1. Introduction
Alphaviruses are a diverse group of enveloped RNA viruses that can cause infection in both humans and livestock [
1]. They have a single-stranded positive-sense RNA genome of about 11.5 kb in length. The genome translates into a polyprotein that is then cleaved into four nonstructural proteins (nsP1–nsP4), a capsid protein (Cp), and envelope proteins (E1 and E2). E1 and E2 generate the viral spike protein mediating viral entry through endocytosis. Interactions between Cp-E2 and the formation of the E1/E2 heterodimer drive the budding process at the host cell surface [
1].
The alphaviruses Venezuelan equine encephalitis virus (VEEV) and Eastern equine encephalitis virus (EEEV) are spread to humans through mosquitos and can cause symptoms such as fever, rash, joint pain, inflammation, and malaise [
2]. VEEV and EEEV tend to be encephalitogenic in nature and are endemic to South and North America, respectively. They can cause severe damage to the central nervous system, including seizures, blindness, permanent neurological damage, and death [
3]. Both VEEV and EEEV are of concern due to their potential use as biological weapons and the possibility of re-emergence. There are currently no vaccines or therapeutics available for either of these viruses, which are classified as Category B priority pathogens by the National Institute of Allergy and Infectious Diseases (NIAID) and Select Agents by the Center for Disease Control (CDC) and United States Department of Agriculture (USDA).
Sindbis virus (SINV), another alphavirus, is widely distributed across Africa, Asia, Europe, and Australia [
4]. SINV typically manifests as flu-like symptoms, including rash, nausea, and arthralgia that can persist for years after initial infection [
5,
6]. A considerable number of infected patients are left with persistent joint pain for years and, in some cases, chronic arthritis. The potential for long-term effects increases in high-risk populations, such as women between the ages of 45 and 65 [
7]. Currently, there are no vaccines or therapeutics available for the treatment of SINV.
Rift Valley Fever virus (RVFV), the causative agent of Rift Valley Fever, belonging to the bunyavirus family, is a zoonotic, negative-stranded, enveloped RNA virus. Its capsid contains a tripartite genome: small (S), medium (M), and large (L), coding for the viral polymerase, two non-structural proteins (NS), a nucleoprotein (N), and two glycoproteins (Gn and Gc). Virulence is increased by the non-structural proteins, which aid in hijacking host transcription and degradation of dsRNA-dependent protein kinase, and also reduce the production of interferons in response to viral infection [
8]. In livestock, RVFV causes severe disease, including hemorrhagic fever, febrile illness, fetal malformation, and spontaneous abortions. It is primarily transmitted to humans through
Aedes and
Culex mosquitoes. In humans, RVFV is fatal in 1–2% of cases with symptoms, including blindness, hemorrhagic fever, and miscarriages [
9].
RVFV was first detected in Kenya in 1931 and since then has spread throughout Africa, Madagascar, and the Arabian Peninsula. Although not detected in the Americas, Asia, or Europe as of this writing, the emergence of other diseases such as West Nile virus (WNV) and Zika virus serves as a warning of RVFV’s potential spread. RVFV is classified as a Category A pathogen by NIAID [
10].
An Echovirus (EV), belonging to the
Picornaviridae family, was also investigated in this study. Like VEEV and EEEV, EV is a positive-sense RNA virus but is non-enveloped. The genome codes for four primary proteins are VP1-VP4. Translation results in a polyprotein that is further cleaved to form the icosahedral shell and the interior lining of the fully formed virion. VP2 and VP3 are further cleaved into replication proteins to synthesize new RNA. Fully formed virions escape the host cell by lysis [
11]. This family of viruses ranges in infection severity, from asymptomatic cases to those that can result in severe central nervous system disease and meningitis [
12].
