Cell Envelope Modifications Generating Resistance to Hop Beta Acids and Collateral Sensitivity to Cationic Antimicrobials in Listeria monocytogenes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. Construction of in-Frame Deletion Mutants and Ectopic Overexpression Mutants
2.3. Hop Beta Acids (HBAs)
2.4. ALE Experiment to Isolate Mutants with Increased HBA Resistance
2.5. Identification of Mutations
2.6. Growth and MIC Assays
2.7. Survival Assay
2.8. Statistical Analysis
3. Results
3.1. HBA Has a Concentration-Dependent Growth-Inhibitory Effect on L. monocytogenes
3.2. HBA Resistance Is Increased by Loss of Function Mutations in mprF
3.3. Loss of DltABCD Also Increases HBA Resistance
3.4. HBA Resistance of ΔmprF/ΔdltA Is Maintained at Low pH
3.5. HBA-Resistant Mutants Display Collateral Sensitivity to Some Cationic Antimicrobials
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Koopmans, M.M.; Brouwer, M.C.; Vázquez-Boland, J.A.; van de Beek, D. Human Listeriosis. Clin. Microbiol. Rev. 2023, 36, 120–121. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union One Health 2021 Zoonoses Report. EFSA J. 2022, 20, e07666. [Google Scholar] [CrossRef]
- Rocourt, J. Risk Factors for Listeriosis. Food Control 1996, 7, 195–202. [Google Scholar] [CrossRef]
- Swaminathan, B.; Gerner-Smidt, P. The Epidemiology of Human Listeriosis. Microbes Infect. 2007, 9, 1236–1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osek, J.; Wieczorek, K. Listeria monocytogenes—How This Pathogen Uses Its Virulence Mechanisms to Infect the Hosts. Pathogens 2022, 11, 1491. [Google Scholar] [CrossRef]
- Pouillot, R.; Hoelzer, K.; Chen, Y.; Dennis, S.B. Listeria monocytogenes Dose Response Revisited-Incorporating Adjustments for Variability in Strain Virulence and Host Susceptibility. Risk Anal. 2015, 35, 90–108. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.C.; Wiedmann, M. Physiology and Genetics of Listeria monocytogenes Survival and Growth at Cold Temperatures. Crit. Rev. Food Sci. Nutr. 2008, 49, 237–253. [Google Scholar] [CrossRef]
- McClure, P.J.; Kelly, T.M.; Roberts, T.A. The Effects of Temperature, PH, Sodium Chloride and Sodium Nitrite on the Growth of Listeria monocytogenes. Int. J. Food Microbiol. 1991, 14, 77–91. [Google Scholar] [CrossRef]
- Shabala, L.; Lee, S.H.; Cannesson, P.; Ross, T. Acid and NaCl Limits to Growth of Listeria monocytogenes and Influence of Sequence of Inimical Acid and NaCl Levels on Inactivation Kinetics. J. Food Prot. 2008, 71, 1169–1177. [Google Scholar] [CrossRef]
- Ferreira, V.; Wiedmann, M.; Teixeira, P.; Stasiewicz, M.J. Listeria monocytogenes Persistence in Food-Associated Environments: Epidemiology, Strain Characteristics, and Implications for Public Health. J. Food Prot. 2014, 77, 150–170. [Google Scholar] [CrossRef]
- Gartley, S.; Anderson-Coughlin, B.; Sharma, M.; Kniel, K.E. Listeria monocytogenes in Irrigation Water: An Assessment of Outbreaks, Sources, Prevalence, and Persistence. Microorganisms 2022, 10, 1319. [Google Scholar] [CrossRef] [PubMed]
- Vivant, A.-L.; Garmyn, D.; Piveteau, P. Listeria monocytogenes, a down-to-Earth Pathogen. Front. Cell. Infect. Microbiol. 2013, 3, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Welshimer, H.J.; Donker-Voet, J. Listeria monocytogenes in Nature. Appl. Microbiol. 1971, 21, 516–519. [Google Scholar] [CrossRef]
- Crowe, W.; Pan, X.; Mackle, J.; Harris, A.; Hardiman, G.; Elliott, C.T.; Green, B.D. Dietary Inclusion of Nitrite-Containing Frankfurter Exacerbates Colorectal Cancer Pathology and Alters Metabolism in APCmin Mice. NPJ Sci. Food 2022, 6, 60. [Google Scholar] [CrossRef] [PubMed]
- Bouarab Chibane, L.; Degraeve, P.; Ferhout, H.; Bouajila, J.; Oulahal, N. Plant Antimicrobial Polyphenols as Potential Natural Food Preservatives. J. Sci. Food Agric. 2019, 99, 1457–1474. [Google Scholar] [CrossRef] [Green Version]
- Singh, S.; Chaurasia, P.K.; Bharati, S.L. Functional Roles of Essential Oils as an Effective Alternative of Synthetic Food Preservatives: A Review. J. Food Process. Preserv. 2022, 46, e16804. [Google Scholar] [CrossRef]
- Tkaczewska, J. Peptides and Protein Hydrolysates as Food Preservatives and Bioactive Components of Edible Films and Coatings—A Review. Trends Food Sci. Technol. 2020, 106, 298–311. [Google Scholar] [CrossRef]
- EFSA. Commission Implementing Regulation (EU) No 872/2012. Off. J. Eur. Union 2012, 267, 161. [Google Scholar]
- FDA. CFR Title 21: Chapter I: Subchapter B: Part 172: Subpart F—Flavoring Agents and Related Substances. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/CFRSearch.cfm?FR=172.515 (accessed on 17 May 2023).
