Next Article in Journal
Detection of mcr-1-1 Positive Enteropathogenic Escherichia coli Isolates Associated with Post-Weaning Diarrhoea in an Organic Piglet-Producing Farm in Austria
Previous Article in Journal
Orally Administered Drugs and Their Complicated Relationship with Our Gastrointestinal Tract
Previous Article in Special Issue
The Role of Flagellum and Flagellum-Based Motility on Salmonella Enteritidis and Escherichia coli Biofilm Formation
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 2
10.3390/microorganisms12020243
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Relationship between Desiccation Tolerance and Biofilm Formation in Shiga Toxin-Producing Escherichia coli

by
Muhammad Qasim Javed
1,
Igor Kovalchuk
1,
Dmytro Yevtushenko
1,
Xianqin Yang
2 and
Kim Stanford
1,*
1
Department of Biological Sciences, University of Lethbridge, Lethbridge, AB T1K 3M4, Canada
2
Agriculture and Agri-Food Canada, Lacombe, AB T4L 1V7, Canada
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(2), 243; https://doi.org/10.3390/microorganisms12020243
Submission received: 5 December 2023 / Revised: 12 January 2024 / Accepted: 22 January 2024 / Published: 24 January 2024
(This article belongs to the Special Issue Bacterial Biofilm Microenvironments: Their Interactions and Functions)
Browse Figures
Versions Notes

Abstract

:
Shiga toxin-producing Escherichia coli (STEC) is a major concern in the food industry and requires effective control measures to prevent foodborne illnesses. Previous studies have demonstrated increased difficulty in the control of biofilm-forming STEC. Desiccation, achieved through osmotic stress and water removal, has emerged as a potential antimicrobial hurdle. This study focused on 254 genetically diverse E. coli strains collected from cattle, carcass hides, hide-off carcasses, and processing equipment. Of these, 141 (55.51%) were STEC and 113 (44.48%) were generic E. coli. The biofilm-forming capabilities of these isolates were assessed, and their desiccation tolerance was investigated to understand the relationships between growth temperature, relative humidity (RH), and bacterial survival. Only 28% of the STEC isolates had the ability to form biofilms, compared to 60% of the generic E. coli. Stainless steel surfaces were exposed to different combinations of temperature (0 °C or 35 °C) and relative humidity (75% or 100%), and the bacterial attachment and survival rates were measured over 72 h and compared to controls. The results revealed that all the strains exposed to 75% relative humidity (RH) at any temperature had reduced growth (p < 0.001). In contrast, 35 °C and 100% RH supported bacterial proliferation, except for isolates forming the strongest biofilms. The ability of E. coli to form a biofilm did not impact growth reduction at 75% RH. Therefore, desiccation treatment at 75% RH at temperatures of 0 °C or 35 °C holds promise as a novel antimicrobial hurdle for the removal of biofilm-forming E. coli from challenging-to-clean surfaces and equipment within food processing facilities.

Graphical Abstract

1. Introduction

Foodborne contamination and the subsequent risk of foodborne illness depend on various factors, including worker practices, food storage, food preparation surfaces, waste management and food hygiene practices [1,2]. Pathogens such as bacteria, viruses, fungi, and parasites can contaminate food products throughout the production line, from production and manufacturing to distribution, preparation, and final consumption [2]. Among these pathogens, bacteria, particularly those belonging to the Enterobacteriaceae family, pose a significant threat to the food industry [3,4]. In particular, the Salmonella and Shiga toxin-producing E. coli (STEC) genera are responsible for severe foodborne infections [5,6]. Foodborne infections caused by pathogens can lead to severe harm and even death, especially among immunocompromised individuals, the elderly, and young children [7]. In the case of STEC, infections are particularly concerning due to their global outbreaks and pathogenicity [5]. Cattle serve as the main reservoir for STEC, with various serotypes linked to human sickness. Pathogenic bacteria, including STEC, can attach to surfaces and form biofilms, which present a challenge in food manufacturing settings as biofilms confer extreme resistance against sanitizers, antibiotics, and other external factors [8,9,10]. Over 90% of bacteria exist as a biofilm on various biotic and abiotic surfaces, including stainless steel, rubber, plastic, silicon, and glass in food manufacturing settings [10]. The proportion of STEC strains forming biofilms is relatively low, but STEC able to form extremely strong biofilms exists [11]. Effective control methods are required to prevent the formation of biofilms, which can lead to cross-contamination and compromise food safety [8,12]. Various chemical, physical, and mechanical methods have been explored to control biofilm formation but are either expensive or of limited efficacy in some situations [13]. These methods include the use of essential oils [14], enzymes [15,16], biosurfactants [17], photosensitization [13], ultrasonic waves [18,19,20], and electric fields [21,22].
Salt is widely used in the food industry due to its preservative and antibacterial properties [23]. It disrupts the osmotic balance within bacterial cells, leading to osmotic dehydration when bacterial cells are immersed in hypertonic solutions [24]. This dehydration process can partially dewater the cells and impact their cellular components and their survival [24]. The effect of salt on biofilm formation and bacterial survival was judged to be of particular interest [25], but to date there have been few studies evaluating desiccation for the control of biofilms. Numerous studies have reported the prolonged survival of E. coli O157:H7 on stainless steel surfaces, even at low temperatures [26,27,28]. As stainless steel surfaces are commonly used in food processors, this demonstrates the ability of STEC to persist and increases the risk of cross-contamination from contaminated surfaces to food items. By examining the resistance of E. coli isolates to desiccation and temperature variations, this study aimed to enhance our understanding of biofilm control strategies and the factors influencing E. coli survival and cross-contamination risks in food processing environments.

2. Materials and Methods

2.1. Selection of Isolates

Based on the ability of E. coli to form biofilm determined in a previous study [11], a total of 254 strains were selected from both generic E. coli and STEC (Table 1). Briefly, overnight cultures were diluted by combining 50 μL with 5 mL of fresh Luria-Betani medium (LB, Oxoid Ltd., Basingstoke, Hampshire, UK). A 160 μL portion of the diluted inoculum was added to duplicate wells of a round-bottom 96-well microtiter plate. Each plate included duplicate blank wells with LB medium as a negative control, and positive controls featured a known strong biofilm-forming isolate (O121:H23). After incubation at 15 °C for 4 d, microplate absorbance at 570 nm was measured using a microplate reader and biofilm formation was categorized as described in Table 1. The E. coli was originally isolated from cattle and their environment, cattle carcasses, or processing equipment as described in a previous study [29]. The STEC isolates were balanced as much as possible across different biofilm-forming classes.

