Vibrio splendidus AJ01 Promotes Pathogenicity via L-Glutamic Acid
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Bacterial Strain
2.2. Coelomocyte Viability Assay
2.3. Histological Analysis
2.4. Immersion Infection Experiment
2.5. Transcriptomic Library Construction
2.6. Real-Time Quantitative Reverse Transcription PCR (qRT‒PCR)
2.7. Growth Measurement
2.8. Swimming Motility Analysis
2.9. Data Accession Number
3. Results
3.1. The Effect of L-Glu on Sea Cucumbers
3.2. L-Glu Affected the Immune-Related Pathways in Sea Cucumbers
3.3. L-Glu Promoted the Virulence of V. splendidus AJ01
3.4. L-Glu Promoted the Growth and Swimming Motility of V. splendidus AJ01
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Jiang, C.; Tanaka, M.; Nishikawa, S.; Mino, S.; Romalde, J.L.; Thompson, F.L.; Gomez-Gil, B.; Sawabe, T. Vibrio Clade 3.0: New Vibrionaceae evolutionary units using genome-based approach. Curr. Microbiol. 2021, 79, 10. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.; Kasai, H.; Mino, S.; Romalde, J.L.; Sawabe, T. The pan-genome of Splendidus clade species in the family Vibrionaceae: Insights into evolution, adaptation, and pathogenicity. Environ. Microbiol. 2022, 24, 4587–4606. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, C.H. Virulence mechanisms of Splendidus clade strains, emerging aquaculture pathogens, from case studies and the genome database. Rev. Aquac. 2021, 13, 2004–2026. [Google Scholar] [CrossRef]
- Gatesoupe, F.J.; Lambert, C.; Nicolas, J.L. Pathogenicity of Vibrio splendidus strains associated with turbot larvae, Scophthalmus maximus. J. Appl. Microbiol. 1999, 87, 757–763. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Qiu, L.; Yu, Z.; Zi, J.; Yue, F.; Wang, L.; Song, L. Identifification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 2013, 114, 144–150. [Google Scholar] [CrossRef] [PubMed]
- Garnier, M.; Labreuche, Y.; Garcia, C.; Robert, M.; Nicolas, J.L. Evidence for the involvement of pathogenic bacteria in summer mortalities of the Pacifific oyster Crassostrea gigas. Microb. Ecol. 2007, 53, 187–196. [Google Scholar] [CrossRef] [PubMed]
- Gevers, D.; Cohan, F.M.; Lawrence, J.G.; Spratt, B.G.; Coenye, T.; Feil, E.J.; Stackebrandt, E.; Van de Peer, Y.; Vandamme, P.; Thompson, F.L.; et al. Opinion: Re-evaluating prokaryotic species. Nat. Rev. Microbiol. 2005, 3, 733–739. [Google Scholar] [CrossRef]
- Charles, M.; Trancart, S.; Oden, E.; Houssin, M. Experimental infection of Mytilus edulis by two Vibrio splendidus-related strains: Determination of pathogenicity level of strains and influence of the origin and annual cycle of mussels on their sensitivity. J. Fish. Dis. 2020, 43, 9–21. [Google Scholar] [CrossRef]
- Gao, Q.; Liao, M.; Wang, Y.; Li, B.; Zhang, Z.; Rong, X.; Chen, G.; Wang, L. Transcriptome analysis and discovery of genes involved in immune pathways from coelomocytes of sea cucumber (Apostichopus japonicus) after Vibrio splendidus challenge. Int. J. Mol. Sci. 2015, 16, 16347–16377. [Google Scholar] [CrossRef]
- Duperthuy, M.; Binesse, J.; Le Roux, F.; Romestand, B.; Caro, A.; Got, P.; Givaudan, A.; Mazel, D.; Bachère, E.; Destoumieux-Garzón, D. The major outer membrane protein OmpU of Vibrio splendidus contributes to host antimicrobial peptide resistance and is required for virulence in the oyster Crassostrea gigas. Environ. Microbiol. 2010, 12, 951–963. [Google Scholar] [CrossRef]