- FDA. GRN No. 63 Hop Beta Acids. Available online: https://www.cfsanappsexternal.fda.gov/scripts/fdcc/?set=GRASNotices&id=63&sort=GRN_No&order=DESC&startrow=1&type=column&search=GRN (accessed on 17 May 2023).
- Zhang, G.; Zhang, N.; Yang, A.; Huang, J.; Ren, X.; Xian, M.; Zou, H. Hop Bitter Acids: Resources, Biosynthesis, and Applications. Appl. Microbiol. Biotechnol. 2021, 105, 4343–4356. [Google Scholar] [CrossRef]
- Justé, A.; Krause, M.S.; Lievens, B.; Klingeberg, M.; Michiels, C.W.; Willems, K.A. Protective Effect of Hop B-Acids on Microbial Degradation of Thick Juice during Storage. J. Appl. Microbiol. 2007, 104, 51–59. [Google Scholar] [CrossRef]
- Kramer, B.; Thielmann, J.; Hickisch, A.; Muranyi, P.; Wunderlich, J.; Hauser, C. Antimicrobial Activity of Hop Extracts against Foodborne Pathogens for Meat Applications. J. Appl. Microbiol. 2015, 118, 648–657. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.; Geornaras, I.; Kendall, P.A.; Sofos, J.N. Control of Listeria monocytogenes on Frankfurters by Dipping in Hops Beta Acids Solutions. J. Food Prot. 2009, 72, 702–706. [Google Scholar] [CrossRef] [PubMed]
- Kramer, B.; Mignard, C.; Warschat, D.; Gürbüz, S.; Aiglstorfer, P.; Muranyi, P. Inhibition of Listeria monocytogenes on Bologna by a Beta Acid Rich Hop Extract. Food Control 2021, 126, 108040. [Google Scholar] [CrossRef]
- Wang, L.; Shen, C. Survival of Unstressed and Acid-, Cold-, and Starvation-Stress-Adapted Listeria monocytogenes in Ham Extract with Hops Beta Acids and Consumer Acceptability of HBA on Ready-to-Eat Ham. Biomed Res. Int. 2015, 2015, 817042. [Google Scholar] [CrossRef] [Green Version]
- Teuber, M.; Schmalreck, A.F. Membrane Leakage in Bacillus subtilis 168 Induced by the Hop Constituents Lupulone, Humulone, Isohumulone and Humulinic Acid. Arch. Mikrobiol. 1973, 94, 159–171. [Google Scholar] [CrossRef]
- Simpson, W.J.; Smith, A.R.W. Factors Affecting Antibacterial Activity of Hop Compounds and Their Derivatives. J. Appl. Bacteriol. 1992, 72, 327–334. [Google Scholar] [CrossRef]
- Simpson, W.J. Cambridge Prize Lecture. Studies on the Sensitivity of Lactic Acid Bacteria to Hop Bitter Acids. J. Inst. Brew. 1993, 99, 405–411. [Google Scholar] [CrossRef]
- Simpson, W.J. Ionophoric Action of Trans-Isohumulone on Lactobacillus brevis. J. Gen. Microbiol. 1993, 139, 1041–1045. [Google Scholar] [CrossRef] [Green Version]
- Behr, J.; Vogel, R.F. Mechanisms of Hop Inhibition: Hop Ionophores. J. Agric. Food Chem. 2009, 57, 6074–6081. [Google Scholar] [CrossRef]