2.2. Preparation of Relative Humidity Tubes

Based on methodology from a previous study [28], salt (NaCl; Sigma Aldrich, St. Louis, MO, USA) was dissolved in distilled water to achieve RH 75% (375 g/1 L), while distilled water alone was used for RH 100%. The solutions were autoclaved and dispensed into 50 mL centrifuge tubes, with each tube containing 800 µL of the respective solution. To ensure accuracy and replicate the experiment, four tubes were prepared for each RH level (75% and 100%). All replicate tubes were processed side by side at the same time on the same day as described below. Within each RH, duplicate tubes were prepared for each equilibration temperature, with tubes incubated at 0 °C or 35 °C for a period of 3 weeks.

2.3. Coupon Preparation

Food-grade stainless steel coupons (5.0 cm × 2.0 cm, grade 304, no. 4 finish) were soaked in a detergent solution (Tergazyme, Alconox Inc., New York, NY, USA) overnight. They were subsequently washed in distilled water, followed by 70% ethanol, and left to air dry, following a previously described protocol [28]. The coupons were then autoclaved and used in the subsequent experiments.

2.4. Bacterial Culture Conditions

For revitalization, the bacterial culture was inoculated from glycerol stocks onto MacConkey agar plates (Dalynn, Calgary, AB, Canada) and incubated at 35 °C for 24 h. Subsequently, a single colony was selected for subculture in 10 mL of ½ strength brain heart infusion broth (BHIB) (Oxoid). The culture was placed in a shaking incubator at 35 °C and 80 rpm for 16–18 h, resulting in a bacterial suspension with a concentration of 5–6 log CFU/cm2, which was then used for inoculating the coupons. These culture conditions were the same as used in a previous study [29] for the same strains of E. coli where concentrations of colonies were confirmed by enumeration on MacConkey agar.

2.5. Inoculation and Incubation of Stainless Steel Coupons

The coupons were inoculated by adding 50 µL of bacterial culture to one half of the coupons in individual sterile petri dishes. The petri dishes were left in a biosafety cabinet for 10 to 15 min to allow excess moisture to be absorbed. Subsequently, the equilibrating tubes were opened one at a time to prevent contamination and loss of moisture. Using sterile forceps, the inoculated coupons were carefully placed in the tubes, ensuring they did not contact the liquid, and the lids were tightly sealed. The tubes were then incubated at the same temperatures used for equilibration (0 °C or 35 °C) for a duration of approximately 72 h.

2.6. Assessment of Bacterial Counts

Freshly prepared 50 mL centrifuge tubes containing 30 mL 0.1% (w/v) pH 7.2 peptone water (Oxoid) were utilized, and the inoculated coupons with bacterial suspension were added to the tubes. Glass beads (0.5 mm) were autoclaved and pre-weighed, and 3 g was added to the tubes prior to vortexing the tubes at maximum speed for 1 min. For each sample, 10-fold serial dilutions were performed, and 1 mL of culture was filtered through a 0.45 µm membrane filter (Millipore S-Pak Type HA, 47 mm gridded, Millipore Sigma, Oakville, ON, Canada) using vacuum filtration prior to plating the filter on Lactose Monensin Glucuronate Agar (LMG Agar, Oxoid), a selective media for E. coli. The agar plates were incubated at 35 °C for 20–24 h, and the resulting blue colonies were counted. These plates served as the control for bacterial survival without exposure to any stress environment. The same procedures were used to assess bacterial numbers on the coupons incubated for 72 h at either 0 or 35 °C and these were compared to the controls.

2.7. DNA Extraction and PCR Confirmation

To confirm colonies were E. coli, DNA was extracted by lysing cells using TE buffer as previously described [30]. The amplification of bacterial DNA through PCR was performed utilizing a set of primers for the uidA gene (Table 2) [31], which resulted in the amplification of DNA fragments comprising 166 base pairs. Cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles, and each cycle consisted of a 30 s denaturation step at 95 °C, a 60 s annealing step at 60 °C, and an extension period at 50 °C for one minute. The amplified DNA products were made visible using the QIAxcel system (QIAXcel Advanced, Qiagen, Toronto, ON, Canada). For all PCR reactions, a strain of E. coli O157:H7, EDL933, was used as a positive control, while a strain of Salmonella enterica was used as a negative control.

2.8. Statistical Analysis

Statistical analyses were performed using SAS Version 9.4 (SAS Institute Inc., Cary, NC, USA) in a mixed effects model comparison. Fixed effects included temperature, humidity, and biofilm-forming class in a factorial design. Percentage reduction was the response variable and was calculated by following equation:
Percentage   reduction = 1 − ( CFU   Treatment CFU   Control ) × 100
The normality of the response variable was confirmed using Proc Univariate, with p > 0.05 for each test of normality employed. Additionally, to compare the percentage reduction between STEC and generic E. coli, we employed RStudio (R Core Team, 2023 https://www.R-project.org, accessed on 10 January 2024). In this analysis, we performed a t-test to determine 95% confidence intervals using a Bonferroni correction to avoid inflating Type 1 error. Trends were determined if 0.05 < p < 0.1, with significance at p < 0.05. The findings were visually represented using ggplot within RStudio, highlighting the distinctions between STEC and generic E. coli, the impact of biofilm class, and the effects of different treatments.

3. Results

3.1. Colony Morphology

The strains retrieved from frozen glycerol stocks were streaked on MacConkey agar plates (Dalynn), where they exhibited pink shiny textured colonies with well-defined margins. After incubation on LMG agar, colonies that lacked the expected blue coloration (Figure 1c) were occasionally noted. These included colorless colonies (Figure 1a) and partially blue-colored colonies (Figure 1b). Regardless of these variations in morphology, PCR amplification with uidA gene primers confirmed all as E. coli.

3.2. Effects of Temperature and Relative Humidity

In our investigation of desiccation stress, we subjected the E. coli strains to various combinations of temperature and relative humidity, exposing them to 75% or 100% RH at either 0 °C or 35 °C for approximately 72 h. Both temperature and relative humidity influenced (p < 0.05) bacterial growth compared to the controls. For the 10−4 dilution, a mean of 51 CFU ± 18 CFU was observed for the controls (Figure 2d). All the strains exposed to 35 °C or 0 °C and 75% RH had reduced growth (p < 0.05) (Figure 2a,b, respectively). Also, when exposed to 0 °C and 100% RH, bacterial growth was negligible (p < 0.001). Conversely, the combination of 35 °C and 100% RH provided optimal conditions that supported bacterial proliferation, which on average led to significantly increased growth compared to the controls (p < 0.001; Figure 2c).