Antimicrobial peptides (AMPs) constitute an interesting strategy for the development of new countermeasure strategies against such acutely infectious viruses in addition to small molecules. Recent studies show both bioactive and synthetically developed small peptides possess antiviral activities, positioning them as promising therapeutic candidates [
13,
14]. Brilacidin (PMX-30063) is a small molecule designed to mimic the properties of naturally occurring human defensins. Defensins are a common family of AMPs found in high concentrations in the granules of leukocytes, such as neutrophils and epithelial cells [
15]. Their amphipathic nature enables them to target and disrupt lipid membranes, acting as a first line of defense against various pathogens, including viruses [
16]. The development of natural defensins for therapeutic use has been limited due to toxicity, malabsorption, and high cost for production [
17]. Brilacidin is smaller than a conventional defensin, cost-efficient to produce, and has been tailored to exhibit increased potency and in vivo stability based on desirable physicochemical characteristics.
Brilacidin’s ability to impact the integrity of viruses such that inhibition may be achieved has previously been shown for various coronaviruses, including SARS-CoV-2 [
18,
19]. The current manuscript delivers early proof-of-concept data for the potential application of brilacidin as a countermeasure strategy against enveloped, vector-transmitted viruses using alphaviruses and bunyaviruses as prototype pathogens. The inhibitory activity of brilacidin on a non-enveloped Echovirus is included for comparison to evaluate the relative efficacy of brilacidin in the context of enveloped versus non-enveloped viruses.
2. Materials and Methods
2.1. Cell Culture
Vero African green monkey kidney cells (ATCC, CCL-81, Manassas, VA, USA) were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM, Quality Biological, 112-013,101CS, Gaithersburg, MD, USA) supplemented with 5% heat-inactivated fetal bovine serum (FBS), 1% penicillin and streptomycin antibiotics (Corning 30-003-CI, Corning, NY, USA), and 1% L-glutamine (Corning, 25-005-CI, Corning, NY, USA). Human small airway epithelial cells (HSAECs) were cultured with Ham’s F-12 GlutaMAX Supplement (ThermoFisher Scientific, 31765-035, Burlington, ON, Canada), 5% FBS, 1% L-glutamine, 1% penicillin and streptomycin, 1% non-essential amino acid solution (ThermoFisher Scientific, 11140-050, Grand Island, NY, USA), 1% sodium pyruvate (VWR, 45000-710, VA, USA) 0.01% 2-Mercaptoethanol (VWR Life Science, 76177-742, Radnor, PA, USA). All cells were incubated at 37 °C with 5% CO2 supplementation.
2.2. Viral Stocks
RVFV (Rift Valley Fever virus) recombinant (r)MP12 attenuated strain was derived from ZH501 strain by 12 serial passages in MRC5 cells and grown in HSAECs utilized under BSL-2 conditions [
20]. The RVFV virulent strain ZH501 was obtained from Stuart Nichol, Centers for Disease Control and Prevention (CDC), and utilized under BSL-3 conditions. The full virulent Trinidad donkey (TrD) strain of VEEV (Venezuelan Equine Encephalitis Virus) was used to conduct BSL-3 studies, whereas the TC-83 strain was studied as the BSL-2 model. VEEV TC-83 and VEEV TrD were obtained from BEI Resources in Manassas, VA. TC-83 is a live attenuated vaccine derivative of the TrD strain of VEEV derived by 83 serial passages of the virus in guinea pig heart cells [
21] and expanded in Vero E6 cells and quantitated using plaque assay. A VEEV TC-83 V5 E2 tagged virus was utilized as described in Barrera et al. [
22]. Wild-type Eastern Equine Encephalitis Virus (EEEV) GA97 was obtained from Dr. Jonathan Jacobs (MRIGlobal) and expanded in Vero cells and quantitated via plaque assay. Sindbis virus (SINV, EgAr339) was utilized under BSL-2 conditions and was obtained from BEI Resources in Manassas, VA. Human Echovirus 6 (EV) was obtained from American Type Culture Collection (ATCC, VR-1045, Manassas, VA, USA). All select agents used in the manuscript are registered under the Center for Infectious Disease Research (CIDR, formerly NCBID) and conducted at George Mason University’s Biomedical Research Laboratory with registrations in accordance with Federal Select Agent regulations.