- Binesse, J.; Delsert, C.; Saulnier, D.; Champomier-Vergès, M.C.; Zagorec, M.; Munier-Lehmann, H.; Le Roux, F. Metalloprotease vsm is the major determinant of toxicity for extracellular products of Vibrio splendidus. Appl. Environ. Microbiol. 2008, 74, 7108–7117. [Google Scholar] [CrossRef] [PubMed]
- Vanhove, A.S.; Duperthuy, M.; Charrière, G.M.; Le Roux, F.; Goudenège, D.; Gourbal, B.; Destoumieux-Garzón, D. Outer membrane vesicles are vehicles for the delivery of Vibrio tasmaniensis virulence factors to oyster immune cells. Environ. Microbiol. 2015, 17, 1152–1165. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yang, H.R.; Zhang, J.X.; Shi, W.B.; Li, W.S.; Zhang, W.W. VspC from Vibrio splendidus is responsible for collagen degradation in Apostichopus japonicus. Aquaculture 2023, 571, 739489. [Google Scholar] [CrossRef]
- Oyanedel, D.; Labreuche, Y.; Bruto, M.; Amraoui, H.; Robino, E.; Haffner, P.; Rubio, T.; Charrière, G.M.; Le Roux, F.; Destoumieux-Garzón, D. Vibrio splendidus O-antigen structure: A trade-off between virulence to oysters and resistance to grazers. Environ. Microbiol. 2020, 22, 4264–4278. [Google Scholar] [CrossRef]
- Dai, F.; Li, Y.; Shao, Y.N.; Li, C.H.; Zhang, W.W. FliC of Vibrio splendidus-related strain involved in adhesion to Apostichopus japonicus. Microb. Pathog. 2020, 149, 104503. [Google Scholar] [CrossRef]
- Dai, F.; Guo, M.; Shao, Y.; Li, C. Vibrio splendidus flagellin C binds tropomodulin to induce p38 MAPK-mediated p53-dependent coelomocyte apoptosis in Echinodermata. J. Biol. Chem. 2022, 298, 102091. [Google Scholar] [CrossRef]
- Scharf, B.E.; Hynes, M.F.; Alexandre, G.M. Chemotaxis signaling systems in model beneficial plant-bacteria associations. Plant Mol. Biol. 2016, 90, 549–559. [Google Scholar] [CrossRef] [PubMed]
- Pashaei, S.; Yarani, R.; Mohammadi, P.; Emami Aleagha, M.S. The potential roles of amino acids and their major derivatives in the management of multiple sclerosis. Amino. Acids. 2022, 54, 841–858. [Google Scholar] [CrossRef] [PubMed]
- Olive, A.J.; Sassetti, C.M. Metabolic crosstalk between host and pathogen: Sensing, adapting and competing. Nat. Rev. Microbiol. 2016, 14, 221–234. [Google Scholar] [CrossRef]
- Yang, J.; Sun, C.; Fu, D.; Yu, T. Test for l-glutamate inhibition of growth of Alternaria alternata by inducing resistance in tomato fruit. Food Chem. 2017, 230, 145–153. [Google Scholar] [CrossRef]
- Ren, W.; Rajendran, R.; Zhao, Y.; Tan, B.; Wu, G.; Bazer, F.W.; Zhu, G.; Peng, Y.; Huang, X.; Deng, J.; et al. Amino acids as mediators of metabolic cross talk between host and pathogen. Front. Immunol. 2018, 9, 319. [Google Scholar] [CrossRef]
- Brosnan, J.T.; Brosnan, M.E. Glutamate: A truly functional amino acid. Amino. Acids. 2013, 45, 413–418. [Google Scholar] [CrossRef] [PubMed]
- O’Malley, M.R.; Kpenu, E.; Peck, S.C.; Anderson, J.C. Plant-exuded chemical signals induce surface attachment of the bacterial pathogen Pseudomonas syringae. Peer J. 2023, 11, e14862. [Google Scholar] [CrossRef] [PubMed]