3.3. Effects of Biofilm-Producing Ability

We observed that the biofilm-forming class of the isolate had a notable impact on the growth of isolates at 35 °C and 100% RH. Specifically, under what we expected to be optimal growth conditions, strains that were not capable of forming biofilm (class 0), moderate biofilm formers (class 2), and strong biofilm formers (class 3) had increased cell proliferation (>100% of that of controls), while isolates capable of forming the strongest biofilms (class 4 and class 5) as well as weak biofilm formers (class 1) had reduced cell growth, <100% of that of the controls (Figure 3). However, at 75% RH, the growth of all the strains was reduced compared to that of the controls and was not affected by the ability of the isolates to form biofilm.

3.4. Effects of Desiccation on STEC as Compared to Generic E. coli

In our study, we compared bacterial reductions between STEC and generic E. coli across four different conditions (0 °C + 75% RH, 35 °C + 75% RH, 0 °C + 100% RH, 35 °C + 100% RH). We found no difference (p = 0.36) in reduction between the STEC and generic isolates at 75% RH and 0 °C. Similarly, at 35 °C and 75% RH, the STEC and generic E. coli reductions were almost identical (p = 0.5). However, at 0 °C and 100% RH, the STEC exhibited a trend (p = 0.1) to a lower reduction compared to the generic E. coli of approximately 5.05%. Under optimal conditions, i.e., 35 °C and 100% RH, the STEC isolates had a lower reduction compared to the generic isolates of approximately 85.82% (p < 0.001; Figure 4).

4. Discussion

4.1. Atypical Colony Morphology

During our study, several E. coli isolates had colonies with unexpected morphologies when cultured on LMG agar after exposure to desiccation stress. Initially, the unexpected differences in colony appearance raised concerns of potential contamination. However, we later confirmed these colonies as E. coli through PCR amplification. LMG agar contains lactose as a carbon source and the lac operon is one of the best-known gene regulatory circuits, exemplifying how bacteria adapt their metabolism to nutritional conditions [32]. Stressors that disrupt the lac operon could have led to the changes in colony color. Fluctuations in temperature can impact lactose utilization by impacting the enzymatic activity of β-galactosidase as demonstrated by Fujikawa [33], where Pantoea agglomerans could produce blue pigment only at temperatures of ≥10 °C. Also, the activity and stability of enzymes involved in pigment synthesis are directly affected by the pH of the growth media. A pH fluctuation can be induced by metabolite accumulation, nutrition intake, oxygen availability, and organic acid outflow [33]. The color shift by several isolates in our study was potentially caused by stress-induced gene regulation, genetic variability, and/or adaptive responses.

4.2. Effects of Temperature and Relative Humidity

Pathogenic bacteria often encounter various abiotic stressors, such as drying, temperature fluctuations, oxidative conditions, pH changes, and osmotic pressures, among others [8]. These stress factors exert selective pressures on the resilience and virulence of these bacteria, leading to immediate effects on shorter timescales and evolutionary changes over longer periods [34]. Numerous investigations have explored the impact of these abiotic stresses on bacterial characteristics [35,36,37,38,39]. The ability of bacteria to withstand desiccation varies among different species. In general, gram-positive bacteria exhibit greater tolerance to dry conditions compared to gram-negative bacteria [40,41,42]. This study revealed that, even though the numbers of E. coli decreased on steel surfaces under dry conditions (75% relative humidity) or in the cold (0 °C), certain cells persisted, while others exhibited robust growth under the conditions of 35 °C and 100% RH for over 72 h. Desiccation tolerance has been previously investigated in E. coli, alongside three other bacterial cultures [43]. These researchers found that E. coli O157:H7 displayed the lowest resistance to desiccation compared to all the other strains. The greatest reduction in O157:H7 viability was observed when it was subjected to 24 h of desiccation at a relative humidity of 33% and pH levels of 4, 5 and 7 [43]. Furthermore, Hwang et al. [44] assessed the reduction in E. coli O157:H7 when exposed to temperatures of 22 °C and relative humidity ranging from 80% to 85% for a period of 3 to 7 d. These researchers observed a reduction in bacterial count between 0 and 3.5 log10 CFU/g in sausages [44]. This finding is relevant to our current study because it underscores the relationship between lower relative humidity and a decrease in bacterial count.
Nissen and Holck [45] reported that E. coli O157:H7 in dry sausages, which had a pH of 4.8 and water activity (aw) 0.89 exhibited greater inactivation when stored at 20 °C compared to 4 °C. Similarly, Chikthimmah and Knabel [46] revealed that bologna inoculated with 7.5 log10 CFU of E. coli O157:H7, decreased contamination more effectively when stored at 13 °C rather than 3.6 °C. Interestingly, our study contradicts these, as we observed better reductions in bacterial counts regardless of temperature when the relative humidity was lower and generally reduced growth at 0 °C as compared to 35 °C. Desiccation stresses likely differ in a food matrix as compared to the stainless steel coupons used in the present study and differences among studies could be result of variations in the food matrix, pH, water activity, and strain-specific characteristics of E. coli O157:H7. The matrix where evaluations occur undoubtedly affects experimental results. E. coli grows rapidly in soil temperatures above 30 °C but cells also have a higher mortality rate in warmer conditions (>30 °C) compared to colder temperatures (<15 °C) [47,48]. Another study indicated that E. coli can endure prolonged periods at temperatures lower than those typically found in host organisms [49] but in our study both the low and optimal temperatures could reduce bacterial growth provided relative humidity was also reduced.

4.3. Effects of Biofilm-Forming Class

As all the strains during the current study showed reduced growth compared to the controls after incubation at 75% RH, there were no significant differences in desiccation sensitivity among the classes of biofilm-formers. However, at 35 °C and 100% relative humidity, the extent to which the isolates were able to form biofilm influenced bacterial growth. Possibly, the initial growth of the most extreme biofilm formers was rapid and used the nutrients available, resulting in cell death during the 72 h incubation. Previous studies [50,51] determined that biofilm formation is most rapid at higher temperatures and the biofilm composition changes at low temperatures. When E. coli was cultivated in culture media with 0% or 1% NaCl supplementation, biofilm formation was detected, although the presence of 3.5% or 5% NaCl completely inhibited the development of the biofilm [52]. Other investigations support the notion that osmotic stress can induce biofilm production in various microorganisms, including Staphylococcus epidermidis, Clostridium ljungdahlii, and Candida albicans [53,54,55]. Perhaps extreme biofilm producers are more sensitive to osmotic stress than other E. coli strains. Weak biofilm formers (class 1) also showed reduced growth compared to the controls at 35 °C and 100% RH, possibly due to strain-related variation. The factors promoting biofilm formation in E. coli are poorly understood and are worthy of further study.
Another critical factor to consider pertains to oxygen availability. Changes in temperature and humidity can impact the levels of dissolved oxygen within the environment and a previous study hypothesized that elevated temperature at low oxygen availability increases biofilm formation [56]. Like many other bacterial species, E. coli adapts its growth behavior in response to oxygen availability. As the tubes were sealed during the 72 h incubation, the initial rapid growth of the extreme biofilm formers may have reduced oxygen levels and impeded overall bacterial growth [56]. Moreover, bacteria, including E. coli, employ quorum sensing and signaling molecules to communicate and coordinate behaviors like biofilm formation. Previous studies [57,58] determined that autoinducer 1 and autoinducer 2 are related to biofilm formation and regulation, respectively, in extreme environments in Acinetobacter baumannii, Pseudomonas aeruginosa, and Bifidobacterium longum. Temperature and humidity can potentially affect the production and reception of these signaling molecules, subsequently impacting the timing and intensity of biofilm development and cellular survival [59]. These relationships reinforce the need to consider multiple elements when devising strategies to regulate biofilm formation, with potential implications in various fields, such as healthcare and food safety.