2.3. Inhibitor
Brilacidin was provided by Innovation Pharmaceuticals Inc. (Wakefield, MA, USA) and was suspended in dimethyl sulfoxide (DMSO).
2.4. Viral Infections
Vero cells were seeded in 96-well plates at a seeding density of 5 × 104 cells per well and allowed to reach 90–100% confluency for 24 h. These cells were used for VEEV-TC-83 and TrD, EEEV, and SINV infections. HSAECs were seeded in 96-well plates at a seeding density of 5 × 104 cells per well and were used for RVFV infections. Brilacidin was dissolved in dimethyl sulfoxide (DMSO). Four treatment strategies were used. Cells were pre-treated with brilacidin at 20 µM for 1 h. Pre-treatment was removed and replaced with viral inoculum for 1 hr. All cells were infected with a multiplicity of infections (MOI 0.1). Viral inoculum was removed and replaced with fresh media and 20 µM of brilacidin until collection time. For VEEV TC-83, VEEV TrD, EEEV GA97, and SINV EgAr338 infections, collection time was 18 h post-infection (hpi). For RVFV MP-12 and RVFV infections, collection time was 16 h post-infection. EV infections were collected 24 h post-infection. For direct viral treatment, virus was suspended in appropriate cell media with 20 µM of brilacidin and incubated for 1 h before being placed on cells for 1 h. The inoculum was then replaced with fresh culture media until collection time. A combination of these treatment strategies was also used. Post-treatment consisted of infecting the cells with virus for 1 h and then placing 20 µM of brilacidin on cells until collection time. Mock-infected wells consisted of treated and untreated cells during infections. Samples were collected and used immediately or frozen at –80 °C.
For IC50 infections, Vero cells were seeded in a 96-well plate at a seeding density of 1 × 104 cells per well. Cells were pre-treated with varying concentrations of brilacidin for 1 h, with the upper limit being 200 μM and conducting 2-fold serial dilutions to establish an 8-point curve. The lower limit was 1.56 μM. Simultaneously, VEEV TC-83 or RVFV MP-12 were suspended in Vero media along concentration curve for 1 h. Pre-treatment was removed and cells were infected. Inoculum was removed 1 h later and cells were post-treated following the same guidance as outlined in the pre-treatment. Samples were collected 18 hpi for VEEV TC-84 and 16 hpi for RVFV MP-12.
2.5. Cell Viability and Toxicity Screens
Vero cells and HSAECs were seeded in 96-well white plates at 5 × 104 cells per well, respectively, and allowed to grow for 24 h. Brilacidin was diluted to the desired concentrations in appropriate cell culture media. Dilutions of brilacidin were applied to individual wells of the plate and incubated at 37 °C with 5% CO2 for 24 h. Brilacidin and media mixture were removed, and cell viability was measured with CellTiter-Glo® Luminescent Cell Viability Assay per manufacturer’s instructions (Promega, G7572, Madison, WI, USA). Luminescence was measured using GloMax Explorer Plate Reader (Promega, GM3510, Madison, WI, USA).
Viral infections were conducted as previously outlined in 96-well white plates. At specified collection time, CellTiter-Glo® Luminescent Cell Viability Assays were conducted according to manufacturer’s protocol. Percent cell survival was analyzed and compared with mock infected wells.
2.6. Plaque Assay
Vero cells were seeded in 12-well plates at a density of 2 × 105 cells per well. These were allowed to become confluent for 24 h. Eight ten-fold serial dilutions were conducted with each sample before being placed on the 12-well plates. Plates were incubated for 1 h and rocked every 15 min. Plates were overlayed with a 1:1 ratio of 1.0% agarose and Eagle’s Modified Essential Medium (without phenol red) supplemented with 5% FBS, 1% penicillin and streptomycin, 1% L-glutamine, 1% NEAA, and 1% sodium pyruvate. After 48 h, plates were fixed with 10% formaldehyde for 1 h. Plugs were removed and plates were stained with 1% crystal violet, 20% ethanol, and 79% diH2O. Plaque-forming units are represented as PFU/mL. Vero cells were seeded in 6-well plates at a density of 5 × 105 cells per well and plugs were left for 72 h in the case of the Echovirus. Limit of detection for plaque assay is specified on VEEV TC-83 IC50 graph.