- Behr, J.; Gänzle, M.G.; Vogel, R.F. Characterization of a Highly Hop-Resistant Lactobacillus brevis Strain Lacking Hop Transport. Appl. Environ. Microbiol. 2006, 72, 6483–6492. [Google Scholar] [CrossRef] [Green Version]
- Behr, J.; Israel, L.; Gänzle, M.G.; Vogel, R.F. Proteomic Approach for Characterization of Hop-Inducible Proteins in Lactobacillus brevis. Appl. Environ. Microbiol. 2007, 73, 3300–3306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Behr, J.; Vogel, R.F. Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction. Appl. Environ. Microbiol. 2010, 76, 142–149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schurr, B.C.; Hahne, H.; Kuster, B.; Behr, J.; Vogel, R.F. Molecular Mechanisms behind the Antimicrobial Activity of Hop Iso-Alpha-Acids in Lactobacillus brevis. Food Microbiol. 2015, 46, 553–563. [Google Scholar] [CrossRef]
- Fugett, E.; Fortes, E.; Nnoka, C.; Wiedmann, M. International Life Sciences Institute North America Listeria monocytogenes Strain Collection: Development of Standard Listeria monocytogenes Strain Sets for Research and Validation Studies. J. Food Prot. 2006, 69, 2929–2938. [Google Scholar] [CrossRef]
- Grant, S.G.N.; Jessee, J.; Bloom, F.R.; Hanahan, D. Differential Plasmid Rescue from Transgenic Mouse DNAs into Escherichia coli Methylation-Restriction Mutants. Proc. Natl. Acad. Sci. USA 1990, 87, 4645–4649. [Google Scholar] [CrossRef]
- Simon, R.; Priefer, U.; Pühler, A. A Broad Host Range Mobilization System for in vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nat. Biotechnol. 1983, 1, 784–791. [Google Scholar] [CrossRef]
- Monk, I.R.; Gahan, C.G.M.; Hill, C. Tools for Functional Postgenomic Analysis of Listeria monocytogenes. Appl. Environ. Microbiol. 2008, 74, 3921–3934. [Google Scholar] [CrossRef] [Green Version]
- Abdelhamed, H.; Lawrence, M.L.; Karsi, A. A Novel Suicide Plasmid for Efficient Gene Mutation in Listeria monocytogenes. Plasmid 2015, 81, 1–8. [Google Scholar] [CrossRef]
- Baranyi, J.; Roberts, T.A. A Dynamic Approach to Predicting Bacterial Growth in Food. Int. J. Food Microbiol. 1994, 23, 277–294. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org (accessed on 4 July 2023).
- Hothorn, T.; Bretz, F.; Westfall, P. Simultaneous Inference in General Parametric Models Simultaneous Inference in General Parametric Models. Biom. J. 2008, 50, 346–363. [Google Scholar] [CrossRef] [Green Version]
- Graves, S.; Piepho, H.; Selzer, L. Package ‘MultcompView.’ v0.1-9, 2023. The Comprehensive R Archive Network. Available online: https://cran.r-project.org/web/packages/multcompView/multcompView.pdf (accessed on 6 August 2023).
