Biofilm Formation in Campylobacter concisus: The Role of the luxS Gene
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Plasmids
2.2. Bacterial Growth Conditions
2.3. Crystal Violet (CV) Assay to Assess Biofilm-Formation by C. concisus Isolates
2.4. Phenotypic Characterization of C. concisus Biofilm
2.4.1. Phase Contrast Microscopy
2.4.2. Confocal Laser Scanning Microscopy (CLSM)
2.4.3. Scanning Electron Microscopy (SEM)
2.4.4. Transmission Electron Microscopy (TEM)
2.5. Genomic DNA Extraction
2.6. RNA Extraction
2.7. PCR of luxS in C. concisus
2.8. Construction of Insertional luxS Mutant and Complementary Plasmid
2.9. Natural Transformation of pBKluxSkan in C. concisus
2.10. Whole Genome Sequencing and Assembly
2.11. Motility Assay
2.12. Adhesion and Invasion Assay
2.13. Expression of Flagellin Gene flaB by RT-qPCR
3. Results
3.1. Screening of Biofilm-Forming C. concisus through Quantitative Crystal Violet (CV) Assay
3.2. Phenotypic Characterization of C. concisus Biofilm
3.3. Molecular Detection of luxS in C. concisus
3.4. Construction of C. concisus ΔluxS Mutant, Complementary Plasmid, and Whole Genome Sequence Analysis
3.5. Phenotypic Characterization of the ΔluxS Mutant
3.6. Expression of Flagellin Gene
4. Discussion
5. Conclusions and Future Directions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Teksoy, N.; Ilktac, M.; Ongen, B. Investigating the Significance of Non-jejuni/coli Campylobacter Strains in Patients with Diarrhea. Healthcare 2023, 11, 2562. [Google Scholar] [CrossRef] [PubMed]
- Lastovica, A.J.; Le Roux, E. Efficient isolation of campylobacteria from stools. J. Clin. Microbiol. 2000, 38, 2798–2799. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Man, S.M.; Day, A.S.; Leach, S.T.; Lemberg, D.A.; Dutt, S.; Stormon, M.; Otley, A.; O’Loughlin, E.V.; Magoffin, A.; et al. Detection and isolation of Campylobacter species other than C. jejuni from children with Crohn’s disease. J. Clin. Microbiol. 2009, 47, 453–455. [Google Scholar] [CrossRef] [PubMed]
- Mahendran, V.; Riordan, S.M.; Grimm, M.C.; Tran, T.A.; Major, J.; Kaakoush, N.O.; Mitchell, H.; Zhang, L. Prevalence of Campylobacter species in adult Crohn’s disease and the preferential colonization sites of Campylobacter species in the human intestine. PLoS ONE 2011, 6, e25417. [Google Scholar] [CrossRef]
- Macuch, P.J.; Tanner, A.C. Campylobacter species in health, gingivitis, and periodontitis. J. Dent. Res. 2000, 79, 785–792. [Google Scholar] [CrossRef]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef]
- Kamma, J.J.; Nakou, M.; Manti, F.A. Microbiota of rapidly progressive periodontitis lesions in association with clinical parameters. J. Periodontol. 1994, 65, 1073–1078. [Google Scholar] [CrossRef]
- Zhang, L.; Budiman, V.; Day, A.S.; Mitchell, H.; Lemberg, D.A.; Riordan, S.M.; Grimm, M.; Leach, S.T.; Ismail, Y. Isolation and detection of Campylobacter concisus from saliva of healthy individuals and patients with inflammatory bowel disease. J. Clin. Microbiol. 2010, 48, 2965–2967. [Google Scholar] [CrossRef]
- Gunther, N.W., IV; Chen, C.Y. The biofilm forming potential of bacterial species in the genus Campylobacter. Food Microbiol. 2009, 26, 44–51. [Google Scholar] [CrossRef]