- Shen, F.; Yin, W.; Song, S.; Zhang, Z.; Ye, P.; Zhang, Y.; Zhou, J.; He, F.; Li, P.; Deng, Y. Ralstonia solanacearum promotes pathogenicity by utilizing l-glutamic acid from host plants. Mol. Plant Pathol. 2020, 21, 1099–1110. [Google Scholar] [CrossRef] [PubMed]
- Shao, Y.; Li, C.; Chen, X. Metabolomic responses of sea cucumber Apostichopus japonicus to thermal stresses. Aquaculture 2015, 435, 390–397. [Google Scholar] [CrossRef]
- Jiang, G.; Li, Y.; Li, Y.; Zhang, W.; Li, C. Selection of the amino acid and saccharide that increase the tetracycline susceptibility of Vibrio splendidus. Front. Vet. Sci. 2022, 8, 823332. [Google Scholar] [CrossRef]
- Zhang, P.J.; Li, C.H.; Zhang, P.; Jin, C.H.; Pan, D.D.; Bao, Y.B. iTRAQ-based proteomics reveals novel members involved in pathogen challenge in sea cucumber Apostichopus japonicus. PLoS ONE 2014, 9, e100492. [Google Scholar] [CrossRef] [PubMed]
- Lv, Z.; Guo, M.; Zhao, X.; Shao, Y.; Zhang, W.; Li, C. IL-17/IL-17 Receptor pathway-mediated inflammatory response in Apostichopus japonicus supports the conserved functions of cytokines in invertebrates. J. Immunol. 2022, 208, 464–479. [Google Scholar] [CrossRef]
- Li, Y.; Dai, F.; Li, Y.N.; Liang, W.K.; Li, C.H.; Zhang, W.W. Hfq, a global regulator contributes to the virulence of Vibrio splendidus AJ01. Aquaculture 2022, 546, 737416. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT, a fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome. Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Liang, W.; Zhang, W.; Li, C. Characterization of a metalloprotease involved in Vibrio splendidus infection in the sea cucumber, Apostichopus japonicus. Microb. Pathog. 2016, 101, 96–103. [Google Scholar] [CrossRef] [PubMed]
- Liang, W.K.; Zhang, C.; Liu, N.N.; Zhang, W.W.; Han, Q.X.; Li, C.H. Cloning and characterization of Vshppd, a gene inducing haemolysis and immune response of Apostichopus japonicus. Aquaculture 2016, 464, 246–252. [Google Scholar] [CrossRef]
- Zhuang, Q.T.; Dai, F.; Zhao, X.L.; Shao, Y.N.; Guo, M.; Lv, Z.M.; Li, C.H.; Zhang, W.W. Cloning and characterization of the virulence factor Hop from Vibrio splendidus. Microb. Pathog. 2020, 139, 103900. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Valdebenito, I.; Moreno, C.; Lozano, C.; Ubilla, A. Effect of L-glutamate and glycine incorporated in activation media, on sperm motility and fertilization rate of rainbow trout (Oncorhynchus mykiss) spermatozoa. J. Appl. Ichthyol. 2010, 26, 702–706. [Google Scholar] [CrossRef]
- Li, X.; Zheng, S.; Wu, G. Nutrition and metabolism of glutamate and glutamine in fish. Amino. Acids. 2020, 52, 671–691. [Google Scholar] [CrossRef]
- Cheng, Z.; Buentello, A.; Gatlin, D.M., III. Effects of dietary arginine and glutamine on growth performance, immune responses and intestinal structure of red drum, Sciaenops ocellatus. Aquaculture 2011, 319, 247–252. [Google Scholar] [CrossRef]
- Schousboe, A.; Scafidi, S.; Bak, L.K.; Waagepetersen, H.S.; McKenna, M.C. Glutamate metabolism in the brain focusing on astrocytes. Adv. Neurobiol. 2014, 11, 13–30. [Google Scholar]
- Cossart, P.; Helenius, A. Endocytosis of viruses and bacteria. Cold Spring Harb. Perspect. Biol. 2014, 6, a016972. [Google Scholar] [CrossRef]