- Gutierrez, J.; Rodriguez, G.; Barry-Ryan, C.; Bourke, P. Efficacy of Plant Essential Oils against Foodborne Pathogens and Spoilage Bacteria Associated with Ready-to-Eat Vegetables: Antimicrobial and Sensory Screening. J. Food Prot. 2008, 71, 1846–1854. [Google Scholar] [CrossRef] [PubMed]
- Rogiers, G.; Kebede, B.T.; Van Loey, A.; Michiels, C.W. Membrane Fatty Acid Composition as a Determinant of Listeria monocytogenes Sensitivity to Trans-Cinnamaldehyde. Res. Microbiol. 2017, 168, 536–546. [Google Scholar] [CrossRef] [PubMed]
- Thedieck, K.; Hain, T.; Mohamed, W.; Tindall, B.J.; Nimtz, M.; Chakraborty, T.; Wehland, J.; Jänsch, L. The MprF Protein Is Required for Lysinylation of Phospholipids in Listerial Membranes and Confers Resistance to Cationic Antimicrobial Peptides (CAMPs) on Listeria monocytogenes. Mol. Microbiol. 2006, 62, 1325–1339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ernst, C.M.; Kuhn, S.; Slavetinsky, C.J.; Krismer, B.; Heilbronner, S.; Gekeler, C.; Kraus, D.; Wagner, S.; Peschel, A. The Lipid-Modifying Multiple Peptide Resistance Factor Is an Oligomer Consisting of Distinct Interacting Synthase and Flippase Subunits. MBio 2015, 6, e02340-14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parsons, C.; Lee, S.; Kathariou, S. Heavy Metal Resistance Determinants of the Foodborne Pathogen Listeria monocytogenes. Genes 2019, 10, 11. [Google Scholar] [CrossRef] [Green Version]
- Dare, K.; Shepherd, J.; Roy, H.; Seveau, S.; Ibba, M. LysPGS Formation in Listeria monocytogenes Has Broad Roles in Maintaining Membrane Integrity beyond Antimicrobial Peptide Resistance. Virulence 2014, 5, 534–546. [Google Scholar] [CrossRef]
- Song, D.; Jiao, H.; Liu, Z. Phospholipid Translocation Captured in a Bifunctional Membrane Protein MprF. Nat. Commun. 2021, 12, 2927. [Google Scholar] [CrossRef]
- Ernst, C.M.; Peschel, A. Broad-Spectrum Antimicrobial Peptide Resistance by MprF-Mediated Aminoacylation and Flipping of Phospholipids. Mol. Microbiol. 2011, 80, 290–299. [Google Scholar] [CrossRef]
- Thitiananpakorn, K.; Aiba, Y.; Tan, X.E.; Watanabe, S.; Kiga, K.; Sato’o, Y.; Boonsiri, T.; Li, F.Y.; Sasahara, T.; Taki, Y.; et al. Association of MprF Mutations with Cross-Resistance to Daptomycin and Vancomycin in Methicillin-Resistant Staphylococcus aureus (MRSA). Sci. Rep. 2020, 10, 16107. [Google Scholar] [CrossRef]
- Mandin, P.; Fsihi, H.; Dussurget, O.; Vergassola, M.; Milohanic, E.; Toledo-Arana, A.; Lasa, I.; Johansson, J.; Cossart, P. VirR, a Response Regulator Critical for Listeria monocytogenes Virulence. Mol. Microbiol. 2005, 57, 1367–1380. [Google Scholar] [CrossRef]
- Perego, M.; Glaser, P.; Minutello, A.; Strauch, M.A.; Leopold, K.; Fischer, W. Incorporation of D-Alanine into Lipoteichoic Acid and Wall Teichoic Acid in Bacillus subtilis. J. Biol. Chem. 1995, 270, 15598–15606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peschel, A.; Otto, M.; Jack, R.W.; Kalbacher, H.; Jung, G.; Götz, F. Inactivation of the Dlt Operon in Staphylococcus aureus Confers Sensitivity to Defensins, Protegrins, and Other Antimicrobial Peptides. J. Biol. Chem. 1999, 274, 8405–8410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sansawat, T.; Lee, H.C.; Zhang, L.; Ryser, E.T.; Kang, I. Antilisterial Effects of Different Hop Acids in Combination with Potassium Acetate and Potassium Diacetate at 7 and 37 °C. Food Control 2015, 59, 256–261. [Google Scholar] [CrossRef]
