Establishment of Replication Deficient Vesicular Stomatitis Virus for Studies of PEDV Spike-Mediated Cell Entry and Its Inhibition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Plasmids
2.3. Cell Lines, Viruses and Antibody
2.4. Recovery and Production of rVSV-ΔG-EGFP-G
2.5. Production of PEDV S Pseudotyped rVSV-ΔG-EGFP-S and Infection
2.6. 25-Hydroxycholesterol (25HC) Treatment and PEDV Pseudovirus Infection
2.7. Flow Cytometry Analysis
2.8. ANPEP Knockout in Huh7
2.9. RT-qPCR for PEDV Titer
2.10. Western blotting
2.11. Porcine Intestinal Organoid Culture and Transduction
2.12. Statistical Analyses
3. Result
3.1. Generation of Replication-Deficient PEDV S Pseudotyped rVSV-ΔG-EGFP-S
3.2. Characterizing the Entry of rVSV-ΔG-EGFP-S on Several Cell Lines
3.3. C-Terminal Truncation of PEDV Spike Decreases the Efficiency of Viral Pseudotyping
3.4. 25-Hydroxycholesterol Inhibits the Pseudovirus rVSV-ΔG-EGFP-S Entry
3.5. Human ANPEP Facilitates rVSV-ΔG-EGFP-S Entry
3.6. rVSV-ΔG-EGFP-S Infects Swine Intestinal Organoids
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wood, E.N. An apparently new syndrome of porcine epidemic diarrhoea. Vet. Rec. 1977, 100, 243–244. [Google Scholar] [CrossRef]
- Stevenson, G.W.; Hoang, H.; Schwartz, K.J.; Burrough, E.R.; Sun, D.; Madson, D.; Cooper, V.L.; Pillatzki, A.; Gauger, P.; Schmitt, B.J.; et al. Emergence of Porcine epidemic diarrhea virus in the United States: Clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Investig. 2013, 25, 649–654. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.M.; Niu, B.B.; Yan, H.; Gao, D.S.; Yang, X.; Chen, L.; Chang, H.T.; Zhao, J.; Wang, C.Q. Genetic properties of endemic Chinese porcine epidemic diarrhea virus strains isolated since 2010. Arch. Virol. 2013, 158, 2487–2494. [Google Scholar] [CrossRef]
- Duarte, M.; Tobler, K.; Bridgen, A.; Rasschaert, D.; Ackermann, M.; Laude, H. Sequence analysis of the porcine epidemic diarrhea virus genome between the nucleocapsid and spike protein genes reveals a polymorphic ORF. Virology 1994, 198, 466–476. [Google Scholar] [CrossRef] [PubMed]
- Kocherhans, R.; Bridgen, A.; Ackermann, M.; Tobler, K. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 2001, 23, 137–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; van Kuppeveld, F.J.M.; He, Q.; Rottier, P.J.M.; Bosch, B.J. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e278. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Moore, M.J.; Vasilieva, N.; Sui, J.; Wong, S.K.; Berne, M.A.; Somasundaran, M.; Sullivan, J.L.; Luzuriaga, K.; Greenough, T.C.; et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature 2003, 426, 450–454. [Google Scholar] [CrossRef] [Green Version]
- Raj, V.S.; Mou, H.; Smits, S.L.; Dekkers, D.H.; Muller, M.A.; Dijkman, R.; Muth, D.; Demmers, J.A.; Zaki, A.; Fouchier, R.A.; et al. Dipeptidyl peptidase 4 is a functional receptor for the emerging human coronavirus-EMC. Nature 2013, 495, 251–254. [Google Scholar] [CrossRef] [Green Version]
- Williams, R.K.; Jiang, G.S.; Holmes, K.V. Receptor for mouse hepatitis virus is a member of the carcinoembryonic antigen family of glycoproteins. Proc. Natl. Acad. Sci. USA 1991, 88, 5533–5536. [Google Scholar] [CrossRef]