- Lavrencic, P.; Kaakoush, N.O.; Huinao, K.D.; Kain, N.; Mitchell, H.M. Investigation of motility and biofilm formation by intestinal Campylobacter concisus strains. Gut Pathog. 2012, 4, 22. [Google Scholar] [CrossRef]
- Ovesen, S.; Durack, J.; Kirk, K.F.; Nielsen, H.L.; Nielsen, H.; Lynch, S.V. Motility and biofilm formation of the emerging gastrointestinal pathogen Campylobacter concisus differs under microaerophilic and anaerobic environments. Gut Microbes 2019, 10, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef]
- Joshua, G.W.; Guthrie-Irons, C.; Karlyshev, A.V.; Wren, B.W. Biofilm formation in Campylobacter jejuni. Microbiology 2006, 152, 387–396. [Google Scholar] [CrossRef] [PubMed]
- Karatan, E.; Watnick, P. Signals, regulatory networks, and materials that build and break bacterial biofilms. Microbiol. Mol. Biol. Rev. 2009, 73, 310–347. [Google Scholar] [CrossRef] [PubMed]
- Wen, Z.T.; Nguyen, A.H.; Bitoun, J.P.; Abranches, J.; Baker, H.V.; Burne, R.A. Transcriptome analysis of LuxS-deficient Streptococcus mutans grown in biofilms. Mol. Oral Microbiol. 2011, 26, 2–18. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, N.A.; Petersen, F.C.; Scheie, A.A. AI-2/LuxS is involved in increased biofilm formation by Streptococcus intermedius in the presence of antibiotics. Antimicrob. Agents Chemother. 2009, 53, 4258–4263. [Google Scholar] [CrossRef] [PubMed]
- Karim, M.M.; Hisamoto, T.; Matsunaga, T.; Asahi, Y.; Noiri, Y.; Ebisu, S.; Kato, A.; Azakami, H. LuxS affects biofilm maturation and detachment of the periodontopathogenic bacterium Eikenella corrodens. J. Biosci. Bioeng. 2013, 116, 313–318. [Google Scholar] [CrossRef]
- Shao, H.; Demuth, D.R. Quorum sensing regulation of biofilm growth and gene expression by oral bacteria and periodontal pathogens. Periodontology 2000 2010, 52, 53–67. [Google Scholar] [CrossRef]
- Yadav, M.K.; Vidal, J.E.; Go, Y.Y.; Kim, S.H.; Chae, S.W.; Song, J.J. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae Is Required to Cause Disease, and to Regulate Virulence- and Metabolism-Related Genes in a Rat Model of Middle Ear Infection. Front. Cell. Infect. Microbiol. 2018, 8, 138. [Google Scholar] [CrossRef]
- Williams, P. Quorum sensing, communication and cross-kingdom signalling in the bacterial world. Microbiology 2007, 153 Pt 12, 3923–3938. [Google Scholar] [CrossRef]
- Pecharki, D.; Petersen, F.C.; Scheie, A.A. LuxS and expression of virulence factors in Streptococcus intermedius. Oral Microbiol. Immunol. 2008, 23, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yi, L.; Zhang, Z.; Fan, H.; Cheng, X.; Lu, C. Overexpression of luxS cannot increase autoinducer-2 production, only affect the growth and biofilm formation in Streptococcus suis. Sci. World J. 2013, 2013, 924276. [Google Scholar] [CrossRef] [PubMed]
- Reeser, R.J.; Medler, R.T.; Billington, S.J.; Jost, B.H.; Joens, L.A. Characterization of Campylobacter jejuni biofilms under defined growth conditions. Appl. Environ. Microbiol. 2007, 73, 1908–1913. [Google Scholar] [CrossRef] [PubMed]
- Plummer, P.; Zhu, J.; Akiba, M.; Pei, D.; Zhang, Q. Identification of a key amino acid of LuxS involved in AI-2 production in Campylobacter jejuni. PLoS ONE 2011, 6, e15876. [Google Scholar] [CrossRef] [PubMed]
- Tazumi, A.; Negoro, M.; Tomiyama, Y.; Misawa, N.; Itoh, K.; Moore, J.E.; Millar, B.C.; Matsuda, M. Uneven distribution of the luxS gene within the genus Campylobacter. Br. J. Biomed. Sci. 2011, 68, 19–22. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Defoirdt, T. Quorum sensing positively regulates flagellar motility in pathogenic Vibrio harveyi. Environ. Microbiol. 2015, 17, 960–968. [Google Scholar] [CrossRef]
- Elvers, K.T.; Park, S.F. Quorum sensing in Campylobacter jejuni: Detection of a luxS encoded signalling molecule. Microbiology 2002, 148 Pt 5, 1475–1481. [Google Scholar] [CrossRef]
- Mou, K.T.; Plummer, P.J. The impact of the LuxS mutation on phenotypic expression of factors critical for Campylobacter jejuni colonization. Vet. Microbiol. 2016, 192, 43–51. [Google Scholar] [CrossRef]
- Jeon, B.; Itoh, K.; Misawa, N.; Ryu, S. Effects of quorum sensing on flaA transcription and autoagglutination in Campylobacter jejuni. Microbiol. Immunol. 2003, 47, 833–839. [Google Scholar] [CrossRef]
- Le Roux, E.; Lastovica, A.J. The Cape Town protocol: How to isolate the most campylobacters for your dollar, pound, franc, yen, etc. In International Workshop on Campylobacter, Helicobacter and Related Organisms; Lastovica, A.J., Newell, D.G., Lastovica, E.E., Eds.; Institute of Child Heath: Cape Town, South Africa, 1998; pp. 30–33. [Google Scholar]
- Istivan, T.S.; Coloe, P.J.; Fry, B.N.; Ward, P.; Smith, S.C. Characterization of a haemolytic phospholipase A(2) activity in clinical isolates of Campylobacter concisus. J. Med. Microbiol. 2004, 53, 483–493. [Google Scholar] [CrossRef]
- Russell, J. Campylobacter Like Organisms: Investigation of Clinical and Phenotypical Aspects; RMIT University: Melbourne, Australia, 1995. [Google Scholar]
- Fry, B.N.; Feng, S.; Chen, Y.Y.; Newell, D.G.; Coloe, P.J.; Korolik, V. The galE gene of Campylobacter jejuni is involved in lipopolysaccharide synthesis and virulence. Infect. Immun. 2000, 68, 2594–2601. [Google Scholar] [CrossRef] [PubMed]
- Coil, D.; Jospin, G.; Darling, A.E. A5-miseq: An updated pipeline to assemble microbial genomes from Illumina MiSeq data. Bioinformatics 2015, 31, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST Server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Adler, L.; Alter, T.; Sharbati, S.; Golz, G. Phenotypes of Campylobacter jejuni luxS mutants are depending on strain background, kind of mutation and experimental conditions. PLoS ONE 2014, 9, e104399. [Google Scholar] [CrossRef] [PubMed]
- Wassenaar, T.M.; Bleumink-Pluym, N.M.; van der Zeijst, B.A. Inactivation of Campylobacter jejuni flagellin genes by homologous recombination demonstrates that flaA but not flaB is required for invasion. EMBO J. 1991, 10, 2055–2061. [Google Scholar] [CrossRef] [PubMed]
- Larson, C.; Christensen, J.; Pacheco, S.; Minnich, S.; Konkel, M. Campylobacter jejuni secretes proteins via the flagellar type III secretion system that contribute to host cell invasion and gastroenteritis. In Campylobacter, 3rd ed.; Nachamkin, I., Szymanski, C., Blaser, M., Eds.; ASM Press: Washington, DC, USA, 2008. [Google Scholar]
- Allegrucci, M.; Hu, F.Z.; Shen, K.; Hayes, J.; Ehrlich, G.D.; Post, J.C.; Sauer, K. Phenotypic characterization of Streptococcus pneumoniae biofilm development. J. Bacteriol. 2006, 188, 2325–2335. [Google Scholar] [CrossRef] [PubMed]
- Guerry, P. Campylobacter flagella: Not just for motility. Trends Microbiol. 2007, 15, 456–461. [Google Scholar] [CrossRef]
- Reuter, M.; Mallett, A.; Pearson, B.M.; van Vliet, A.H. Biofilm formation by Campylobacter jejuni is increased under aerobic conditions. Appl. Environ. Microbiol. 2010, 76, 2122–2128. [Google Scholar] [CrossRef]
- Domenech, M.; Garcia, E.; Moscoso, M. Biofilm formation in Streptococcus pneumoniae. Microb. Biotechnol. 2012, 5, 455–465. [Google Scholar] [CrossRef]
- Sauer, K.; Camper, A.K.; Ehrlich, G.D.; Costerton, J.W.; Davies, D.G. Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J. Bacteriol. 2002, 184, 1140–1154. [Google Scholar] [CrossRef]
- Takenaka, S.; Iwaku, M.; Hoshino, E. Artificial Pseudomonas aeruginosa biofilms and confocal laser scanning microscopic analysis. J. Infect. Chemother. 2001, 7, 87–93. [Google Scholar] [CrossRef] [PubMed]
- Ica, T.; Caner, V.; Istanbullu, O.; Nguyen, H.D.; Ahmed, B.; Call, D.R.; Beyenal, H. Characterization of mono- and mixed-culture Campylobacter jejuni biofilms. Appl. Environ. Microbiol. 2012, 78, 1033–1038. [Google Scholar] [CrossRef] [PubMed]
- Joo, H.S.; Otto, M. Molecular basis of in vivo biofilm formation by bacterial pathogens. Chem. Biol. 2012, 19, 1503–1513. [Google Scholar] [CrossRef] [PubMed]
- Sapi, E.; Bastian, S.L.; Mpoy, C.M.; Scott, S.; Rattelle, A.; Pabbati, N.; Poruri, A.; Burugu, D.; Theophilus, P.A.; Pham, T.V.; et al. Characterization of biofilm formation by Borrelia burgdorferi in vitro. PLoS ONE 2012, 7, e48277. [Google Scholar] [CrossRef] [PubMed]
- Merritt, J.; Qi, F.; Goodman, S.D.; Anderson, M.H.; Shi, W. Mutation of luxS affects biofilm formation in Streptococcus mutans. Infect. Immun. 2003, 71, 1972–1979. [Google Scholar] [CrossRef]
- Simunovic, K.; Ramic, D.; Xu, C.; Smole Mozina, S. Modulation of Campylobacter jejuni Motility, Adhesion to Polystyrene Surfaces, and Invasion of INT407 Cells by Quorum-Sensing Inhibition. Microorganisms 2020, 8, 104. [Google Scholar] [CrossRef]
- McNab, R.; Ford, S.K.; El-Sabaeny, A.; Barbieri, B.; Cook, G.S.; Lamont, R.J. LuxS-based signaling in Streptococcus gordonii: Autoinducer 2 controls carbohydrate metabolism and biofilm formation with Porphyromonas gingivalis. J. Bacteriol. 2003, 185, 274–284. [Google Scholar] [CrossRef]
- Petersen, F.C.; Ahmed, N.A.; Naemi, A.; Scheie, A.A. LuxS-mediated signalling in Streptococcus anginosus and its role in biofilm formation. Antonie Van Leeuwenhoek 2006, 90, 109–121. [Google Scholar] [CrossRef]
- Balestrino, D.; Haagensen, J.A.; Rich, C.; Forestier, C. Characterization of type 2 quorum sensing in Klebsiella pneumoniae and relationship with biofilm formation. J. Bacteriol. 2005, 187, 2870–2880. [Google Scholar] [CrossRef]
- Cole, S.P.; Harwood, J.; Lee, R.; She, R.; Guiney, D.G. Characterization of monospecies biofilm formation by Helicobacter pylori. J. Bacteriol. 2004, 186, 3124–3132. [Google Scholar] [CrossRef]
- Tian, Y.; Wang, Q.; Liu, Q.; Ma, Y.; Cao, X.; Guan, L.; Zhang, Y. Involvement of LuxS in the regulation of motility and flagella biogenesis in Vibrio alginolyticus. Biosci. Biotechnol. Biochem. 2008, 72, 1063–1071. [Google Scholar] [CrossRef] [PubMed]
- Teren, M.; Shagieva, E.; Vondrakova, L.; Viktorova, J.; Svarcova, V.; Demnerova, K.; Michova, H.T. Mutagenic strategies against luxS gene affect the early stage of biofilm formation of Campylobacter jejuni. J. Appl. Genet. 2022, 63, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Holmes, K.; Tavender, T.J.; Winzer, K.; Wells, J.M.; Hardie, K.R. AI-2 does not function as a quorum sensing molecule in Campylobacter jejuni during exponential growth in vitro. BMC Microbiol. 2009, 9, 214. [Google Scholar] [CrossRef] [PubMed]
- Man, S.M.; Kaakoush, N.O.; Leach, S.T.; Nahidi, L.; Lu, H.K.; Norman, J.; Day, A.S.; Zhang, L.; Mitchell, H.M. Host attachment, invasion, and stimulation of proinflammatory cytokines by Campylobacter concisus and other non-Campylobacter jejuni Campylobacter species. J. Infect. Dis. 2010, 202, 1855–1865. [Google Scholar] [CrossRef]
- Quinones, B.; Miller, W.G.; Bates, A.H.; Mandrell, R.E. Autoinducer-2 production in Campylobacter jejuni contributes to chicken colonization. Appl. Environ. Microbiol. 2009, 75, 281–285. [Google Scholar] [CrossRef]
- Jordan, D.M.; Sperandio, V.; Kaper, J.B.; Dean-Nystrom, E.A.; Moon, H.W. Colonization of gnotobiotic piglets by a luxS mutant strain of Escherichia coli O157:H7. Infect. Immun. 2005, 73, 1214–1216. [Google Scholar] [CrossRef]
- Kim, S.M.; Park, J.H.; Lee, H.S.; Kim, W.B.; Ryu, J.M.; Han, H.J.; Choi, S.H. LuxR homologue SmcR is essential for Vibrio vulnificus pathogenesis and biofilm detachment, and its expression is induced by host cells. Infect. Immun. 2013, 81, 3721–3730. [Google Scholar] [CrossRef]
Primer Name | Size (bp) | Primer Pair | Primer Sequences | Template | Product size (bp) | TA (°C) | Target gene | Source |
---|---|---|---|---|---|---|---|---|
FCCluxS RCCluxS | 22 22 | 1 | GAAACCATCTAAACGGCAACGG GTCCCATAGCATCAACGTCAAG | C. concisus gDNA | 309 | 55 | luxS | This study |
luxScfc | 30 | 2 | GATCGGTACCATGAGCCTTCTTGCRGTRTC | RMIT-O17 | 1380 | 52 | luxS | This study |
luxScr1 | 30 | 2a | GCTAGAGCTCATAGAAGCGGCTCGTGCAGG | |||||
luxScr2 | 31 | 2b | GCTAGAGCTCCAAGTCTCGCAGCCTAGAAAG | |||||
Inv F O17 | 28 | 3 | CGTAGGATCCGCCCATCGGTGAGATGTC | pBK luxS | 3400 | 54 | pBluescript containing luxS | This study |
Inv R O17 | 33 | GAGCGGATCCTCTACGCCGTTGCCGTTTAGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huq, M.; Wahid, S.U.H.; Istivan, T. Biofilm Formation in Campylobacter concisus: The Role of the luxS Gene. Microorganisms 2024, 12, 46. https://doi.org/10.3390/microorganisms12010046
Huq M, Wahid SUH, Istivan T. Biofilm Formation in Campylobacter concisus: The Role of the luxS Gene. Microorganisms. 2024; 12(1):46. https://doi.org/10.3390/microorganisms12010046
Chicago/Turabian StyleHuq, Mohsina, Syeda Umme Habiba Wahid, and Taghrid Istivan. 2024. "Biofilm Formation in Campylobacter concisus: The Role of the luxS Gene" Microorganisms 12, no. 1: 46. https://doi.org/10.3390/microorganisms12010046