- Larson, A.E.; Yu, R.R.Y.; Lee, O.A.; Price, S.; Haas, G.J.; Johnson, E.A. Antimicrobial Activity of Hop Extracts against Listeria monocytogenes in Media and in Food. Int. J. Food Microbiol. 1996, 33, 195–207. [Google Scholar] [CrossRef] [PubMed]
- Hyldgaard, M.; Mygind, T.; Meyer, R.L. Essential Oils in Food Preservation: Mode of Action, Synergies, and Interactions with Food Matrix Components. Front. Microbiol. 2012, 3, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyague, L.; Macedo, R.E.F.; Meca, G.; Holley, R.A.; Luciano, F.B. Combination of Phenolic Acids and Essential Oils against Listeria monocytogenes. LWT Food Sci. Technol. 2015, 64, 333–336. [Google Scholar] [CrossRef]
- Pernin, A.; Dubois-brissonnet, F.; Roux, S.; Masson, M.; Bosc, V.; Maillard, M. Phenolic Compounds Can Delay the Oxidation of Polyunsaturated Fatty Acids and the Growth of Listeria monocytogenes: Structure-Activity Relationships. J. Sci. Food Agric. 2018, 98, 5401–5408. [Google Scholar] [CrossRef]
- Suzuki, K.; Iijima, K.; Sakamoto, K.; Sami, M.; Yamashita, H. A Review of Hop Resistance in Beer Spoilage Lactic Acid Bacteria. J. Inst. Brew. 2006, 112, 173–191. [Google Scholar] [CrossRef]
- Chen, F.J.; Lauderdale, T.L.; Lee, C.H.; Hsu, Y.C.; Huang, I.W.; Hsu, P.C.; Yang, C.S. Effect of a Point Mutation in MprF on Susceptibility to Daptomycin, Vancomycin, and Oxacillin in an MRSA Clinical Strain. Front. Microbiol. 2018, 9, 1086. [Google Scholar] [CrossRef]
- Nishi, H.; Komatsuzawa, H.; Fujiwara, T.; McCallum, N.; Sugai, M. Reduced Content of Lysyl-Phosphatidylglycerol in the Cytoplasmic Membrane Affects Susceptibility to Moenomycin, as Well as Vancomycin, Gentamicin, and Antimicrobial Peptides, in Staphylococcus aureus. Antimicrob. Agents Chemother. 2004, 48, 4800–4807. [Google Scholar] [CrossRef] [Green Version]
- Nowak, J.; Visnovsky, S.B.; Cruz, C.D.; Fletcher, G.C.; van Vliet, A.H.M.; Hedderley, D.; Butler, R.; Flint, S.; Palmer, J.; Pitman, A.R. Inactivation of the Gene Encoding the Cationic Antimicrobial Peptide Resistance Factor MprF Increases Biofilm Formation but Reduces Invasiveness of Listeria monocytogenes. J. Appl. Microbiol. 2020, 130, 464–477. [Google Scholar] [CrossRef] [PubMed]
- Abachin, E.; Poyart, C.; Pellegrini, E.; Milohanic, E.; Fiedler, F.; Berche, P.; Trieu-Cuot, P. Formation of D-Alanyl-Lipoteichoic Acid Is Required for Adhesion and Virulence of Listeria monocytogenes. Mol. Microbiol. 2002, 43, 1–14. [Google Scholar] [CrossRef]
- Camejo, A.; Buchrieser, C.; Couvé, E.; Carvalho, F.; Reis, O.; Ferreira, P.; Sousa, S.; Cossart, P.; Cabanes, D. In Vivo Transcriptional Profiling of Listeria monocytogenes and Mutagenesis Identify New Virulence Factors Involved in Infection. PLoS Pathog. 2009, 5, e1000449. [Google Scholar] [CrossRef] [PubMed]
- Fischer, W. Physiology of Lipoteichoic Acids in Bacteria. Adv. Microb. Physiol. 1988, 29, 233–302. [Google Scholar] [CrossRef] [PubMed]
- Neuhaus, F.C.; Baddiley, J. A Continuum of Anionic Charge: Structures and Functions of d -Alanyl-Teichoic Acids in Gram-Positive Bacteria. Microbiol. Mol. Biol. Rev. 2003, 67, 686–723. [Google Scholar] [CrossRef] [Green Version]