- Delmas, B.; Gelfi, J.; L’Haridon, R.; Vogel, L.K.; Sjostrom, H.; Noren, O.; Laude, H. Aminopeptidase N is a major receptor for the entero-pathogenic coronavirus TGEV. Nature 1992, 357, 417–420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Tang, J.; Ma, Y.; Liang, X.; Yang, Y.; Peng, G.; Qi, Q.; Jiang, S.; Li, J.; Du, L.; et al. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J. Virol. 2015, 89, 6121–6125. [Google Scholar] [CrossRef] [Green Version]
- Li, B.X.; Ge, J.W.; Li, Y.J. Porcine aminopeptidase N is a functional receptor for the PEDV coronavirus. Virology 2007, 365, 166–172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Luo, R.; He, Q.; van Kuppeveld, F.J.M.; Rottier, P.J.M.; Bosch, B.J. Aminopeptidase N is not required for porcine epidemic diarrhea virus cell entry. Virus Res. 2017, 235, 6–13. [Google Scholar] [CrossRef] [Green Version]
- Ji, C.M.; Wang, B.; Zhou, J.; Huang, Y.W. Aminopeptidase-N-independent entry of porcine epidemic diarrhea virus into Vero or porcine small intestine epithelial cells. Virology 2018, 517, 16–23. [Google Scholar] [CrossRef]
- Shirato, K.; Maejima, M.; Islam, M.T.; Miyazaki, A.; Kawase, M.; Matsuyama, S.; Taguchi, F. Porcine aminopeptidase N is not a cellular receptor of porcine epidemic diarrhea virus, but promotes its infectivity via aminopeptidase activity. J. Gen. Virol. 2016, 97, 2528–2539. [Google Scholar] [CrossRef]
- Luo, L.; Wang, S.; Zhu, L.; Fan, B.; Liu, T.; Wang, L.; Zhao, P.; Dang, Y.; Sun, P.; Chen, J.; et al. Aminopeptidase N-null neonatal piglets are protected from transmissible gastroenteritis virus but not porcine epidemic diarrhea virus. Sci. Rep. 2019, 9, 13186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huan, C.C.; Wang, Y.; Ni, B.; Wang, R.; Huang, L.; Ren, X.F.; Tong, G.Z.; Ding, C.; Fan, H.J.; Mao, X. Porcine epidemic diarrhea virus uses cell-surface heparan sulfate as an attachment factor. Arch. Virol. 2015, 160, 1621–1628. [Google Scholar] [CrossRef]
- Luo, X.; Guo, L.; Zhang, J.; Xu, Y.; Gu, W.; Feng, L.; Wang, Y. Tight Junction Protein Occludin Is a Porcine Epidemic Diarrhea Virus Entry Factor. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Cao, Y.; Yang, Q. Transferrin receptor 1 levels at the cell surface influence the susceptibility of newborn piglets to PEDV infection. PLoS Pathog. 2020, 16, e1008682. [Google Scholar] [CrossRef]
- Wrapp, D.; McLellan, J.S. The 3.1-Angstrom Cryo-electron Microscopy Structure of the Porcine Epidemic Diarrhea Virus Spike Protein in the Prefusion Conformation. J. Virol. 2019, 93. [Google Scholar] [CrossRef] [Green Version]
- Lv, L.; Luo, H.; Yu, L.; Tong, W.; Jiang, Y.; Li, G.; Tong, G.; Li, Y.; Liu, C. Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection. Viruses 2022, 14, 2754. [Google Scholar] [CrossRef]
- Lichty, B.D.; Power, A.T.; Stojdl, D.F.; Bell, J.C. Vesicular stomatitis virus: Re-inventing the bullet. Trends Mol. Med. 2004, 10, 210–216. [Google Scholar] [CrossRef]
- Whelan, S.P.; Ball, L.A.; Barr, J.N.; Wertz, G.T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proc. Natl. Acad. Sci. USA 1995, 92, 8388–8392. [Google Scholar] [CrossRef] [PubMed]
- Whitt, M.A. Generation of VSV pseudotypes using recombinant DeltaG-VSV for studies on virus entry, identification of entry inhibitors, and immune responses to vaccines. J. Virol. Methods 2010, 169, 365–374. [Google Scholar] [CrossRef] [Green Version]