2.7. RNA Extraction and qRT-PCR Assay
Cells were lysed using TRIzol Reagent (ThermoFisher, 15596026, Waltham, MA, USA) and intracellular RNA was extracted using a Direct-zol Miniprep RNA kit (Zymo Research, R2052, Irvine, CA, USA) following manufacturer’s instructions and stored at −80 °C. Viral RNA was detected using Verso 1-Step RT-qPCR Mix (ThermoFisher, AB4101A, Waltham, MA, USA) on a One-Step Quantitative RT-PCR System using primer pairs (forward, CTGACCTGGAAACTGAGACTATG, and reverse, GGCGACTCTAACTCCCTTATTG) and probe (TACGAAGGGCAAGTCGCTGTTTACC) against the nsP1 region of the viral genome. A standard curve was generated using serial dilutions of VEEV TC-83 RNA at known concentrations. Absolute quantification was performed using StepOne software v2.3 based on the threshold cycle relative to the standard curve.
2.8. Negative-Strand RT-qPCR
Negative-strand synthesis was performed as previously described [
23]. cDNA was generated using a specific primer to negative-strand RNA for VEEV TC-83, which contained a T7 promoter sequence attached at the 5′ end (T7-TC83-Neg 5′-GCGTAATACGACTCACTATATCCGTCAGCTCTCTCGCAGG-3′). A high-capacity cDNA reverse transcription kit (4368814, ThermoFisher, Waltham, MA, USA) was used to generate the negative-strand cDNA per the manufacturer’s instructions. For qPCR of negative-strand viral RNA, forward primer specific to the T7 promoter sequence (5′-GCGTAATACGACTCACTATA-3′) and reverse primer specific to VEEV TC-83 (5′-CAGGTACTAGGTTTATGCGC-3′) were utilized. qPCR for detection of viral negative strand used thermal cycling conditions adapted from PowerUp SYBR Green (A25742, ThermoFisher Scientific, Waltham, MA, USA) per the manufacturer’s instructions: 1 cycle at 50 °C for 2 min, 1 cycle at 95 °C for 2 min, 40 cycles at 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 1 min using StepOnePlus™ Real-Time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The ΔΔCt method was used to determine the fold change compared to the Mock average.
2.9. Western Blots
Cells were lysed in Blue Lysis Buffer composed of 25 mL 2× Novex Tris-Glycine Sample Loading Buffer SDS (Invitrogen LC2676, Waltham, MA, USA), 20 mL T-PER TissueProtein Extraction Reagent (ThermoFisher, 78510, Waltham, MA, USA), 200 µL 0.5 M EDTA pH 8.0, 3 complete Protease Cocktail tablets, 80 µL 0.1M Na3VO4, 400 µL 0.1 M NaF, and 1.3 mL 1M dithiothreitol. A total of 15 µL of cell lysate was separated by gel electrophoresis on a NuPAGE 4–12% Bis-Tris gel (Invitrogen, NP0322BOX, Waltham, MA, USA) and transferred to PVDF membrane (ThermoFisher, 88518, Waltham, MA, USA). The membrane was blocked in 1% BSA in TBS—0.1% Tween (TBST) solution (ThermoFisher, 37520, Waltham, MA, USA) for 30 min at room temperature. Primary antibody was incubated overnight at 4 °C in 1% BSA TBST. Rabbit anti-nsP1 antibody (ThermoFisher, MA-5-47057, Waltham, MA, USA) was used at 1:1000, goat and actin HRP (Abcam, ab49900, Cambridge, MA, USA) was used at 1:30,000. The membrane was washed three times for five minutes with TBST. Secondary antibody was prepared in 1% BSA TBST and incubated at room temperature for 1 h. Goat anti-rabbit HRP (Invitrogen, 32460, Waltham, MA, USA) was used at 1:1000. Membranes were washed once for five minutes with TBST and twice for five minutes with TBS. SuperSignal West Femto Maximum Sensitivity Substrate kit (ThermoFisher, 34095, Waltham, MA, USA) was used to image blots on a Chemidoc Imaging System (BioRad, 12003153, Hercules, CA, USA).