- Kang, J.; Wiedmann, M.; Boor, K.J.; Bergholz, T.M. VirR-Mediated Resistance of Listeria monocytogenes against Food Antimicrobials and Cross-Protection Induced by Exposure to Organic Acid Salts. Appl. Environ. Microbiol. 2015, 81, 4553–4562. [Google Scholar] [CrossRef] [Green Version]
- Matsuo, M.; Oogai, Y.; Kato, F.; Sugai, M.; Komatsuzawa, H. Growth-Phase Dependence of Susceptibility to Antimicrobial Peptides in Staphylococcus aureus. Microbiology 2011, 157, 1786–1797. [Google Scholar] [CrossRef] [Green Version]
- Bao, Y.; Sakinc, T.; Laverde, D.; Wobser, D.; Benachour, A.; Theilacker, C.; Hartke, A.; Huebner, J. Role of MprF1 and MprF2 in the Pathogenicity of Enterococcus faecalis. PLoS ONE 2012, 7, e38458. [Google Scholar] [CrossRef]
- Woodall, B.M.; Harp, J.R.; Brewer, W.T.; Tague, E.D.; Campagna, S.R.; Fozo, E.M. Enterococcus faecalis Readily Adapts Membrane Phospholipid Composition to Environmental and Genetic Perturbation. Front. Microbiol. 2021, 12, 616045. [Google Scholar] [CrossRef]
- Biswas, R.; Martinez, R.E.; Göhring, N.; Schlag, M.; Josten, M.; Xia, G.; Hegler, F.; Gekeler, C.; Gleske, A.K.; Götz, F.; et al. Proton-Binding Capacity of Staphylococcus aureus Wall Teichoic Acid and Its Role in Controlling Autolysin Activity. PLoS ONE 2012, 7, e41415. [Google Scholar] [CrossRef] [Green Version]
- Hughes, A.H.; Hancock, I.C.; Baddiley, J. The Function of Teichoic Acids in Cation Control in Bacterial Membranes. Biochem. J. 1973, 132, 83–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kern, T.; Giffard, M.; Hediger, S.; Amoroso, A.; Giustini, C.; Bui, N.K.; Joris, B.; Bougault, C.; Vollmer, W.; Simorre, J.P. Dynamics Characterization of Fully Hydrated Bacterial Cell Walls by Solid-State NMR: Evidence for Cooperative Binding of Metal Ions. J. Am. Chem. Soc. 2010, 132, 10911–10919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heptinstall, S.; Archibald, A.R.; Baddiley, J. Teichoic Acids and Membrane Function in Bacteria. Nature 1970, 225, 519–521. [Google Scholar] [CrossRef] [PubMed]
- Lambert, P.A.; Hancock, I.C.; Baddiley, J. Influence of Alanyl Ester Residues on the Binding of Magnesium Ions to Teichoic Acids. Biochem. J. 1975, 151, 671–676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rashid, R.; Nair, Z.J.; Chia, D.M.H.; Chong, K.K.L.; Cazenave Gassiot, A.; Morley, S.A.; Allen, D.K.; Chen, S.L.; Chng, S.S.; Wenk, M.R.; et al. Depleting Cationic Lipids Involved in Antimicrobial Resistance Drives Adaptive Lipid Remodeling in Enterococcus faecalis. mBio 2023, 14, e0307322. [Google Scholar] [CrossRef] [PubMed]
- Sleha, R.; Radochova, V.; Malis, J.; Mikyska, A.; Houska, M.; Krofta, K.; Bogdanova, K.; Janovska, S.; Pejchal, J.; Kolar, M.; et al. Strong Antimicrobial and Healing Effects of Beta-Acids from Hops in Methicillin-Resistant Staphylococcus aureus-Infected External Wounds in Vivo. Antibiotics 2021, 10, 708. [Google Scholar] [CrossRef]
Strain | Description | Reference | |
---|---|---|---|
L. monocytogenes | |||
WT | Wild-type strain Scott A, serotype 4b | [36] | |
WT/pI | WT with pIMK2 integrated; Kmr | This work | |
HBA2.2 | Isolated HBA-resistant mutant | This work | |
HBA2.7 | Isolated HBA-resistant mutant | This work | |
ΔarsB1 | arsB1 deletion mutant | This work | |
ΔmprF | mprF deletion mutant | This work | |
ΔmprF/pI | mprF deletion mutant with integrated pIMK2; Kmr | This work | |
ΔmprF/pI-mprF | mprF deletion mutant with integrated pIMK2-mprF; Kmr | This work | |
ΔdltA | dltA deletion mutant | This work | |