4.4. Effects of Desiccation on STEC vs. Generic E. coli

The survival rates of the STEC strains were equal to those of the generic E. coli in our study under 75% RH. This observation contrasts with earlier research, which had indicated lower survival rates for non-pathogenic E. coli. during desiccation [60] but aligned with another study using similar methodology on stainless steel coupons where complete inactivation was observed in generic E. coli and O157 when exposed to 75% RH and 35 °C [28]. Despite not being widely considered resistant to desiccation, E. coli O157:H7 has demonstrated greater survival abilities compared to generic E. coli during drying [61,62,63,64]. The ability of STEC to survive in dry foods has led to outbreaks caused by STEC contamination since the mid-1990s [64]. The improved growth at optimal conditions (35 °C and 100% RH) for STEC noted in the present study was likely due to fewer STEC strains being able to form extremely strong biofilms compared to generic E. coli, with only 2 STEC extreme biofilm formers vs. 48 of the generic E. coli.

4.5. Is Desiccation a Potentially Useful Antimicrobial Hurdle for Beef Slaughter Plants?

Common advice to the food industry is to keep the production environment less humid (75% RH) to prevent bacterial growth [65]. However, contrary to earlier findings of decreased survival at 85% RH and greater survival of E. coli at RH < 85% [65], our study observed better bacterial inhibition at 75% as compared to 100% RH. Other studies evaluated desiccation in dry foods such as confectionary products and chocolates [60] as opposed to our studies with stainless steel coupons. Better surface attachment [66], an abundance of organic residues in desiccated food [67], and a protective matrix in food such as sugar crystals [68,69] could be possible reasons for improved bacterial survival in dry foods as compared to stainless steel under a desiccated environment.
While the meat industry typically operates at around 80% RH [70], intermittent periods of higher humidity during cleaning routines could contribute to microbial survival. Even though this study indicated that E. coli survival was reduced at 75% RH after 72 h, maintaining such precise humidity levels would likely be impractical for the food industry. A more feasible approach would be to limit periods of elevated humidity at temperatures > 0 °C, as these conditions could enhance STEC survival, growth, and biofilm formation. Also, the environment of meat processing facilities would not likely have the same restrictive effect on extreme biofilm formers seen in the present study as nutrients and oxygen would both be abundant.
Previous research indicated that STEC survival rates in food were higher in dry conditions (aw 0.5 to 0.6) at 4–15 °C compared to 20–35 °C [27,59,71], a trend shared by other bacteria [42]. In our study, survival was better at 35 °C compared to 0 °C, with an average of 24% more growth at 35 °C and 100% RH, which is likely reflective of differences in the survival of E. coli in food as compared to stainless steel. This study’s findings indicate desiccation at 75% RH was effective for growth inhibition regardless of temperature, although inhibition was most pronounced at 0 °C. Accordingly, desiccation may be a valuable strategy for mitigating the prevalence of enteric pathogens on surfaces within the context of beef processing. The utility of NaCl sprays, independently and in tandem with more aggressive compounds such as sodium hypochlorite, n-alkyl dimethyl ethylbenzyl ammonium chlorides, and peroxyacetic acid is worthy of additional study.

5. Conclusions

Our study explored the impact of desiccation stress on E. coli, uncovering unexpected results. Atypical colony morphologies initially raised concerns, but PCR confirmation verified them as E. coli. Our research showed that 75% RH yields better bacterial inhibition than 100% RH, in contrast to some other studies evaluating desiccation effects in food matrixes. The investigation showed that biofilm formation involves complex dynamics, with bacterial growth being influenced by temperature and humidity. Survival of the STEC and generic E. coli was equivalent at 75% RH but differed most markedly at 35 °C and 100% RH, likely due to the reduced biofilm-forming ability of STEC. Overall, our research indicates that desiccation at 75% humidity might be a promising approach for mitigating enteric pathogens on surfaces in beef processing. However, additional studies are necessary to determine when to apply salt sprays in conjunction with traditional sanitizers.

Author Contributions

Formal analysis, M.Q.J.; investigation, M.Q.J.; resources, K.S. and X.Y.; writing—original draft preparation, M.Q.J.; writing—review and editing, M.Q.J., I.K., X.Y. and K.S.; supervision, D.Y.; funding acquisition, K.S. and X.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Beef Cattle Research Council, grant number FOS.01.17 and Results-Driven Agricultural Research, grant # 2021R014R.

Data Availability Statement

All relevant data were presented within this manuscript. Other data are available upon request.

