Liu, J.; Dalamaga, M. Could gut mycobiome play a role in NAFLD pathogenesis? Insights and therapeutic perspectives. Metabol. Open 2022, 14, 100178. [Google Scholar] [CrossRef]
- Kinoshita, H.; Yoshioka, M.; Ihara, F.; Nihira, T. Cryptic antifungal compounds active by synergism with polyene antibiotics. J. Biosci. Bioeng. 2016, 121, 394–398. [Google Scholar] [CrossRef] [PubMed]
- Bartoszewska, M.; Kiel, J.A. The role of macroautophagy in development of filamentous fungi. Antioxid. Redox Signal. 2011, 14, 2271–2287. [Google Scholar] [CrossRef]
- Innokentev, A.; Kanki, T. Mitophagy in Yeast: Molecular Mechanism and Regulation. Cells 2021, 10, 3569. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.B.; Wang, D.G.; Guo, F.F.; Xuan, C. Mitochondrial membrane potential and reactive oxygen species in cancer stem cells. Fam. Cancer 2015, 14, 19–23. [Google Scholar] [CrossRef] [PubMed]
- Hirst, J.; King, M.S.; Pryde, K.R. The production of reactive oxygen species by complex I. Biochem. Soc. Trans. 2008, 36, 976–980. [Google Scholar] [CrossRef] [PubMed]
- Pallichankandy, S.; Rahman, A.; Thayyullathil, F.; Galadari, S. ROS-dependent activation of autophagy is a critical mechanism for the induction of anti-glioma effect of sanguinarine. Free Radic. Biol. Med. 2015, 89, 708–720. [Google Scholar] [CrossRef] [PubMed]
- Scherz-Shouval, R.; Elazar, Z. ROS, mitochondria and the regulation of autophagy. Trends Cell Biol. 2007, 17, 422–427. [Google Scholar] [CrossRef]
- Shekhova, E.; Kniemeyer, O.; Brakhage, A.A. Induction of Mitochondrial Reactive Oxygen Species Production by Itraconazole, Terbinafine, and Amphotericin B as a Mode of Action against Aspergillus fumigatus. Antimicrob. Agents Chemother. 2017, 61, e00978-17. [Google Scholar] [CrossRef]
- Li, L.; Tan, J.; Miao, Y.; Lei, P.; Zhang, Q. ROS and Autophagy: Interactions and Molecular Regulatory Mechanisms. Cell. Mol. Neurobiol. 2015, 35, 615–621. [Google Scholar] [CrossRef]
- Lee, Y.; Puumala, E.; Robbins, N.; Cowen, L.E. Antifungal Drug Resistance: Molecular Mechanisms in Candida albicans and Beyond. Chem. Rev. 2021, 121, 3390–3411. [Google Scholar] [CrossRef]
- Miwa, S.; Kashyap, S.; Chini, E.; von Zglinicki, T. Mitochondrial dysfunction in cell senescence and aging. J. Clin. Investig. 2022, 132, e158447. [Google Scholar] [CrossRef]
- Zorova, L.D.; Popkov, V.A.; Plotnikov, E.Y.; Silachev, D.N.; Pevzner, I.B.; Jankauskas, S.S.; Babenko, V.A.; Zorov, S.D.; Balakireva, A.V.; Juhaszova, M.; et al. Mitochondrial membrane potential. Anal. Biochem. 2018, 552, 50–59. [Google Scholar] [CrossRef] [PubMed]
- Perry, S.W.; Norman, J.P.; Barbieri, J.; Brown, E.B.; Gelbard, H.A. Mitochondrial membrane potential probes and the proton gradient: A practical usage guide. Biotechniques 2011, 50, 98–115. [Google Scholar] [CrossRef] [PubMed]
- Sena, L.A.; Chandel, N.S. Physiological roles of mitochondrial reactive oxygen species. Mol. Cell 2012, 48, 158–167. [Google Scholar] [CrossRef] [PubMed]
- Vyssokikh, M.Y.; Holtze, S.; Averina, O.A.; Lyamzaev, K.G.; Panteleeva, A.A.; Marey, M.V.; Zinovkin, R.A.; Severin, F.F.; Skulachev, M.V.; Fasel, N.; et al. Mild depolarization of the inner mitochondrial membrane is a crucial component of an anti-aging program. Proc. Natl. Acad. Sci. USA 2020, 117, 6491–6501. [Google Scholar] [CrossRef] [PubMed]
