Development of a Real-Time PCR Assay for the Detection of Francisella spp. and the Identification of F. tularensis subsp. mediasiatica
Abstract
:1. Introduction
2. Materials and Methods
2.1. DNA Samples
2.2. Primer Development
2.3. Conducting PCR
2.4. Amplification Efficiency (AE)
2.5. Analytical Sensitivity
2.6. Specificity Analysis
3. Results
3.1. Development of Primers for Detection of Francisella spp. and Subspecies Identification of Mediasiatica
3.2. Analytical Sensitivity and Amplification Efficiency
3.3. Specificity Assessment
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Malkhazova, S.M.; Mironova, V.A.; Kotova, T.V.; Shartova, N.V.; Orlov, D.S. Natural-focal diseases: Mapping experience in Russia. Int. J. Health Geogr. 2014, 13, 21. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Kou, Z.; Xu, L.; Cao, J.; Liu, Z.; Wen, X.; Wen, H. Analysis of epidemiological characteristics of four natural-focal diseases in Shandong Province, China in 2009–2017: A descriptive analysis. PLoS ONE 2019, 14, e0221677. [Google Scholar] [CrossRef] [PubMed]
- Prislegina, D.A.; Dubyansky, V.M.; Platonov, A.E.; Maletskaya, O.V. The influence of natural and climatic factors on the epidemiological situation of natural focal infections. Infect. Immun. 2021, 11, 820–836. (In Russian) [Google Scholar]
- Malkhazova, S.; Mironova, V.; Shartova, N.; Orlov, D. Mapping Russia’s Natural Focal Diseases: History and Contemporary Approaches; Springer Nature: Berlin/Heidelberg, Germany, 2018. [Google Scholar]
- Mätz-Rensing, K.; Floto, A.; Schrod, A.; Becker, T.; Finke, E.J.; Seibold, E.; Splettstoesser, W.D.; Kaup, F.J. Epizootic of tularemia in an outdoor housed group of cynomolgus monkeys (Macaca fascicularis). Vet. Pathol. 2007, 44, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Zayet, S.; Frechet, L.; Abdallah, Y.B.; Garnier, P.; Lavoignet, C.E.; Guermazi, Z.; Naudot, X.; Klopfenstein, T.; Gendrin, V. Francisella tularensis infection: Variable clinical aspects with persistent pulmonary nodules presentation, a case series of human tularemia in Franche-Comté, France. Ticks Tick-Borne Dis. 2022, 13, 101941. [Google Scholar] [CrossRef] [PubMed]
- Maurin, M.; Gyuranecz, M. Tularaemia: Clinical aspects in Europe. Lancet Infect. Dis. 2016, 16, 113–124. [Google Scholar] [CrossRef]
- Pechous, R.D.; McCarthy, T.R.; Zahrt, T.C. Working toward the future: Insights into Francisella tularensis pathogenesis and vaccine development. Microbiol. Mol. Biol. Rev. 2009, 73, 684–711. [Google Scholar] [CrossRef]
- Hopla, C.E.; Hopla, A.K. Tularemia. In Handbook of Zoonoses, 2nd ed.; CRC Press, Inc.: Boca Raton, FL, USA, 1994; pp. 113–126. [Google Scholar]
- Hennebique, A.; Boisset, S.; Maurin, M. Tularemia as a waterborne disease: A review. Emerg. Microbes Infect. 2019, 8, 1027–1042. [Google Scholar] [CrossRef]
- Cieślikl, P.; Knap, J.; Bielawska-Drózd, A. Francisella tularensis-review. Post. Mikrobiol. 2018, 57, 58–67. [Google Scholar]
- Sjöstedt, A. Tularemia: History, epidemiology, pathogen physiology, and clinical manifestations. Ann. N. Y. Acad. Sci. 2007, 1105, 1–29. [Google Scholar] [CrossRef]