- Chen, K.; Zhang, S.; Shao, Y.; Guo, M.; Zhang, W.; Li, C. A unique NLRC4 receptor from echinoderms mediates Vibrio phagocytosis via rearrangement of the cytoskeleton and polymerization of F-actin. PLoS Pathog. 2021, 17, e1010145. [Google Scholar] [CrossRef]
- Buratta, S.; Tancini, B.; Sagini, K.; Delo, F.; Chiaradia, E.; Urbanelli, L.; Emiliani, C. Lysosomal exocytosis, exosome release and secretory autophagy: The autophagic- and endo-lysosomal systems go extracellular. Int. J. Mol. Sci. 2020, 21, 2576. [Google Scholar] [CrossRef] [PubMed]
- Dai, F.; Guo, M.; Shao, Y.; Li, C. Novel secreted STPKLRR from Vibrio splendidus AJ01 promotes pathogen internalization via mediating tropomodulin phosphorylation dependent cytoskeleton rearrangement. PLoS Pathog. 2023, 19, e1011419. [Google Scholar] [CrossRef] [PubMed]
- D'Souza-Schorey, C.; Chavrier, P. ARF proteins: Roles in membrane traffic and beyond. Nat. Rev. Mol. Cell Biol. 2006, 7, 347–358. [Google Scholar] [CrossRef] [PubMed]
- Reiling, J.H.; Olive, A.J.; Sanyal, S.; Carette, J.E.; Brummelkamp, T.R.; Ploegh, H.L.; Starnbach, M.N.; Sabatini, D.M. A CREB3-ARF4 signalling pathway mediates the response to Golgi stress and susceptibility to pathogens. Nat. Cell Biol. 2013, 15, 1473–1485. [Google Scholar] [CrossRef]
- Tattoli, I.; Sorbara, M.T.; Vuckovic, D.; Ling, A.; Soares, F.; Carneiro, L.A.; Yang, C.; Emili, A.; Philpott, D.J.; Girardin, S.E. Amino acid starvation induced by invasive bacterial pathogens triggers an innate host defense program. Cell Host. Microb. 2012, 11, 563–575. [Google Scholar] [CrossRef]
- Goto, Y.; Maki, N.; Ichihashi, Y.; Kitazawa, D.; Igarashi, D.; Kadota, Y.; Shirasu, K. Exogenous treatment with glutamate induces immune responses in arabidopsis. Mol. Plant Microb. Interact. 2020, 33, 474–487. [Google Scholar] [CrossRef]
- Nishiyama, S.; Suzuki, D.; Itoh, Y.; Suzuki, K.; Tajima, H.; Hyakutake, A.; Homma, M.; Butler-Wu, S.M.; Camilli, A.; Kawagishi, I. Mlp24 (McpX) of Vibrio cholerae implicated in pathogenicity functions as a chemoreceptor for multiple amino acids. Infect. Immun. 2012, 80, 3170–3178. [Google Scholar] [CrossRef]
Primer | Sequence (5′→3′) |
---|---|
933F | GCACAAGCGGTGGAGCATGTGG |
16SRTR1 | CGTGTGTAGCCCTGGTCGTA |
qtvspCF | GACAGAAACACCGACACCTCC |
qtvspCR | CATTCTCCGCATTGTCACTCT |
qtvsmF | AAACGAAAGTCCGCTACCA |
qtvsmR | CCATTGACCCGAACACCT |
qtfliCF | TACCGACTACGCCAAAGAAA |
qtfliCR | CCCAGTAAGGTTAAGGCAAGA |
qthopF | GAGGCGAACTATGACTTTTCTGAG |
qthopR | TCTTCAGCCCATACAATCCA |
qtvshppdF | GCCAAGCACCGTTCAAAAGA |
qtvshppdR | CGAATGTTTTGATGGTCGGTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Shi, W.; Zhang, W. Vibrio splendidus AJ01 Promotes Pathogenicity via L-Glutamic Acid. Microorganisms 2023, 11, 2333. https://doi.org/10.3390/microorganisms11092333
Li Y, Shi W, Zhang W. Vibrio splendidus AJ01 Promotes Pathogenicity via L-Glutamic Acid. Microorganisms. 2023; 11(9):2333. https://doi.org/10.3390/microorganisms11092333
Chicago/Turabian StyleLi, Ya, Weibo Shi, and Weiwei Zhang. 2023. "Vibrio splendidus AJ01 Promotes Pathogenicity via L-Glutamic Acid" Microorganisms 11, no. 9: 2333. https://doi.org/10.3390/microorganisms11092333
APA StyleLi, Y., Shi, W., & Zhang, W. (2023). Vibrio splendidus AJ01 Promotes Pathogenicity via L-Glutamic Acid. Microorganisms, 11(9), 2333. https://doi.org/10.3390/microorganisms11092333