- Levraut, J.; Iwase, H.; Shao, Z.H.; Vanden Hoek, T.L.; Schumacker, P.T. Cell death during ischemia: Relationship to mitochondrial depolarization and ROS generation. Am. J. Physiol. Heart Circ. Physiol. 2003, 284, H549–H558. [Google Scholar] [CrossRef] [PubMed]
- Sun, N.; Youle, R.J.; Finkel, T. The Mitochondrial Basis of Aging. Mol. Cell 2016, 61, 654–666. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Hwang, J.W.; Yun, C.K.; Lee, Y.; Choi, Y.S. Delivery of exogenous mitochondria via centrifugation enhances cellular metabolic function. Sci. Rep. 2018, 8, 3330. [Google Scholar] [CrossRef]
- Bhattacharya, S.; Oliveira, N.K.; Savitt, A.G.; Silva, V.K.A.; Krausert, R.B.; Ghebrehiwet, B.; Fries, B.C. Low Glucose Mediated Fluconazole Tolerance in Cryptococcus neoformans. J. Fungi 2021, 7, 489. [Google Scholar] [CrossRef]
- Lang, Y.; Zhang, X.; Li, X.; Xu, Y. The mitophagosome, a novel ultrastructure of mitophagy in the alcoholic steatohepatitis mouse model: A transmission electron microscope study. Ultrastruct. Pathol. 2022, 46, 251–258. [Google Scholar] [CrossRef]
- Parzych, K.R.; Klionsky, D.J. An overview of autophagy: Morphology, mechanism, and regulation. Antioxid. Redox Signal. 2014, 20, 460–473. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′→3′) |
---|---|
CAT-F | CCAATTCCAGAACCATTTGCCACTC |
CAT-R | ACCATAAGCACCGGAACCTTTAGC |
GLR1-F | TGACAAGACTTTGATCGCCACTGG |
GLR1-R | TCCAAGGCAAAGAACCCATCAGATG |
SOD1-F | ACAAGAATCCGAATCCGCTCCAAC |
SOD1-R | AGGACCAGCAGAAGTACAACCATTG |
TRR1-F | GACCAACTCAAGACCGACGAAGC |
TRR1-R | GCCATACATCCACTACCAGCAGAAG |
ATG7-F | CTGGGGTGTCAGGAGCATTA |
ATG7-R | GCATCTACACCGGGGAAAAC |
ATG13-F | GCCAAGACTACGGGGTATGA |
ATG13-R | AAGCATTGGAATTGCGTCGA |
ATG17-F | TTCAACGCCTTCCAGCAA |
ATG17-R | TGGTTTGATCTCTGGCATTGA |
ATG27-F | ACTCCAACAGCTATCTCGCA |
ATG27-R | TATAACGTCGCCAACCCT |
β-actin-F | GACCAAGAAGACATCAAGGTATCAT |
β-actin-R | GTGTTCAATTGGGTATCTCAAG |
Drugs | No Treatment (μg/mL) | Treated with 100 nM Rapamycin (μg/mL) | Treated with 200 nM Rapamycin (μg/mL) | Treated with 100 nM Chloroquine (μg/mL) | Treated with 200 nM Chloroquine (μg/mL) |
---|---|---|---|---|---|
fluconazole | >512 | >1024 * | >1024 * | >512 | >512 |
itraconazole | >256 | >1024 * | >1024 * | >256 | >256 |
terbinafine | >128 | >512 * | >512 * | >128 | >64 * |
5-fluorocytosine | >256 | >1024 * | >1024 * | >256 | >128 * |
amphotericin B | >4 | >8 * | >8 * | >2 * | >2 * |
nystatin | >2 | >4 * | >4 * | >1 * | >1 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, J.; Ma, M.; Duan, W.; Huang, Y.; Shi, B.; Wu, Q.; Wei, X. Autophagy Alters the Susceptibility of Candida albicans Biofilms to Antifungal Agents. Microorganisms 2023, 11, 2015. https://doi.org/10.3390/microorganisms11082015
Shen J, Ma M, Duan W, Huang Y, Shi B, Wu Q, Wei X. Autophagy Alters the Susceptibility of Candida albicans Biofilms to Antifungal Agents. Microorganisms. 2023; 11(8):2015. https://doi.org/10.3390/microorganisms11082015
Chicago/Turabian StyleShen, Jiadi, Ming Ma, Wei Duan, Yun Huang, Banruo Shi, Qiaochu Wu, and Xin Wei. 2023. "Autophagy Alters the Susceptibility of Candida albicans Biofilms to Antifungal Agents" Microorganisms 11, no. 8: 2015. https://doi.org/10.3390/microorganisms11082015
APA StyleShen, J., Ma, M., Duan, W., Huang, Y., Shi, B., Wu, Q., & Wei, X. (2023). Autophagy Alters the Susceptibility of Candida albicans Biofilms to Antifungal Agents. Microorganisms, 11(8), 2015. https://doi.org/10.3390/microorganisms11082015