- Buettcher, M.; Egli, A.; Albini, S.; Altpeter, E.; Labutin, A.; Guidi, V.; Tonolla, M.; Lienhard, R.; Opota, O.; Schmid, P.; et al. Tularemia on the rise in Switzerland? A one health approach is needed! Infection 2024, 52, 1165–1169. [Google Scholar] [CrossRef] [PubMed]
- Order of the Minister of Health of the Republic of Kazakhstan Dated November 12, 2021 No. ҚР ДCM-114. On Approval of the Sanitary Rules “Sanitary and Epidemiological Requirements for the Organization and Implementation of Sanitary and Anti-Epidemic, Sanitary and Preventive Measures to Prevent Particularly Dangerous Infectious Diseases”. Available online: https://law.gov.kz/client/#!/doc/121054/rus/24.06.2021/42 (accessed on 5 February 2024). (In Russian)
- Kunitsa, T.N.; Izbanova, U.A.; Erubaev, T.K.; Ayazbaev, T.Z.; Meka-Mechenko, V.G.; Abdel, Z.Z.; Meka-Mechenko, T.V.; Sadovskaya, V.P. Natural Foci of Tularemia in Kazakhstan: Monograph; KSCQZI: Almaty, Kazakhstan, 2019; 97p. [Google Scholar]
- Timofeev, V.; Titareva, G.; Bahtejeva, I.; Kombarova, T.; Kravchenko, T.; Mokrievich, A.; Dyatlov, I. The comparative virulence of Francisella tularensis subsp. mediasiatica for vaccinated laboratory animals. Microorganisms 2020, 8, 1403. [Google Scholar] [CrossRef] [PubMed]
- Timofeev, V.; Bakhteeva, I.; Mokrievich, A.; Vakhrameeva, G.; Gritskova, E.; Anisimov, Y.; Rozhdestvensky, E.; Bazarova, G.; Zhumakaev, R.; Dyatlov, I.; et al. The First Finding of Francisella tularensis subsp. mediasiatica in Krasnoyarsk Territory, Siberia, and an Update of the Subspecies Genetic Diversity. Bacteria 2022, 1, 242–249. [Google Scholar] [CrossRef]
- Izbanova, U.; Lukhnova, L.; Sadovskaya, V.; Zhumadilova, Z.; Meka-Mechenko, T.; Shevtsov, A.; Baitursyn, B.; Turebekov, N.; Tukhanova, N. Characterization of tularemia foci in the Republic of Kazakhstan from 2000 to 2020. Front. Epidemiol. 2024, 4, 1291690. [Google Scholar] [CrossRef]
- Birdsell, D.N.; Johansson, A.; Öhrman, C.; Kaufman, E.; Molins, C.; Pearson, T.; Gyuranecz, M.; Naumann, A.; Vogler, A.J.; Myrtennäs, K.; et al. Francisella tularensis subsp. tularensis group AI, United States. Emerg. Infect. Dis. 2014, 20, 861. [Google Scholar] [CrossRef]
- Sjöstedt, A.; Genus, I. Francisella Dorofe’ev 1947, 176AL. In Bergey’s Manual of Systematic Bacteriology, 2nd ed.; Brenner, D.J., Krieg, N.R., Staley, J.T., Garrity, G.M., Eds.; Springer: New York, NY, USA, 2005; pp. 200–210. [Google Scholar]
- Burke, D.S. Immunization against tularemia: Analysis of the effectiveness of live Francisella tularensis vaccine in prevention of laboratory-acquired tularemia. J. Infect. Dis. 1977, 135, 55–60. [Google Scholar] [CrossRef]
- Lam, S.T.; Sammons-Jackson, W.; Sherwood, J.; Ressner, R. Laboratory-acquired tularemia successfully treated with ciprofloxacin: A case report. Infect. Dis. Clin. Pract. 2012, 20, 204–207. [Google Scholar] [CrossRef]
- Staples, J.E.; Kubota, K.A.; Chalcraft, L.G.; Mead, P.S.; Petersen, J.M. Epidemiologic and molecular analysis of human tularemia, United States, 1964–2004. Emerg. Infect. Dis. 2006, 12, 1113. [Google Scholar] [CrossRef]