Acknowledgments

Thanks to Allison McNaughton for excellent technical assistance and to Uvindu Abeysekara and Skyler Ngo for additional technical support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Aklilu, A.; Kahase, D.; Dessalegn, M.; Tarekegn, N.; Gebremichael, S.; Zenebe, S.; Desta, K.; Mulugeta, G.; Mamuye, Y.; Mama, M. Prevalence of Intestinal Parasites, Salmonella and Shigella among Apparently Health Food Handlers of Addis Ababa University Student’s Cafeteria, Addis Ababa, Ethiopia. BMC Res. Notes 2015, 8, 17. [Google Scholar] [CrossRef] [PubMed]
  2. Hemalata, V.B.; Virupakshaiah, D.B.M. Isolation and Identification of Food Borne Pathogens from Spoiled Food Samples. Int. J. Curr. Microbiol. Appl. Sci. 2016, 5, 1017–1025. [Google Scholar] [CrossRef]
  3. Kolling, G.; Wu, M.; Guerrant, R.L. Enteric Pathogens through Life Stages. Front. Cell Infect. Microbiol. 2012, 2, 114. [Google Scholar] [CrossRef]
  4. Zhao, X.; Lin, C.-W.; Wang, J.; Oh, D.H. Advances in Rapid Detection Methods for Foodborne Pathogens. J. Microbiol. Biotechnol. 2014, 24, 297–312. [Google Scholar] [CrossRef] [PubMed]
  5. Majowicz, S.E.; Scallan, E.; Jones-Bitton, A.; Sargeant, J.M.; Stapleton, J.; Angulo, F.J.; Yeung, D.H.; Kirk, M.D. Global Incidence of Human Shiga Toxin Producing E. coli Infections and Deaths: A Systematic Review and Knowledge Synthesis. Foodborne Pathog. Dis. 2014, 11, 447–455. [Google Scholar] [CrossRef] [PubMed]
  6. Wells, M. Shiga Toxigenic Escherichia coli Biofilm Persistence in Beef Processing Environments and Contamination of Beef; University of Manitoba: Winnipeg, MB, Canada, 2021. [Google Scholar]
  7. Bintsis, T. Foodborne Pathogens. AIMS Microbiol. 2017, 3, 529–563. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, R.; Luedtke, B.E.; Bosilevac, J.M.; Schmidt, J.W.; Kalchayanand, N.; Arthur, T.M. Escherichia coli O157:H7 Strains Isolated from High-Event Period Beef Contamination Have Strong Biofilm-Forming Ability and Low Sanitizer Susceptibility, Which Are Associated with High PO157 Plasmid Copy Number. J. Food Prot. 2016, 79, 1875–1883. [Google Scholar] [CrossRef]
  9. Moser, C.; Jensen, P.Ø.; Thomsen, K.; Kolpen, M.; Rybtke, M.; Lauland, A.S.; Trøstrup, H.; Tolker-Nielsen, T. Immune Responses to Pseudomonas aeruginosa Biofilm Infections. Front. Immunol. 2021, 12, 625597. [Google Scholar] [CrossRef]
  10. Ribeiro, M.M.; Graziano, K.U.; Olson, N.; França, R.; Alfa, M.J. The Polytetrafluoroethylene (PTFE) Channel Model of Cyclic-Buildup Biofilm and Traditional Biofilm: The Impact of Friction, and Detergent on Cleaning and Subsequent High-Level Disinfection. Infect. Control Hosp. Epidemiol. 2020, 41, 172–180. [Google Scholar] [CrossRef]
  11. Stanford, K.; Tran, F.; Zhang, P.; Yang, X. Biofilm-Forming Capacity of Escherichia coli Isolated from Cattle and Beef Packing Plants: Relation to Virulence Attributes, Stage of Processing, Antimicrobial Interventions, and Heat Tolerance. Appl. Environ. Microbiol. 2021, 87, e01126-21. [Google Scholar] [CrossRef]
  12. Winfield, M.D.; Groisman, E.A. Role of Nonhost Environments in the Lifestyles of Salmonella and Escherichia coli. Appl. Environ. Microbiol. 2003, 69, 3687–3694. [Google Scholar] [CrossRef] [PubMed]
  13. Yu, T.; Ma, M.; Sun, Y.; Xu, X.; Qiu, S.; Yin, J.; Chen, L. The Effect of Sublethal Concentrations of Benzalkonium Chloride on the LuxS/AI-2 Quorum Sensing System, Biofilm Formation and Motility of Escherichia coli. Int. J. Food Microbiol. 2021, 353, 109313. [Google Scholar] [CrossRef] [PubMed]
  14. Burt, S. Essential Oils: Their Antibacterial Properties and Potential Applications in Foods—A Review. Int. J. Food Microbiol. 2004, 94, 223–253. [Google Scholar] [CrossRef] [PubMed]
  15. Maszewska, A.; Moryl, M.; Wu, J.; Liu, B.; Feng, L.; Rozalski, A. Amikacin and Bacteriophage Treatment Modulates Outer Membrane Proteins Composition in Proteus mirabilis Biofilm. Sci. Rep. 2021, 11, 1522. [Google Scholar] [CrossRef] [PubMed]
  16. Seghal Kiran, G.; Nishanth Lipton, A.; Kennedy, J.; Dobson, A.D.; Selvin, J. A Halotolerant Thermostable Lipase from the Marine Bacterium Oceanobacillus Sp. PUMB02 with an Ability to Disrupt Bacterial Biofilms. Bioengineered 2014, 5, 305–318. [Google Scholar] [CrossRef] [PubMed]
  17. Salisbury, A.-M.; Mullin, M.; Foulkes, L.; Chen, R.; Percival, S.L. The Ability of a Concentrated Surfactant Gel to Reduce an Aerobic, Anaerobic and Multispecies Bacterial Biofilm in Vitro. In Advances in Microbiology, Infectious Diseases and Public Health; Springer International Publishing: Cham, Switzerland, 2021; pp. 149–157. [Google Scholar]
  18. Bigelow, T.A.; Northagen, T.; Hill, T.M.; Sailer, F.C. Ultrasound Histotripsy and the Destruction of Escherichia coli Biofilms. In Proceedings of the 2008 30th Annual International Conference of the IEEE Engineering in Medicine and Biology Society, Vancouver, BC, Canada, 20–25 August 2008; IEEE: Piscataway, NJ, USA, 2008; pp. 4467–4470. [Google Scholar]
  19. Oulahal-Lagsir, N.; Martial-Gros, A.; Boistier, E.; Blum, L.J.; Bonneau, M. The Development of an Ultrasonic Apparatus for the Non-Invasive and Repeatable Removal of Fouling in Food Processing Equipment. Lett. Appl. Microbiol. 2000, 30, 47–52. [Google Scholar] [CrossRef]
  20. Yu, H.; Liu, Y.; Li, L.; Guo, Y.; Xie, Y.; Cheng, Y.; Yao, W. Ultrasound-Involved Emerging Strategies for Controlling Foodborne Microbial Biofilms. Trends Food Sci. Technol. 2020, 96, 91–101. [Google Scholar] [CrossRef]
  21. Ravikumar, K.; Basu, B.; Dubey, A.K. Analysis of Electrical Analogue of a Biological Cell and Its Response to External Electric Field. Regen. Eng. Transl. Med. 2019, 5, 10–21. [Google Scholar] [CrossRef]