- Yang, F.; Tan, J.; Fang, Y.; Chen, G.; Zhang, Y.; Hu, Q.; Han, W.; Liu, Y.; Fu, B.; Jing, Z.; et al. The Multiplicity of Infection of Recombinant Vaccinia Virus Expressing the T7 RNA Polymerase Determines the Rescue Efficiency of Vesicular Stomatitis Virus. Front. Microbiol. 2022, 13, 846426. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Banister, C.E.; Buckhaults, P.J. Spindle Assembly Checkpoint Inhibition Can Resensitize p53-Null Stem Cells to Cancer Chemotherapy. Cancer Res. 2019, 79, 2392–2403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Banister, C.E.; Weige, C.C.; Altomare, D.; Richardson, J.H.; Contreras, C.M.; Buckhaults, P.J. PRDM1 silences stem cell-related genes and inhibits proliferation of human colon tumor organoids. Proc. Natl. Acad. Sci. USA 2018, 115, E5066–E5075. [Google Scholar] [CrossRef] [Green Version]
- Zhang, M.; Lv, L.; Cai, H.; Li, Y.; Gao, F.; Yu, L.; Jiang, Y.; Tong, W.; Li, L.; Li, G.; et al. Long-Term Expansion of Porcine Intestinal Organoids Serves as an in vitro Model for Swine Enteric Coronavirus Infection. Front. Microbiol. 2022, 13, 865336. [Google Scholar] [CrossRef]
- Fukushi, S.; Mizutani, T.; Saijo, M.; Matsuyama, S.; Miyajima, N.; Taguchi, F.; Itamura, S.; Kurane, I.; Morikawa, S. Vesicular stomatitis virus pseudotyped with severe acute respiratory syndrome coronavirus spike protein. J. Gen. Virol. 2005, 86, 2269–2274. [Google Scholar] [CrossRef]
- Nie, J.; Li, Q.; Wu, J.; Zhao, C.; Hao, H.; Liu, H.; Zhang, L.; Nie, L.; Qin, H.; Wang, M.; et al. Establishment and validation of a pseudovirus neutralization assay for SARS-CoV-2. Emerg. Microbes Infect. 2020, 9, 680–686. [Google Scholar] [CrossRef] [Green Version]
- Nie, J.; Li, Q.; Wu, J.; Zhao, C.; Hao, H.; Liu, H.; Zhang, L.; Nie, L.; Qin, H.; Wang, M.; et al. Quantification of SARS-CoV-2 neutralizing antibody by a pseudotyped virus-based assay. Nat. Protoc. 2020, 15, 3699–3715. [Google Scholar] [CrossRef]
- Quinn, K.; Brindley, M.A.; Weller, M.L.; Kaludov, N.; Kondratowicz, A.; Hunt, C.L.; Sinn, P.L.; McCray, P.B., Jr.; Stein, C.S.; Davidson, B.L.; et al. Rho GTPases modulate entry of Ebola virus and vesicular stomatitis virus pseudotyped vectors. J. Virol. 2009, 83, 10176–10186. [Google Scholar] [CrossRef] [Green Version]
- Stubbs, S.H.; Cornejo Pontelli, M.; Mishra, N.; Zhou, C.; de Paula Souza, J.; Mendes Viana, R.M.; Lipkin, W.I.; Knipe, D.M.; Arruda, E.; Whelan, S.P.J. Vesicular Stomatitis Virus Chimeras Expressing the Oropouche Virus Glycoproteins Elicit Protective Immune Responses in Mice. mBio 2021, 12, e0046321. [Google Scholar] [CrossRef]
- Negrete, O.A.; Levroney, E.L.; Aguilar, H.C.; Bertolotti-Ciarlet, A.; Nazarian, R.; Tajyar, S.; Lee, B. EphrinB2 is the entry receptor for Nipah virus, an emergent deadly paramyxovirus. Nature 2005, 436, 401–405. [Google Scholar] [CrossRef]
- Ma, J.; Chen, R.; Huang, W.; Nie, J.; Liu, Q.; Wang, Y.; Yang, X. In vitro and in vivo efficacy of a Rift Valley fever virus vaccine based on pseudovirus. Hum. Vaccin. Immunother. 2019, 15, 2286–2294. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Deng, F.; Ye, G.; Dong, W.; Zheng, A.; He, Q.; Peng, G. Comparison of lentiviruses pseudotyped with S proteins from coronaviruses and cell tropisms of porcine coronaviruses. Virol. Sin. 2016, 31, 49–56. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.Y.; Huang, C.; Tian, L.; Huang, X.; Zhang, C.; Llewellyn, G.N.; Rogers, G.L.; Andresen, K.; O’Gorman, M.R.G.; Chen, Y.W.; et al. Cytoplasmic Tail Truncation of SARS-CoV-2 Spike Protein Enhances Titer of Pseudotyped Vectors but Masks the Effect of the D614G Mutation. J. Virol. 2021, 95, e0096621. [Google Scholar] [CrossRef]