- Larsson, P.; Svensson, K.; Karlsson, L.; Guala, D.; Granberg, M.; Forsman, M.; Johansson, A. Canonical insertion-deletion markers for rapid DNA typing of Francisella tularensis. Emerg. Infect. Dis. 2007, 13, 1725. [Google Scholar] [CrossRef]
- Sorokin, V.M.; Vodopyanov, A.S.; Tsymbalistova, M.V.; Pavlovich, N.V. Differentiation of Francisella tularensis subspecies by INDEL typing. J. Microbiol. Epidemiol. Immunobiol. 2022, 2, 193–202. (In Russian) [Google Scholar] [CrossRef]
- Vakhrameeva, G.M.; Lapin, A.A.; Pavlov, V.M.; Mokrievich, A.N.; Mironova, R.I.; Dyatlov, I.A. PCR differentiation of Francisella tularensis subspecies using one primer. Probl. Espec. Danger. Infect. 2011, 1, 46–48. (In Russian) [Google Scholar] [CrossRef]
- Timofeev, V.; Bakhteeva, I.; Titareva, G.; Kopylov, P.; Christiany, D.; Mokrievich, A.; Dyatlov, I.; Vergnaud, G. Russian isolates enlarge the known geographic diversity of Francisella tularensis subsp. mediasiatica. PLoS ONE 2017, 12, e0183714. [Google Scholar] [CrossRef] [PubMed]
- Gunnell, M.K.; Lovelace, C.D.; Satterfield, B.A.; Moore, E.A.; O’Neill, K.L.; Robison, R.A. A multiplex real-time PCR assay for the detection and differentiation of Francisella tularensis subspecies. J. Med. Microbiol. 2012, 61, 1525–1531. [Google Scholar] [CrossRef]
- Birdsell, D.N.; Vogler, A.J.; Buchhagen, J.; Clare, A.; Kaufman, E.; Naumann, A.; Driebe, E.; Wagner, D.M.; Keim, P.S. TaqMan real-time PCR assays for single-nucleotide polymorphisms which identify Francisella tularensis and its subspecies and subpopulations. PLoS ONE 2014, 9, e107964. [Google Scholar] [CrossRef]
- Kugeler, K.J.; Pappert, R.; Zhou, Y.; Petersen, J.M. Real-time PCR for Francisella tularensis types A and B. Emerg. Infect. Dis. 2006, 12, 1799. [Google Scholar] [CrossRef] [PubMed]
- Lopes de Carvalho, I.; Toledo, A.; Carvalho, C.L.; Barandika, J.F.; Respicio-Kingry, L.B.; Garcia-Amil, C.; García-Pérez, A.L.; Olmeda, A.S.; Zé-Zé, L.; Petersen, J.M.; et al. Francisella species in ticks and animals, Iberian Peninsula. Ticks Tick-Borne Dis. 2016, 7, 159–165. [Google Scholar] [CrossRef]
- Brunet, C.D.; Hennebique, A.; Peyroux, J.; Pelloux, I.; Caspar, Y.; Maurin, M. Presence of Francisella tularensis subsp. holarctica DNA in the aquatic environment in France. Microorganisms 2021, 9, 1398. [Google Scholar] [CrossRef]
- Panella, N.A.; Nicholson, W.L.; Komar, N.; Burkhalter, K.L.; Hughes, H.R.; Theuret, D.P.; Blocher, B.H.; Sexton, C.; Connelly, R.; Rothfeldt, L.; et al. Field-Collected Ticks From Benton County, Arkansas, and Prevalence of Associated Pathogens. J. Med. Entomol. 2024, 61, 1035–1042. [Google Scholar] [CrossRef]
- Larson, M.A.; Sayood, K.; Bartling, A.M.; Meyer, J.R.; Starr, C.; Baldwin, J.; Dempsey, M.P. Differentiation of Francisella tularensis subspecies and subtypes. J. Clin. Microbiol. 2020, 58, 10–1128. [Google Scholar] [CrossRef]
- Shevtsov, V.; Kairzhanova, A.; Shevtsov, A.; Shustov, A.; Kalendar, R.; Abdrakhmanov, S.; Lukhnova, L.; Izbanova, U.; Ramankulov, Y.; Vergnaud, G. Genetic diversity of Francisella tularensis subsp. holarctica in Kazakhstan. PLoS Neglected Trop. Dis. 2021, 15, e0009419. [Google Scholar] [CrossRef]
- Maughan, H.; Cunningham, K.S.; Wang, P.W.; Zhang, Y.; Cypel, M.; Chaparro, C.; Tullis, D.E.; Waddell, T.K.; Keshavjee, S.; Liu, M.; et al. Pulmonary bacterial communities in surgically resected noncystic fibrosis bronchiectasis lungs are similar to those in cystic fibrosis. Pulm. Med. 2012, 2012, 746358. [Google Scholar] [CrossRef] [PubMed]
- Darling, A.C.; Mau, B.; Blattner, F.R.; Perna, N.T. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004, 14, 1394–1403. [Google Scholar] [CrossRef] [PubMed]
- Hall, T. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Venables, W.N.; Ripley, B.D. Modern Applied Statistics with S, 4th ed.; Springer: New York, NY, USA, 2002. [Google Scholar]
- Shevtsov, A.; Izbanova, U.; Amirgazin, A.; Kairzhanova, A.; Dauletov, A.; Kiyan, V.; Vergnaud, G. Genetic Homogeneity of Francisella tularensis subsp. mediasiatica Strains in Kazakhstan. Pathogens 2024, 13, 581. [Google Scholar] [CrossRef]
- Kunitsa, T.; Izbanova, U.; Meka-Mechenko, T.; Yakupov, V. The modern clinical and epidemical peculiarities of manifestation of tularemia in Kazakhstan urbanized territories. Life Without Danger Health Prev. Longev. 2013, 8, 41–46. (In Russian) [Google Scholar]
- Kunitsa, T.; Meka-Mechenko, T.; Lukhnova, L. Incidence of tularemia in Kazakhstan. Probl Espec. Danger. Infect. 2001, 1, 52. (In Russian) [Google Scholar]
- Gurycova, D.; Výrosteková, V.; Khanakah, G.; Kocianova, E.; Stanek, G. Importance of surveillance of tularemia natural foci in the known endemic area of Central Europe, 1991–1997. Wien. Klin. Wochenschr. 2001, 113, 433–438. [Google Scholar]
- Sabitova, V.R.; Tokanova, S.E.; Kyrykbaeva, S.S. Improving epidemiological surveillance of especially dangerous infectious diseases in independent Kazakhstan: A literature review. Sci. Healthc. 2021, 2, 31–50. (In Russian) [Google Scholar]
- Grobe, N.; Cherif, A.; Wang, X.; Dong, Z.; Kotanko, P. Sample pooling: Burden or solution? Clin. Microbiol. Infect. 2021, 27, 1212–1220. [Google Scholar] [CrossRef]
- Lagier, J.C.; Edouard, S.; Pagnier, I.; Mediannikov, O.; Drancourt, M.; Raoult, D. Current and past strategies for bacterial culture in clinical microbiology. Clin. Microbiol. Rev. 2015, 28, 208–236. [Google Scholar] [CrossRef] [PubMed]
- Isidro, J.; Escudero, R.; Luque-Larena, J.J.; Pinto, M.; Borges, V.; González-Martín-Niño, R.; Duarte, S.; Vieira, L.; Mougeot, F.; Vidal, D.; et al. Strengthening the genomic surveillance of Francisella tularensis by using culture-free whole-genome sequencing from biological samples. Front. Microbiol. 2024, 14, 1277468. [Google Scholar] [CrossRef] [PubMed]
- Zharnikova, I.V.; Efremenko, V.I.; Zharnikova, T.V.; Kurcheva, S.A.; Kalnoy, S.M.; Efremenko, D.V.; Isakova, A.A.; Indenbom, A.V. Serological methods for detecting the causative agent of tularemia and their evaluation. J. Microbiol. Epidemiol. Immunobiol. 2019, 4, 32–38. (In Russian) [Google Scholar] [CrossRef]
- Maurin, M. Francisella tularensis, tularemia and serological diagnosis. Front. Cell. Infect. Microbiol. 2020, 10, 512090. [Google Scholar] [CrossRef] [PubMed]
- Thomas, R.; Johansson, A.; Neeson, B.; Isherwood, K.; Sjostedt, A.; Ellis, J.; Titball, R.W. Discrimination of human pathogenic subspecies of Francisella tularensis by using restriction fragment length polymorphism. J. Clin. Microbiol. 2003, 41, 50–57. [Google Scholar] [CrossRef]
- Öhrman, C.; Sahl, J.W.; Sjödin, A.; Uneklint, I.; Ballard, R.; Karlsson, L.; McDonough, R.F.; Sundell, D.; Soria, K.; Bäckman, S.; et al. Reorganized genomic taxonomy of Francisellaceae enables design of robust environmental PCR assays for detection of Francisella tularensis. Microorganisms 2021, 9, 146. [Google Scholar] [CrossRef]
- Ammam, I.; Brunet, C.D.; Boukenaoui-Ferrouk, N.; Peyroux, J.; Berthier, S.; Boutonnat, J.; Rahal, K.; Bitam, I.; Maurin, M. Francisella tularensis PCR detection in Cape hares (Lepus capensis) and wild rabbits (Oryctolagus cuniculus) in Algeria. Sci. Rep. 2022, 12, 21451. [Google Scholar] [CrossRef]
- Cohan, H.A.; Jamshidian, M.; Rohani, M.; Moravedji, M.; Mostafavi, E. Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran. Comp. Immunol. Microbiol. Infect. Dis. 2020, 69, 101419. [Google Scholar]
- Esmaeili, S.; Rohani, M.; Ghasemi, A.; Gouya, M.M.; Khayatzadeh, S.; Mahmoudi, A.; Ahangari Cohan, H.; Johansson, A.; Maurin, M.; Mostafavi, E. Francisella tularensis human infections in a village of northwest Iran. BMC Infect. Dis. 2021, 21, 310. [Google Scholar] [CrossRef]
- Versage, J.L.; Severin, D.D.; Chu, M.C.; Petersen, J.M. Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. J. Clin. Microbiol. 2003, 41, 5492–5499. [Google Scholar] [CrossRef]
- Şimşek, H.; Taner, M.; Karadenizli, A.Y.N.U.R.; Ertek, M.; Vahaboğlu, H. Identification of Francisella tularensis by both culture and real-time TaqMan PCR methods from environmental water specimens in outbreak areas where tularemia cases were not previously reported. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 2353–2357. [Google Scholar] [CrossRef] [PubMed]
- Janse, I.; Hamidjaja, R.A.; Bok, J.M.; van Rotterdam, B.J. Reliable detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis by using multiplex qPCR including internal controls for nucleic acid extraction and amplification. BMC Microbiol. 2010, 10, 314. [Google Scholar] [CrossRef] [PubMed]
- Larsson, P.; Elfsmark, D.; Svensson, K.; Wikström, P.; Forsman, M.; Brettin, T.; Keim, P.; Johansson, A. Molecular evolutionary consequences of niche restriction in Francisella tularensis, a facultative intracellular pathogen. PLoS Pathog. 2009, 5, e1000472. [Google Scholar] [CrossRef] [PubMed]
- Saussoy, P.; Vaerman, J.L.; Straetmans, N.; Deneys, V.; Cornu, G.; Ferrant, A.; Latinne, D. Differentiation of acute myeloid leukemia from B- and T-lineage acute lymphoid leukemias by real-time quantitative reverse transcription-PCR of lineage marker mRNAs. Clin. Chem. 2004, 50, 1165–1173. [Google Scholar] [CrossRef]
- Petrosino, J.F.; Xiang, Q.; Karpathy, S.E.; Jiang, H.; Yerrapragada, S.; Liu, Y.; Gioia, J.; Hemphill, L.; Gonzalez, A.; Raghavan, T.M.; et al. Chromosome rearrangement and diversification of Francisella tularensis revealed by the type B (OSU18) genome sequence. J. Bacteriol. 2006, 188, 6977–6985. [Google Scholar] [CrossRef]