2.10. Statistical Analyses
Statistical analyses were conducted using unpaired, two-tailed t-tests in GraphPad Prism version 9.2.0 for Windows 10. Significance values are indicated using asterisks for * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001; ns for not significant.
4. Discussion
The need for new antiviral therapeutic options is substantial due to a current lack of treatments and preventive vaccines with desirable safety profiles for the acutely infectious viruses discussed here. In this study, the alphaviruses VEEV, EEEV, and SINV, as well as the bunyavirus RVFV, were treated with brilacidin to assess the broad-spectrum antiviral potential of this defensin mimetic. Four treatment strategies were used to evaluate and further identify the impact of brilacidin on enveloped viruses and one non-enveloped virus. For the alphaviruses, VEEV TC-83, SINV, and EEEV, all four treatment strategies significantly inhibited viral replication. In the case of VEEV TrD, pre-treatment and post-treatment, direct viral treatment, and a combination of these treatments significantly reduced viral titers, whereas post-treatment alone had no significant effect. Additional viral genome quantification studies indicated that brilacidin treatment negatively affected both positive- and negative-strand RNA synthesis in the context of VEEV TC-83, thus alluding to early post-entry mechanisms being affected [
18,
24]. Direct treatment of RVFV with brilacidin resulted in viral inhibition indicating that there may be additional mechanistic differences between alphaviruses and bunyaviruses being inhibited by brilacidin. This is not surprising because alphaviruses are positive-stranded viruses that need to be converted to negative strands for RNA replication, whereas the bunyavirus genome is negative stranded. The engagement of the secretory pathway for viral egress is also fundamentally different between these two pathogens which may also contribute to late events being impacted, which were not investigated as part of this work. The non-enveloped Echovirus was also only inhibited by brilacidin when applied as a direct treatment although not to the same extent as seen with most of the enveloped viruses thus further underscoring the impact of brilacidin on enveloped viruses specifically. Interestingly, previously published studies with adenovirus and host defensins showed similar inhibitory events as observed in the current study, pointing towards a mechanism that involves intracellular viral RNA [
25,
26]. Our studies with the host defense peptide LL37 elicited reasonably comparable inhibition of VEEV TC-83 and TrD as observed with this defensin mimetic, following a pre- and post-infection treatment strategy [
27] similar to the one followed in the studies included in this manuscript. Similar mechanisms of inhibition observations were made when brilacidin was compared to LL16, another defensin [
28].
Brilacidin has previously been tested in over 500 human subjects across multiple clinical indications where it has been shown to be efficacious and well-tolerated [
29,
30,
31,
32,
33]. Brilacidin, acting in synergy with other antiviral AMPs or antiviral drugs, may help arrest multiple parts of the viral lifecycle, resulting in better disease outcomes and a reduced risk for antiviral resistance. Deploying brilacidin as part of a prophylactic strategy to prevent early post-entry mechanisms and inhibit the intracellular production of new viral RNA could further prevent severe inflammatory effects observed during later stages of viral infection. Additionally, other enveloped viruses should be tested to further inform brilacidin’s broad spectrum potential and mechanism of action. Although brilacidin holds translational promise as a broadly effective countermeasure, there are additional studies to be performed in the context of the viruses included in this manuscript including in vitro specificity studies, expanded mechanism of action studies that focus on intracellular events including vesicular interactions, and impact on the innate immune inflammatory events, and in vivo dosing assessments that are pertinent to acute viral infections before the compound can become mainstream as a broad spectrum intervention strategy.