- Johnson, M.C.; Lyddon, T.D.; Suarez, R.; Salcedo, B.; LePique, M.; Graham, M.; Ricana, C.; Robinson, C.; Ritter, D.G. Optimized Pseudotyping Conditions for the SARS-COV-2 Spike Glycoprotein. J. Virol. 2020, 94. [Google Scholar] [CrossRef]
- Yu, J.; Li, Z.; He, X.; Gebre, M.S.; Bondzie, E.A.; Wan, H.; Jacob-Dolan, C.; Martinez, D.R.; Nkolola, J.P.; Baric, R.S.; et al. Deletion of the SARS-CoV-2 Spike Cytoplasmic Tail Increases Infectivity in Pseudovirus Neutralization Assays. J. Virol. 2021, 95. [Google Scholar] [CrossRef]
- Fu, X.; Tao, L.; Zhang, X. Comprehensive and systemic optimization for improving the yield of SARS-CoV-2 spike pseudotyped virus. Mol. Ther. Methods Clin. Dev. 2021, 20, 350–356. [Google Scholar] [CrossRef]
- Zhang, Y.; Song, Z.; Wang, M.; Lan, M.; Zhang, K.; Jiang, P.; Li, Y.; Bai, J.; Wang, X. Cholesterol 25-hydroxylase negatively regulates porcine intestinal coronavirus replication by the production of 25-hydroxycholesterol. Vet Microbiol 2019, 231, 129–138. [Google Scholar] [CrossRef]
- Ke, W.; Wu, X.; Fang, P.; Zhou, Y.; Fang, L.; Xiao, S. Cholesterol 25-hydroxylase suppresses porcine deltacoronavirus infection by inhibiting viral entry. Virus Res. 2021, 295, 198306. [Google Scholar] [CrossRef]
- Zhang, J.; Yang, G.; Wang, X.; Zhu, Y.; Wang, J. 25-Hydroxycholesterol Mediates Cholesterol Metabolism to Restrict Porcine Deltacoronavirus Infection via Suppression of Transforming Growth Factor beta1. Microbiol. Spectr. 2022, 10, e0219822. [Google Scholar] [CrossRef]
- Zang, R.; Case, J.B.; Yutuc, E.; Ma, X.; Shen, S.; Gomez Castro, M.F.; Liu, Z.; Zeng, Q.; Zhao, H.; Son, J.; et al. Cholesterol 25-hydroxylase suppresses SARS-CoV-2 replication by blocking membrane fusion. Proc. Natl. Acad. Sci. USA 2020, 117, 32105–32113. [Google Scholar] [CrossRef]
- Mao, S.; Ren, J.; Xu, Y.; Lin, J.; Pan, C.; Meng, Y.; Xu, N. Studies in the antiviral molecular mechanisms of 25-hydroxycholesterol: Disturbing cholesterol homeostasis and post-translational modification of proteins. Eur. J. Pharmacol. 2022, 926, 175033. [Google Scholar] [CrossRef]
- Clevers, H. Modeling Development and Disease with Organoids. Cell 2016, 165, 1586–1597. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Fu, F.; Guo, S.; Wang, H.; He, X.; Xue, M.; Yin, L.; Feng, L.; Liu, P. Porcine Intestinal Enteroids: A New Model for Studying Enteric Coronavirus Porcine Epidemic Diarrhea Virus Infection and the Host Innate Response. J. Virol. 2019, 93. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Yang, N.; Chen, J.; Huang, X.; Zhang, N.; Yang, S.; Liu, G.; Liu, G. Next-Generation Porcine Intestinal Organoids: An Apical-Out Organoid Model for Swine Enteric Virus Infection and Immune Response Investigations. J. Virol. 2020, 94. [Google Scholar] [CrossRef]
- Lin, F.; Zhang, H.; Li, L.; Yang, Y.; Zou, X.; Chen, J.; Tang, X. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses 2022, 14, 1744. [Google Scholar] [CrossRef]
- Chen, J.; Cui, Y.; Wang, Z.; Liu, G. Identification and characterization of PEDV infection in rat crypt epithelial cells. Vet. Microbiol. 2020, 249, 108848. [Google Scholar] [CrossRef]