  22. Sabelnikov, A.G.; Cymbalyuk, E.S.; Gongadze, G.; Borovyagin, V.L. Escherichia coli Membranes during Electrotransformation: An Electron Microscopy Study. Biochim. Biophys. Acta BBA Biomembr. 1991, 1066, 21–28. [Google Scholar] [CrossRef]
  23. Desmond, E. Reducing Salt: A Challenge for the Meat Industry. Meat Sci. 2006, 74, 188–196. [Google Scholar] [CrossRef]
  24. Csonka, L.N. Physiological and Genetic Responses of Bacteria to Osmotic Stress. Microbiol. Rev. 1989, 53, 121–147. [Google Scholar] [CrossRef] [PubMed]
  25. Rahman, M.S. Handbook of Food Preservation, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2007; ISBN 9780429191084. [Google Scholar]
  26. Maule, A. Survival of Verocytotoxigenic Escherichia coli O157 in Soil, Water and on Surfaces. J. Appl. Microbiol. 2000, 88, 71S–78S. [Google Scholar] [CrossRef] [PubMed]
  27. Wilks, S.A.; Michels, H.; Keevil, C.W. The Survival of Escherichia coli O157 on a Range of Metal Surfaces. Int. J. Food Microbiol. 2005, 105, 445–454. [Google Scholar] [CrossRef] [PubMed]
  28. Visvalingam, J.; Liu, Y.; Yang, X. Impact of Dry Chilling on the Genetic Diversity of Escherichia coli on Beef Carcasses and on the Survival of E. coli and E. coli O157. Int. J. Food Microbiol. 2017, 244, 62–66. [Google Scholar] [CrossRef] [PubMed]
  29. Zhang, P.; Tran, F.; Stanford, K.; Yang, X. Are Antimicrobial Interventions Associated with Heat-Resistant Escherichia coli on Meat? Appl. Environ. Microbiol. 2020, 86, e00512-20. [Google Scholar] [CrossRef] [PubMed]
  30. Tsai, Y.L.; Palmer, C.J.; Sangermano, L.R. Detection of Escherichia coli in Sewage and Sludge by Polymerase Chain Reaction. Appl. Environ. Microbiol. 1993, 59, 353–357. [Google Scholar] [CrossRef] [PubMed]
  31. Bej, A.K.; DiCesare, J.L.; Haff, L.; Atlas, R.M. Detection of Escherichia coli and Shigella Spp. in Water by Using the Polymerase Chain Reaction and Gene Probes for Uid. Appl. Environ. Microbiol. 1991, 57, 1013–1017. [Google Scholar] [CrossRef]
  32. Pinto, C.; Melo-Miranda, R.; Gordo, I.; Sousa, A. The Selective Advantage of the Lac Operon for Escherichia coli Is Conditional on Diet and Microbiota Composition. Front. Microbiol. 2021, 12, 709259. [Google Scholar] [CrossRef]
  33. Fujikawa, H.; Akimoto, R. New Blue Pigment Produced by Pantoea agglomerans and Its Production Characteristics at Various Temperatures. Appl. Environ. Microbiol. 2011, 77, 172–178. [Google Scholar] [CrossRef]
  34. Brouwer, A.F.; Eisenberg, M.C.; Love, N.G.; Eisenberg, J.N.S. Phenotypic Variations in Persistence and Infectivity between and within Environmentally Transmitted Pathogen Populations Impact Population-Level Epidemic Dynamics. BMC Infect. Dis. 2019, 19, 449. [Google Scholar] [CrossRef]
  35. Boor, K.J. Bacterial Stress Responses: What Doesn’t Kill Them Can Make Them Stronger. PLoS Biol. 2006, 4, e23. [Google Scholar] [CrossRef] [PubMed]
  36. Ezraty, B.; Gennaris, A.; Barras, F.; Collet, J.-F. Oxidative Stress, Protein Damage and Repair in Bacteria. Nat. Rev. Microbiol. 2017, 15, 385–396. [Google Scholar] [CrossRef] [PubMed]
  37. Guan, N.; Li, J.; Shin, H.; Du, G.; Chen, J.; Liu, L. Microbial Response to Environmental Stresses: From Fundamental Mechanisms to Practical Applications. Appl. Microbiol. Biotechnol. 2017, 101, 3991–4008. [Google Scholar] [CrossRef] [PubMed]
  38. Mihaljevic, R.R.; Sikic, M.; Klancnik, A.; Brumini, G.; Mozina, S.S.; Abram, M. Environmental Stress Factors Affecting Survival and Virulence of Campylobacter jejuni. Microb. Pathog. 2007, 43, 120–125. [Google Scholar] [CrossRef]
  39. Pinto, A.C.; de Sá, P.H.C.G.; Ramos, R.T.J.; Barbosa, S.; Barbosa, H.P.M.; Ribeiro, A.C.; Silva, W.M.; Rocha, F.S.; Santana, M.P.; de Paula Castro, T.L.; et al. Differential Transcriptional Profile of Corynebacterium pseudotuberculosis in Response to Abiotic Stresses. BMC Genom. 2014, 15, 14. [Google Scholar] [CrossRef] [PubMed]
  40. de Goffau, M.C.; Yang, X.; van Dijl, J.M.; Harmsen, H.J.M. Bacterial Pleomorphism and Competition in a Relative Humidity Gradient. Environ. Microbiol. 2009, 11, 809–822. [Google Scholar] [CrossRef] [PubMed]
  41. Janning, B.; in’t Veld, P.H. Susceptibility of Bacterial Strains to Desiccation: A Simple Method to Test Their Stability in Microbiological Reference Materials. Anal. Chim. Acta 1994, 286, 469–476. [Google Scholar] [CrossRef]
  42. Kramer, A.; Schwebke, I.; Kampf, G. How Long Do Nosocomial Pathogens Persist on Inanimate Surfaces? A Systematic Review. BMC Infect. Dis. 2006, 6, 130. [Google Scholar] [CrossRef]
  43. Suehr, Q.J.; Chen, F.; Anderson, N.M.; Keller, S.E. Effect of Ph on Survival of Escherichia coli O157, Escherichia coli O121, and Salmonella enterica during Desiccation and Short-Term Storage. J. Food Prot. 2020, 83, 211–220. [Google Scholar] [CrossRef]
  44. Hwang, C.-A.; Porto-Fett, A.C.S.; Juneja, V.K.; Ingham, S.C.; Ingham, B.H.; Luchansky, J.B. Modeling the Survival of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella typhimurium during Fermentation, Drying, and Storage of Soudjouk-Style Fermented Sausage. Int. J. Food Microbiol. 2009, 129, 244–252. [Google Scholar] [CrossRef]
  45. Nissen, H.; Holck, A. Survival of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella kentucky in Norwegian Fermented, Dry Sausage. Food Microbiol. 1998, 15, 273–279. [Google Scholar] [CrossRef]
  46. Chikthimmah, N.; Knabel, S.J. Survival of Escherichia coli O157:H7, Salmonella typhimurium, and Listeria monocytogenes in and on Vacuum Packaged Lebanon Bologna Stored at 3.6 and 13.0 °C. J. Food Prot. 2001, 64, 958–963. [Google Scholar] [CrossRef] [PubMed]
  47. Ishii, S.; Ksoll, W.B.; Hicks, R.E.; Sadowsky, M.J. Presence and Growth of Naturalized Escherichia coli in Temperate Soils from Lake Superior Watersheds. Appl. Environ. Microbiol. 2006, 72, 612–621. [Google Scholar] [CrossRef] [PubMed]