ΔdltA/pI | dltA deletion mutant with integrated pIMK2; Kmr | This work | |
ΔdltA/pI-dltABCD | dltA deletion mutant with integrated pIMK2-dltABCD; Kmr | This work | |
ΔmprF/ΔdltA/pI | mprF and dltA deletion mutant with pIMK2 integrated; Kmr | This work | |
E. coli | |||
DH5α | Cloning host strain | [37] | |
S17-1λpir | Cloning host strain and donor strain for plasmid conjugation | [38] | |
Plasmids | Description | Reference | |
pIMK2 | Site-specific integrative vector, constitutive overexpression promoter Phelp, 6.2 kb, Kmr | [39] | |
pIMK2-mprF | Phelp-driven constitutive MprF overexpression | This work | |
pIMK2-dltABCD | Phelp-driven constitutive DltABCD overexpression | This work | |
pHoss1 | Temperature-sensitive suicide plasmid for gene deletion, 9 kb, Ampr, Eryr | [40] | |
pHoss1-oriT | pHoss1 plasmid with integrated RP4 oriT from pIMK2, 9.2 kb, Ampr, Eryr | This work | |
pHoss1-oriTΔmprF | pHoss1-oriT carrying an in-frame MprF deletion cassette | This work | |
pHoss1-oriTΔarsB1 | pHoss1-oriT carrying an in-frame ArsB1 deletion cassette | This work | |
pHoss1-oriTΔdltA | pHoss1-oriT carrying an in-frame DltA deletion cassette | This work |
Primer | Oligonucleotide Sequence (5′-3′) |
---|---|
NC16(2) | GTCAAAACATACGCTCTTATCGATTC |
pIMK_F | GGGTTTCACTCTCCTTCTAC |
pIMK_R | GGTACCCAGCTTTTGTTCC |
pHoss1_F | GCGTCGACGTCATATGGATC |
pHoss1_R | CTCCCGGGTACCATGGGATC |
mprF_SalI | TACTGTCGACCTATTTGCAAGTGGTC |
mprF_BamHI | CTCGGGATCCATGAAAGAAAAATTAATGCAAGCC |
mprF_A | TAGATCCCATGGTACCCGGGAGCTCCTTCTCCTATCTATCATACC |
mprF_B | ACTCTGTTATGACTTGCAAATAGTCAAGTAGTC |
mprF_C | TATTTGCAAGTTTTCATAACAGAGTCTCCTTAAC |
mprF_D | CGGATCCATATGACGTCGACGCGCTTTACCTAGATTTAGGATACTG |
dltABCD_F | GGGAACAAAAGCTGGGTACCTTACTTACGGTCTTTTTTTG |
dltABCD_R | GTAGAAGGAGAGTGAAACCCATGACAACGAGTATCATAGAAAG |
dltA_A | GATCCCATGGTACCCGGGAGGAAACAGGTACAGTGATATC |
dltA_B | CATAGAAAGAGAGGTTAACAAGTGAGTTTAC |
dltA_C | TGTTAACCTCTCTTTCTATGATACTCGTTG |
dltA_D | GATCCATATGACGTCGACGCGTAACTGCTATTCCCTTC |
arsB1_A | TAGATCCCATGGTACCCGGGAGTTATCTGGTTCTTGTACAGTAGAG |
arsB1_B | CTTCTTAACGACATCTTCCTCCATCATAAAATTCAAATAAG |
arsB1_C | GGAGGAAGATGTCGTTAAGAAGCTAGTTTAAGAAG |
arsB1_D | CGGATCCATATGACGTCGACGCCTAACTCTTCAACTTCATCTCC |
Anionic | Cationic | ||||
---|---|---|---|---|---|
Strain | HBA (ppm) | Na Deoxycholate (µg/mL) | SDS (µg/mL) | PMB (µg/mL) | Nisin (µg/mL) |
WT | 2 | 625 | 250 | 100 | 75 |
ΔmprF | 3 | 625 | 250 | 50 | 18.25 |
ΔdltA | 2 | 625 | 250 | 50 | 37.5 |
ΔmprF/ΔdltA | 3 | 625 | 250 | 12.5 | 9.125 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Goedseels, M.; Michiels, C.W. Cell Envelope Modifications Generating Resistance to Hop Beta Acids and Collateral Sensitivity to Cationic Antimicrobials in Listeria monocytogenes. Microorganisms 2023, 11, 2024. https://doi.org/10.3390/microorganisms11082024
Goedseels M, Michiels CW. Cell Envelope Modifications Generating Resistance to Hop Beta Acids and Collateral Sensitivity to Cationic Antimicrobials in Listeria monocytogenes. Microorganisms. 2023; 11(8):2024. https://doi.org/10.3390/microorganisms11082024
Chicago/Turabian StyleGoedseels, Maarten, and Chris W. Michiels. 2023. "Cell Envelope Modifications Generating Resistance to Hop Beta Acids and Collateral Sensitivity to Cationic Antimicrobials in Listeria monocytogenes" Microorganisms 11, no. 8: 2024. https://doi.org/10.3390/microorganisms11082024