- Chen, J.; Kovacs, J.M.; Peng, H.; Rits-Volloch, S.; Lu, J.; Park, D.; Zablowsky, E.; Seaman, M.S.; Chen, B. HIV-1 ENVELOPE. Effect of the cytoplasmic domain on antigenic characteristics of HIV-1 envelope glycoprotein. Science 2015, 349, 191–195. [Google Scholar] [CrossRef]
- Cathomen, T.; Naim, H.Y.; Cattaneo, R. Measles viruses with altered envelope protein cytoplasmic tails gain cell fusion competence. J. Virol. 1998, 72, 1224–1234. [Google Scholar] [CrossRef]
- Gomes, B.; Goncalves, S.; Disalvo, A.; Hollmann, A.; Santos, N.C. Effect of 25-hydroxycholesterol in viral membrane fusion: Insights on HIV inhibition. Biochim. Biophys. Acta Biomembr. 2018, 1860, 1171–1178. [Google Scholar] [CrossRef]
- Liu, S.Y.; Aliyari, R.; Chikere, K.; Li, G.; Marsden, M.D.; Smith, J.K.; Pernet, O.; Guo, H.; Nusbaum, R.; Zack, J.A.; et al. Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol. Immunity 2013, 38, 92–105. [Google Scholar] [CrossRef] [Green Version]
- Li, C.; Deng, Y.Q.; Wang, S.; Ma, F.; Aliyari, R.; Huang, X.Y.; Zhang, N.N.; Watanabe, M.; Dong, H.L.; Liu, P.; et al. 25-Hydroxycholesterol Protects Host against Zika Virus Infection and Its Associated Microcephaly in a Mouse Model. Immunity 2017, 46, 446–456. [Google Scholar] [CrossRef] [Green Version]
- Zu, S.; Deng, Y.Q.; Zhou, C.; Li, J.; Li, L.; Chen, Q.; Li, X.F.; Zhao, H.; Gold, S.; He, J.; et al. 25-Hydroxycholesterol is a potent SARS-CoV-2 inhibitor. Cell Res. 2020, 30, 1043–1045. [Google Scholar] [CrossRef]
- Wang, S.; Li, W.; Hui, H.; Tiwari, S.K.; Zhang, Q.; Croker, B.A.; Rawlings, S.; Smith, D.; Carlin, A.F.; Rana, T.M. Cholesterol 25-Hydroxylase inhibits SARS-CoV-2 and other coronaviruses by depleting membrane cholesterol. EMBO J. 2020, 39, e106057. [Google Scholar] [CrossRef]
Oligo Name | Sequence (5′-3′) | Purpose |
---|---|---|
PEDV-S-F | CCGGAATTCATGACCCCCCTGATC | PCR |
PEDV-S-R | CCGCTCGAGTCACTGCACGTGCAC | PCR |
PEDV-SCΔ7-R | CCGCTCGAGTCAGGCTTCGTA | Truncation PCR |
PEDV-SCΔ10-R | CCGCTCGAGTCAGGGCTGCAGTCTA | Truncation PCR |
PEDV-SCΔ19-R | CCGCTCGAGTCAGCCACTAAAGCA | Truncation PCR |
PEDV-SCΔ20-R | CCGCTCGAGTCAACTAAAGCAGGCG | Truncation PCR |
PEDV-SCΔ30-R | CCGCTCGAGTCACCCGCAACAG | Truncation PCR |
ANPEP-sgRNA-1 | CCTTGGACCAAAGTAAAGCG | Knockout |
ANPEP-sgRNA-2 | ACGGGGTGGTGGAGGCCACG | Knockout |
ANPEP-ID-F | CTGCAGCCTGTAACCAGACA | Knockout PCR |
ANPEP-ID-R | GTCATTGGGGGTGAGGTACG | Knockout PCR |
PEDV-qPCR-F | GAAGGCGCAAAGACTGAACC | Virus titer |
PEDV-qPCR-R | TTGCCATTGCCACGACTCCT | Virus titer |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, H.; Lv, L.; Yi, J.; Zhou, Y.; Liu, C. Establishment of Replication Deficient Vesicular Stomatitis Virus for Studies of PEDV Spike-Mediated Cell Entry and Its Inhibition. Microorganisms 2023, 11, 2075. https://doi.org/10.3390/microorganisms11082075
Luo H, Lv L, Yi J, Zhou Y, Liu C. Establishment of Replication Deficient Vesicular Stomatitis Virus for Studies of PEDV Spike-Mediated Cell Entry and Its Inhibition. Microorganisms. 2023; 11(8):2075. https://doi.org/10.3390/microorganisms11082075
Chicago/Turabian StyleLuo, Huaye, Lilei Lv, Jingxuan Yi, Yanjun Zhou, and Changlong Liu. 2023. "Establishment of Replication Deficient Vesicular Stomatitis Virus for Studies of PEDV Spike-Mediated Cell Entry and Its Inhibition" Microorganisms 11, no. 8: 2075. https://doi.org/10.3390/microorganisms11082075