  48. Ishii, S.; Yan, T.; Vu, H.; Hansen, D.L.; Hicks, R.E.; Sadowsky, M.J. Factors Controlling Long-Term Survival and Growth of Naturalized Escherichia coli Populations in Temperate Field Soils. Microbes Environ. 2010, 25, 8–14. [Google Scholar] [CrossRef] [PubMed]
  49. Whitman, R.L.; Shively, D.A.; Pawlik, H.; Nevers, M.B.; Byappanahalli, M.N. Occurrence of Escherichia coli and Enterococci in Cladophora (Chlorophyta) in Nearshore Water and Beach Sand of Lake Michigan. Appl. Environ. Microbiol. 2003, 69, 4714–4719. [Google Scholar] [CrossRef] [PubMed]
  50. Coleri Cihan, A.; Karaca, B.; Ozel, B.P.; Kilic, T. Determination of the Biofilm Production Capacities and Characteristics of Members Belonging to Bacillaceae Family. World J. Microbiol. Biotechnol. 2017, 33, 118. [Google Scholar] [CrossRef] [PubMed]
  51. Koerdt, A.; Gödeke, J.; Berger, J.; Thormann, K.M.; Albers, S.-V. Crenarchaeal Biofilm Formation under Extreme Conditions. PLoS ONE 2010, 5, e14104. [Google Scholar] [CrossRef]
  52. Li, F.; Xiong, X.-S.; Yang, Y.-Y.; Wang, J.-J.; Wang, M.-M.; Tang, J.-W.; Liu, Q.-H.; Wang, L.; Gu, B. Effects of NaCl Concentrations on Growth Patterns, Phenotypes Associated with Virulence, and Energy Metabolism in Escherichia coli BW25113. Front. Microbiol. 2021, 12, 705326. [Google Scholar] [CrossRef]
  53. Ferreira, R.B.R.; Ferreira, M.C.S.; Glatthardt, T.; Silvério, M.P.; Chamon, R.C.; Salgueiro, V.C.; Guimarães, L.C.; Alves, E.S.; dos Santos, K.R.N. Osmotic Stress Induces Biofilm Production by Staphylococcus epidermidis Isolates from Neonates. Diagn. Microbiol. Infect. Dis. 2019, 94, 337–341. [Google Scholar] [CrossRef]
  54. Pemmaraju, S.C.; Padmapriya, K.; Pruthi, P.A.; Prasad, R.; Pruthi, V. Impact of Oxidative and Osmotic Stresses on Candida albicans Biofilm Formation. Biofouling 2016, 32, 897–909. [Google Scholar] [CrossRef]
  55. Philips, J.; Rabaey, K.; Lovley, D.R.; Vargas, M. Biofilm Formation by Clostridium Ljungdahlii Is Induced by Sodium Chloride Stress: Experimental Evaluation and Transcriptome Analysis. PLoS ONE 2017, 12, e0170406. [Google Scholar] [CrossRef] [PubMed]
  56. Kent, A.G.; Garcia, C.A.; Martiny, A.C. Increased Biofilm Formation Due to High-Temperature Adaptation in Marine Roseobacter. Nat. Microbiol. 2018, 3, 989–995. [Google Scholar] [CrossRef] [PubMed]
  57. Bhargava, N.; Sharma, P.; Capalash, N. N-Acyl Homoserine Lactone Mediated Interspecies Interactions between A. baumannii and P. aeruginosa. Biofouling 2012, 28, 813–822. [Google Scholar] [CrossRef] [PubMed]
  58. Sun, Z.; He, X.; Brancaccio, V.F.; Yuan, J.; Riedel, C.U. Bifidobacteria Exhibit LuxS-Dependent Autoinducer 2 Activity and Biofilm Formation. PLoS ONE 2014, 9, e88260. [Google Scholar] [CrossRef] [PubMed]
  59. Roy, P.K.; Ha, A.J.-W.; Mizan, M.F.R.; Hossain, M.I.; Ashrafudoulla, M.; Toushik, S.H.; Nahar, S.; Kim, Y.K.; Ha, S.-D. Effects of Environmental Conditions (Temperature, PH, and Glucose) on Biofilm Formation of Salmonella enterica Serotype Kentucky and Virulence Gene Expression. Poult. Sci. 2021, 100, 101209. [Google Scholar] [CrossRef]
  60. Hiramatsu, R.; Matsumoto, M.; Sakae, K.; Miyazaki, Y. Ability of Shiga Toxin-Producing Escherichia coli and Salmonella Spp. To Survive in a Desiccation Model System and in Dry Foods. Appl. Environ. Microbiol. 2005, 71, 6657–6663. [Google Scholar] [CrossRef] [PubMed]
  61. Deng, Y. Influence of Temperature and PH on Survival of Escherichia coli O157:H7 in Dry Foods and Growth in Reconstituted Infant Rice Cereal. Int. J. Food Microbiol. 1998, 45, 173–184. [Google Scholar] [CrossRef] [PubMed]
  62. Keene, W.E. An Outbreak of Escherichia coli 0157:H7 Infections Traced to Jerky Made from Deer Meat. JAMA J. Am. Med. Assoc. 1997, 277, 1229. [Google Scholar] [CrossRef]
  63. Paton, A.W.; Ratcliff, R.M.; Doyle, R.M.; Seymour-Murray, J.; Davos, D.; Lanser, J.A.; Paton, J.C. Molecular Microbiological Investigation of an Outbreak of Hemolytic-Uremic Syndrome Caused by Dry Fermented Sausage Contaminated with Shiga-like Toxin-Producing Escherichia coli. J. Clin. Microbiol. 1996, 34, 1622–1627. [Google Scholar] [CrossRef]
  64. Ryu, J.-H.; Deng, Y.; Beuchat, L.R. Survival of Escherichia coli O157:H7 in Dried Beef Powder as Affected by Water Activity, Sodium Chloride Content and Temperature. Food Microbiol. 1999, 16, 309–316. [Google Scholar] [CrossRef]
  65. Møretrø, T.; Heir, E.; Mo, K.R.; Habimana, O.; Abdelgani, A.; Langsrud, S. Factors Affecting Survival of Shigatoxin-Producing Escherichia coli on Abiotic Surfaces. Int. J. Food Microbiol. 2010, 138, 71–77. [Google Scholar] [CrossRef] [PubMed]
  66. Heukelekian, H.; Heller, A. Relation between Food Concentration and Surface for Bacterial Growth. J. Bacteriol. 1940, 40, 547–558. [Google Scholar] [CrossRef] [PubMed]
  67. Kuda, T.; Nakano, A.; Takahashi, H.; Kimura, B. Effect of the Quantities of Food Residues on the Desiccation Resistance of Spoilage Lactic Acid Bacteria Adhered to a Stainless Steel Surface. Food Control 2016, 68, 40–44. [Google Scholar] [CrossRef]
  68. Carrascosa, C.; Raheem, D.; Ramos, F.; Saraiva, A.; Raposo, A. Microbial Biofilms in the Food Industry—A Comprehensive Review. Int. J. Environ. Res. Public Health 2021, 18, 2014. [Google Scholar] [CrossRef]
  69. Iñiguez-Moreno, M.; Gutiérrez-Lomelí, M.; Avila-Novoa, M.G. Kinetics of Biofilm Formation by Pathogenic and Spoilage Microorganisms under Conditions That Mimic the Poultry, Meat, and Egg Processing Industries. Int. J. Food Microbiol. 2019, 303, 32–41. [Google Scholar] [CrossRef]
  70. Mettler, E.; Carpentier, B. Variations over Time of Microbial Load and Physicochemical Properties of Floor Materials after Cleaning in Food Industry Premises. J. Food Prot. 1998, 61, 57–65. [Google Scholar] [CrossRef]