- Rohmer, L.; Fong, C.; Abmayr, S.; Wasnick, M.; Larson Freeman, T.J.; Radey, M.; Guina, T.; Svensson, K.; Hayden, H.S.; Jacobs, M.; et al. Comparison of Francisella tularensis genomes reveals evolutionary events associated with the emergence of human pathogenic strains. Genome Biol. 2007, 8, R102. [Google Scholar] [CrossRef]
- Timofeev, V.; Bakhteeva, I.; Titareva, G.; Mironova, R.; Evseeva, V.; Kravchenko, T.; Sizova, A.; Borzilov, A.; Pavlovich, N.; Mokrievich, A.; et al. Avirulence of a spontaneous Francisella tularensis subsp. mediasiatica prmA mutant. PLoS ONE 2024, 19, e0305569. [Google Scholar] [CrossRef]
Primer/Probe Name | Sequence 5′-3′ | Length | Concentration in PCR (nM) | Target Subspecies/Genus |
---|---|---|---|---|
isftu-2_F_242 | ACAAAACCCTGATTTACAAGAAGT | 153 bp | 800 | Francisella spp. |
isftu-2_R_396 | CCTAAAGCATCAGTCATAGCAT | 400 | ||
isftu-2_Probes_331 | FAM-CCAACTGATCTACCAATTGCTTG-BHQ1 | 400 | ||
FtM_452000_F | TTGTTTCAACTGTTCTATACCTCTAA | 215 bp | 600 | F. tularensis subsp. mediasiatica |
FtM_452000_R | CTACCTCCGTACTCTCCAGATT | 600 | ||
FtM_452000_probe | FAM-TCCTATTGAAAAGGTTTGGGCT-BHQ1 | 400 |
qPCR and Used Primers | The Average Ct Value for 39 F. tularensis subsp. holarctica DNA Samples Was Calculated Using 1 ng DNA in the Reaction. (Standard Error of the Mean (SEM)) | The Average Ct Value for 28 F. tularensis subsp. mediasiatica DNA Samples Was Calculated Using 1 ng DNA in the Reaction (SEM). |
---|---|---|
qPCR for subspecies differential identification of mediasiatica using primers FtM_452000_F, FtM_452000_R and TaqMan probe FtM_452000_probe | Not detected | 19.1 (0.09) |
qPCR for the detection of Francisella spp. using primers isftu-2_F_242, isftu-2_R_396 and TaqMan probe isftu-2_Probes_331 | 14.522 (0.044) | 15.536 (0.122) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shevtsov, A.; Dauletov, A.; Izbanova, U.; Kairzhanova, A.; Tursunbay, N.; Kiyan, V.; Vergnaud, G. Development of a Real-Time PCR Assay for the Detection of Francisella spp. and the Identification of F. tularensis subsp. mediasiatica. Microorganisms 2024, 12, 2345. https://doi.org/10.3390/microorganisms12112345
Shevtsov A, Dauletov A, Izbanova U, Kairzhanova A, Tursunbay N, Kiyan V, Vergnaud G. Development of a Real-Time PCR Assay for the Detection of Francisella spp. and the Identification of F. tularensis subsp. mediasiatica. Microorganisms. 2024; 12(11):2345. https://doi.org/10.3390/microorganisms12112345
Chicago/Turabian StyleShevtsov, Alexandr, Ayan Dauletov, Uinkul Izbanova, Alma Kairzhanova, Nailya Tursunbay, Vladimir Kiyan, and Gilles Vergnaud. 2024. "Development of a Real-Time PCR Assay for the Detection of Francisella spp. and the Identification of F. tularensis subsp. mediasiatica" Microorganisms 12, no. 11: 2345. https://doi.org/10.3390/microorganisms12112345
APA StyleShevtsov, A., Dauletov, A., Izbanova, U., Kairzhanova, A., Tursunbay, N., Kiyan, V., & Vergnaud, G. (2024). Development of a Real-Time PCR Assay for the Detection of Francisella spp. and the Identification of F. tularensis subsp. mediasiatica. Microorganisms, 12(11), 2345. https://doi.org/10.3390/microorganisms12112345