  71. Williams, A.P.; Avery, L.M.; Killham, K.; Jones, D.L. Persistence of Escherichia coli O157 on Farm Surfaces under Different Environmental Conditions. J. Appl. Microbiol. 2005, 98, 1075–1083. [Google Scholar] [CrossRef]
Microorganisms 12 00243 g001
Figure 1. Unexpected colony morphology after growth of E. coli on LMG agar after 72 h including (a) entirely colorless colonies and (b) partial blue colonies in comparison to (c) expected blue colonies.
Figure 1. Unexpected colony morphology after growth of E. coli on LMG agar after 72 h including (a) entirely colorless colonies and (b) partial blue colonies in comparison to (c) expected blue colonies.
Microorganisms 12 00243 g001
Microorganisms 12 00243 g002
Figure 2. Growth of E. coli strains on LMG agar under different conditions over 72 h: (a) Lack of growth at 35 °C and 75% RH, (b) Reduced growth when exposed to 0 °C and 75% RH, (c) Increased growth when exposed to 35 °C and 100% RH, and (d) Bacterial colonies from control without any treatment.
Figure 2. Growth of E. coli strains on LMG agar under different conditions over 72 h: (a) Lack of growth at 35 °C and 75% RH, (b) Reduced growth when exposed to 0 °C and 75% RH, (c) Increased growth when exposed to 35 °C and 100% RH, and (d) Bacterial colonies from control without any treatment.
Microorganisms 12 00243 g002
Microorganisms 12 00243 g003
Figure 3. Influence of biofilm class on growth as a percentage of control after treatments. Comparison of desiccation tolerance between different biofilm formation categories. Biofilm classes are defined as 0 = non-biofilm former, 1 = weak biofilm, 2 = moderate biofilm, 3 = strong biofilm, 4 = very strong biofilm, and 5 = extremely strong biofilm. a,b,c Means with different superscripts within treatment combinations differ (p < 0.05).
Figure 3. Influence of biofilm class on growth as a percentage of control after treatments. Comparison of desiccation tolerance between different biofilm formation categories. Biofilm classes are defined as 0 = non-biofilm former, 1 = weak biofilm, 2 = moderate biofilm, 3 = strong biofilm, 4 = very strong biofilm, and 5 = extremely strong biofilm. a,b,c Means with different superscripts within treatment combinations differ (p < 0.05).
Microorganisms 12 00243 g003
Microorganisms 12 00243 g004
Figure 4. Box plot representation of percentage reduction values for various treatments in biofilm formation. The data are categorized by STEC and generic strains, denoted by different colors and each point indicates one isolate. The box plot illustrates the distribution of percentage reduction values within each treatment, providing insights into the variability and central tendencies of the data. Means within treatment combinations with different superscripts differ. a,b Generic and STEC strains tended to differ in percentage reduction (p < 0.1). A,B Generic and STEC strains differed in percentage reduction (p < 0.001). Negative percentage reductions are indicative of cell growth.
Figure 4. Box plot representation of percentage reduction values for various treatments in biofilm formation. The data are categorized by STEC and generic strains, denoted by different colors and each point indicates one isolate. The box plot illustrates the distribution of percentage reduction values within each treatment, providing insights into the variability and central tendencies of the data. Means within treatment combinations with different superscripts differ. a,b Generic and STEC strains tended to differ in percentage reduction (p < 0.1). A,B Generic and STEC strains differed in percentage reduction (p < 0.001). Negative percentage reductions are indicative of cell growth.
Microorganisms 12 00243 g004
Table 1. Biofilm-forming classes of E. coli isolates as determined by optical density (OD).
Table 1. Biofilm-forming classes of E. coli isolates as determined by optical density (OD).
Biofilm Class 1Generic E. coliSTEC 2
0, non-biofilm former4592
1, weak44
2, moderate220
3, strong410
4, very strong100
5, extremely strong482
1 Biofilm-forming class is as follows: non-biofilm former, x < ODc; weak < ODc < x < 2 x ODc; moderate, 2 x ODc < x < 4 x ODc; strong, 4 x ODc < x < 8 x ODc; very strong biofilm formers, 8 x ODc < x < 16 x ODc; and extremely strong, 16 x ODc < x. 2 Shiga toxin-producing E. coli isolates. x = OD of two independent replicates for each isolate. ODc = three times the standard deviation of OD of negative control plus average OD of negative control.
Table 2. Forward and reverse primers for uidA gene for generic PCR amplification of E. coli STEC.
Table 2. Forward and reverse primers for uidA gene for generic PCR amplification of E. coli STEC.
Primer SetSequence
uidAF: 5′ TGGTAATTACCGACGAAAACGGC 3′
R: 5′ ACGCGTGGTTACAGTCTTGCG 3′
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Javed, M.Q.; Kovalchuk, I.; Yevtushenko, D.; Yang, X.; Stanford, K. Relationship between Desiccation Tolerance and Biofilm Formation in Shiga Toxin-Producing Escherichia coli. Microorganisms 2024, 12, 243. https://doi.org/10.3390/microorganisms12020243

AMA Style

Javed MQ, Kovalchuk I, Yevtushenko D, Yang X, Stanford K. Relationship between Desiccation Tolerance and Biofilm Formation in Shiga Toxin-Producing Escherichia coli. Microorganisms. 2024; 12(2):243. https://doi.org/10.3390/microorganisms12020243

Chicago/Turabian Style

Javed, Muhammad Qasim, Igor Kovalchuk, Dmytro Yevtushenko, Xianqin Yang, and Kim Stanford. 2024. "Relationship between Desiccation Tolerance and Biofilm Formation in Shiga Toxin-Producing Escherichia coli" Microorganisms 12, no. 2: 243. https://doi.org/10.3390/microorganisms12020243

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop