Establishment and Application of a Quadruplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay for Differentiation of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, Porcine Circovirus Type 3, and Streptococcus suis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primer and Probe Design
2.2. Standard Plasmid Construction
2.3. Optimization of PCR Amplification Conditions
2.4. Construction of Standard Curves
2.5. Validation of Specificity, Sensitivity and Stability
2.6. Comparison with the Uniplex Real-Time PCR Method in Clinical Sample Testing
3. Results
3.1. Optimizing Primers and Probes through Sequence Analysis
3.2. Optimization of Quadruplex-qPCR Reaction Conditions
3.3. Establishment of Standard Curves
3.4. Stability, Specificity, and Sensitivity of the Quadruplex Real-Time PCR Method
3.5. Comparison with the Uniplex Real-Time PCR Method in Clinical Sample Testing
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Assavacheep, P.; Thanawongnuwech, R. Porcine respiratory disease complex: Dynamics of polymicrobial infections and management strategies after the introduction of the African swine fever. Front. Vet. Sci. 2022, 9, 1048861. [Google Scholar] [CrossRef]
- Sun, Q.; Yu, X.; He, D.; Ku, X.; Hong, B.; Zeng, W.; Zhang, H.; He, Q. Investigation and analysis of etiology associated with porcine respiratory disease complex in China from 2017 to 2021. Front. Vet. Sci. 2022, 9, 960033. [Google Scholar] [CrossRef]
- Petri, F.A.M.; Ferreira, G.C.; Arruda, L.P.; Malcher, C.S.; Storino, G.Y.; Almeida, H.M.S.; Sonalio, K.; Silva, D.G.D.; Oliveira, L.G. Associations between Pleurisy and the Main Bacterial Pathogens of the Porcine Respiratory Diseases Complex (PRDC). Animals 2023, 13, 1493. [Google Scholar] [CrossRef]
- Zhu, H.; Li, X.; Chen, H.; Qian, P. Genetic characterization and pathogenicity of a Eurasian avian-like H1N1 swine influenza reassortant virus. Virol. J. 2022, 19, 205. [Google Scholar] [CrossRef]
- Xu, M.; Wang, S.; Li, L.; Lei, L.; Liu, Y.; Shi, W.; Wu, J.; Li, L.; Rong, F.; Xu, M.; et al. Secondary infection with Streptococcus suis serotype 7 increases the virulence of highly pathogenic porcine reproductive and respiratory syndrome virus in pigs. Virol. J. 2010, 7, 184. [Google Scholar] [CrossRef]
- Yu, J.; Wu, J.; Zhang, Y.; Guo, L.; Cong, X.; Du, Y.; Li, J.; Sun, W.; Shi, J.; Peng, J.; et al. Concurrent highly pathogenic porcine reproductive and respiratory syndrome virus infection accelerates Haemophilus parasuis infection in conventional pigs. Vet. Microbiol. 2012, 158, 316–321. [Google Scholar] [CrossRef]
- Ku, X.; Chen, F.; Li, P.; Wang, Y.; Yu, X.; Fan, S.; Qian, P.; Wu, M.; He, Q. Identification and genetic characterization of porcine circovirus type 3 in China. Transbound. Emerg. Dis. 2017, 64, 703–708. [Google Scholar] [CrossRef]
- Ruan, S.; Ren, W.; Yu, B.; Yu, X.; Wu, H.; Li, W.; Jiang, Y.; He, Q. Development and Implementation of a Quadruple RT-qPCR Method for the Identification of Porcine Reproductive and Respiratory Syndrome Virus Strains. Viruses 2023, 15, 1946. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Chang, X.; Zhou, J.; Wang, D.; Zhou, J.; Fan, B.; Ni, Y.; Yin, J.; Lv, L.; Zhao, Y.; et al. Co-infection analysis of bacterial and viral respiratory pathogens from clinically healthy swine in Eastern China. Vet. Med. Sci. 2021, 7, 1815–1819. [Google Scholar] [CrossRef] [PubMed]
- Fablet, C.; Marois, C.; Dorenlor, V.; Eono, F.; Eveno, E.; Jolly, J.P.; Le Devendec, L.; Kobisch, M.; Madec, F.; Rose, N. Bacterial pathogens associated with lung lesions in slaughter pigs from 125 herds. Res. Vet. Sci. 2012, 93, 627–630. [Google Scholar] [CrossRef] [PubMed]
- Opriessnig, T.; Gimenez-Lirola, L.G.; Halbur, P.G. Polymicrobial respiratory disease in pigs. Anim. Health Res. Rev. 2011, 12, 133–148. [Google Scholar] [CrossRef]
- Cheong, Y.; Oh, C.; Lee, K.; Cho, K.H. Survey of porcine respiratory disease complex-associated pathogens among commercial pig farms in Korea via oral fluid method. J. Vet. Sci. 2017, 18, 283–289. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Peng, Z.; Song, W.; Zhang, C.; Fan, J.; Chen, H.; Hua, L.; Pei, J.; Tang, X.; Chen, H.; et al. A triplex real-time PCR method to detect African swine fever virus gene-deleted and wild type strains. Front. Vet. Sci. 2022, 9, 943099. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Cao, C.; Shi, W.; Huang, C.; Zeng, S.; Sun, J.; Wu, J.; Hua, Q. Development of a triplex real-time PCR assay for detection and differentiation of gene-deleted and wild-type African swine fever virus. J. Virol. Methods 2020, 280, 113875. [Google Scholar] [CrossRef]
- Jiao, Q.; Yang, L.; Liu, X.; Wen, Y.; Tian, L.; Qian, P.; Chen, H.; Li, X. Isolation and pathogenicity of porcine circovirus type 2 in mice from Guangxi province, China. Virol. J. 2023, 20, 195. [Google Scholar] [CrossRef] [PubMed]
- Goecke, N.B.; Kobbero, M.; Kusk, T.K.; Hjulsager, C.K.; Pedersen, K.S.; Kristensen, C.S.; Larsen, L.E. Objective pathogen monitoring in nursery and finisher pigs by monthly laboratory diagnostic testing. Porc. Health Manag. 2020, 6, 23. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-Infection of Swine with Porcine Circovirus Type 2 and Other Swine Viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef]
- Boeters, M.; Garcia-Morante, B.; van Schaik, G.; Segales, J.; Rushton, J.; Steeneveld, W. The economic impact of endemic respiratory disease in pigs and related interventions—A systematic review. Porc. Health Manag. 2023, 9, 45. [Google Scholar] [CrossRef]
- D’Annunzio, G.; Ostanello, F.; Muscatello, L.V.; Orioles, M.; Jacumin, N.; Tommasini, N.; Leotti, G.; Luppi, A.; Mandrioli, L.; Sarli, G. Porcine circovirus type 2 and porcine reproductive and respiratory syndrome virus alone or associated are frequent intralesional detected viruses in porcine respiratory disease complex cases in Northern Italy. Front. Vet. Sci. 2023, 10, 1234779. [Google Scholar] [CrossRef]
- Sunaga, F.; Tsuchiaka, S.; Kishimoto, M.; Aoki, H.; Kakinoki, M.; Kure, K.; Okumura, H.; Okumura, M.; Okumura, A.; Nagai, M.; et al. Development of a one-run real-time PCR detection system for pathogens associated with porcine respiratory diseases. J. Vet. Med. Sci. 2020, 82, 217–223. [Google Scholar] [CrossRef]
- Tang, X.; Zhao, Z.; Hu, J.; Wu, B.; Cai, X.; He, Q.; Chen, H. Isolation, antimicrobial resistance, and virulence genes of Pasteurella multocida strains from swine in China. J. Clin. Microbiol. 2009, 47, 951–958. [Google Scholar] [CrossRef]
- Liu, J.; Jasim, I.; Shen, Z.; Zhao, L.; Dweik, M.; Zhang, S.; Almasri, M. A microfluidic based biosensor for rapid detection of Salmonella in food products. PLoS ONE 2019, 14, e0216873. [Google Scholar] [CrossRef]
- Jarvinen, A.K.; Laakso, S.; Piiparinen, P.; Aittakorpi, A.; Lindfors, M.; Huopaniemi, L.; Piiparinen, H.; Maki, M. Rapid identification of bacterial pathogens using a PCR- and microarray-based assay. BMC Microbiol. 2009, 9, 161. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.J.; Han, Q.Y.; Sun, Y.; Zhang, X.; Qiu, H.J. Development of a triplex TaqMan real-time RT-PCR assay for differential detection of wild-type and HCLV vaccine strains of classical swine fever virus and bovine viral diarrhea virus 1. Res. Vet. Sci. 2012, 92, 512–518. [Google Scholar] [CrossRef] [PubMed]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yao, M.; Tang, Z.; Xu, D.; Luo, Y.; Gao, Y.; Yan, L. Development and application of a triplex real-time PCR assay for simultaneous detection of avian influenza virus, Newcastle disease virus, and duck Tembusu virus. BMC Vet. Res. 2020, 16, 203. [Google Scholar] [CrossRef] [PubMed]
- Lung, O.; Ohene-Adjei, S.; Buchanan, C.; Joseph, T.; King, R.; Erickson, A.; Detmer, S.; Ambagala, A. Multiplex PCR and Microarray for Detection of Swine Respiratory Pathogens. Transbound Emerg. Dis. 2017, 64, 834–848. [Google Scholar] [CrossRef] [PubMed]
- Lazov, C.M.; Papetti, A.; Belsham, G.J.; Botner, A.; Rasmussen, T.B.; Boniotti, M.B. Multiplex Real-Time RT-PCR Assays for Detection and Differentiation of Porcine Enteric Coronaviruses. Pathogens 2023, 12, 1040. [Google Scholar] [CrossRef] [PubMed]
- Li, C.Q.; Hu, L.Q.; Liu, G.P.; Wang, Y.; Li, T.; Chen, S.X.; Yang, X.L.; Ma, L.X.; Zeng, J.G. A duplex nested RT-PCR method for monitoring porcine epidemic diarrhea virus and porcine delta-coronavirus. BMC Vet. Res. 2023, 19, 151. [Google Scholar] [CrossRef]
- Wang, C.; Hou, B.; Shao, G.; Wan, C. Development of a One-Step Real-Time TaqMan Reverse Transcription Polymerase Chain Reaction (RT-PCR) Assay for the Detection of the Novel Variant Infectious Bursal Disease Virus (nVarIBDV) Circulating in China. Viruses 2023, 15, 1453. [Google Scholar] [CrossRef]
Name | Gene | Sequence (5′-3′) of Primer/Probe | Size (bp) |
---|---|---|---|
PRRSV-F | ORF6 | CGGCAAATGATAACCACG | |
PRRSV-R | CCACCCAACACGAGGCTT | 125 bp | |
PRRSV-P | FAM-CGGCTCCACTACGGTCAACG-BHQ1 | ||
PCV2-F | ORF2 | CCTACATGGTCTACATTTC | |
PCV2-R | CTTCCAACCCAATAACAA | 72 bp | |
PCV2-P | ROX-AATCAACTCTGGCTGAGACTACAA-BHQ2 | ||
PCV3-F | ORF2 | GGCCTCCTAATGAATAGTC | |
PCV3-R | GAGCTATATTCAGAAGAAGACC | 92 bp | |
PCV3-P | VIC-TTCTGTGGCGTCGTCGTCTC-BHQ1 | ||
SS-F | GDH | CATGGACAGATAAAGATGG | |
SS-R | GAGGAACTTCAAGATGGA | 131 bp | |
SS-P | CY5-AAGTCAACCGTGGCTACCGT-BHQ2 |
Pathogens | DNA/cDNA (Positive Samples) | Within-Group Test | Between-Group Test | ||
---|---|---|---|---|---|
Ct a (Mean ± SD) | C.V. b | Ct (Mean ± SD) | C.V. b | ||
PRRSV | 1 | 21.60 ± 0.18 | 0.84% | 21.80 ± 0.21 | 0.92% |
2 | 17.71 ± 0.15 | 0.83% | 17.95 ± 0.24 | 1.36% | |
3 | 13.79 ± 0.06 | 0.47% | 13.94 ± 0.15 | 1.08% | |
PCV2 | 1 | 21.22 ± 0.080 | 0.39% | 21.92 ± 0.69 | 3.18% |
2 | 17.56 ± 0.01 | 0.07% | 18.07 ± 0.50 | 2.81% | |
3 | 13.76 ± 0.09 | 0.06% | 14.93 ± 0.47 | 3.31% | |
PCV3 | 1 | 21.75 ± 0.19 | 0.89% | 22.00 ± 0.24 | 1.12% |
2 | 18.39 ± 0.35 | 1.91% | 19.00 ± 0.61 | 3.26% | |
3 | 14.05 ± 0.22 | 1.57% | 14.58 ± 0.53 | 3.64% | |
SS | 1 | 24.51 ± 0.21 | 0.86% | 24.56 ± 0.14 | 0.57% |
2 | 20.39 ± 0.22 | 1.60% | 20.45 ± 0.15 | 0.73% | |
3 | 16.56 ± 0.06 | 0.39% | 16.36 ± 0.20 | 1.24% |
Plasmid Name | 10-Fold Gradient Dilutions | 104 | 103 | 102 | 101 | 100 | 10−1 |
---|---|---|---|---|---|---|---|
PRRSV-ORF6-pMD18T | concentrations (copies/μL) | 2.80 × 104 | 2.80 × 103 | 2.80 × 102 | 2.80 × 101 | 2.8 × 100 | 2.80 × 10−1 |
Ct value | 25.55 | 29.35 | 32.7 | 36.37 | N/A a | N/A | |
PCV2-ORF2-pMD18T | concentrations (copies/μL) | 1.96 × 104 | 1.96 × 103 | 1.96 × 102 | 1.96 × 101 | 1.96 × 100 | 1.96 × 10−1 |
Ct value | 26.66 | 29.39 | 32.94 | 34.86 | N/A | N/A | |
PCV3-ORF2-pMD18T | concentrations (copies/μL) | 2.30 × 104 | 2.30 × 103 | 2.30 × 102 | 2.30 × 101 | 2.30 × 100 | 2.30 × 10−1 |
Ct value | 25.7 | 29.56 | 33.26 | 36.22 | N/A | N/A | |
SS-GDH-pMD18T | Concentrations (copies/μL) | 1.75 × 104 | 1.75 × 103 | 1.75 × 102 | 1.75 × 101 | 1.75 × 100 | 1.75 × 10−1 |
Ct value | 28.51 | 33.81 | N/A | N/A | N/A | N/A |
Positive Nucleic Acid | 10-Fold Gradient Dilutions | 106 | 105 | 104 | 103 | 102 | 101 |
---|---|---|---|---|---|---|---|
PRRSV (vaccine of TJ-F92 strains) | Virus tites(TCID50/mL) | 106 TCID50 | 105 TCID50 | 104 TCID50 | 103 TCID50 | 102 TCID50 | 101 TCID50 |
Ct value | 19.52 | 23.34 | 27.10 | 30.94 | 35.25 | N/A a | |
PCV2 (PCV2-GX-6 strains) | Bacterial count by plate (TCID50/mL) | 106 TCID50 | 105 TCID50 | 104 TCID50 | 103 TCID50 | 102 TCID50 | 101 TCID50 |
Ct value | 24.20 | 27.60 | 30.14 | 34.49 | N/A | N/A | |
PCV3 (Positive nucleic acid) | 10-fold gradient dilutions | 106 | 105 | 104 | 103 | 102 | 101 |
Ct value | 19.72 | 23.03 | 27.07 | 30.98 | 34.05 | N/A | |
SS | Bacterial count by plate (CFU/mL) | 106 CFU | 105 CFU | 104 CFU | 103 CFU | 102 CFU | 101 CFU |
Ct value | 20.12 | 24.01 | 27.56 | 31.79 | N/A | N/A |
Samples | Types | PRRSV | SS | PCV2 | PCV3 | ||||
---|---|---|---|---|---|---|---|---|---|
qu-PCR c | gb-PCR a | qu-PCR c | gb-PCR a | qu-PCR c | gb-PCR a | qu-PCR c | db-PCR b | ||
1 | lung | + | + | + | + | + | + | + | + |
2 | lung | + | + | − | − | − | − | + | + |
3 | lung | + | + | − | − | − | − | + | + |
4 | lung | − | − | − | + | − | − | − | − |
5 | lung | + | + | − | − | − | − | + | + |
6 | serum | − | − | − | − | − | − | + | + |
7 | serum | + | + | − | − | − | − | − | − |
8 | serum | + | + | − | − | − | − | + | + |
9 | serum | − | − | − | − | − | − | + | + |
10 | serum | + | + | − | − | − | − | − | − |
11 | spleen | − | − | − | − | − | − | − | − |
12 | spleen | + | + | − | − | − | − | + | + |
13 | spleen | + | + | − | + | + | + | + | + |
14 | spleen | + | + | − | − | − | − | + | + |
15 | tonsil | − | − | − | − | − | − | + | + |
16 | tonsil | + | + | − | − | − | − | + | + |
17 | tonsil | − | − | − | − | − | − | + | + |
18 | tonsil | + | + | + | + | − | − | + | + |
19 | MLN | + | + | − | − | − | − | − | − |
20 | MLN | + | + | − | − | − | − | + | + |
21 | MLN | + | + | − | − | − | − | + | + |
22 | MLN | − | − | − | − | + | + | + | + |
23 | ILN | + | + | − | − | − | − | − | − |
24 | ILN | + | + | − | − | − | − | + | + |
25 | ILN | − | - | − | − | − | − | + | + |
26 | ILN | + | + | − | − | + | + | + | + |
27 | HLN | + | + | − | − | − | − | − | − |
28 | HLN | − | − | − | − | − | − | + | + |
29 | HLN | + | + | − | − | − | − | + | + |
30 | HLN | − | − | − | − | + | + | − | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, G.; Zhu, H.; Zhan, C.; Chen, P.; Wu, B.; Peng, Z.; Qian, P.; Cheng, G. Establishment and Application of a Quadruplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay for Differentiation of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, Porcine Circovirus Type 3, and Streptococcus suis. Microorganisms 2024, 12, 427. https://doi.org/10.3390/microorganisms12030427
Wang G, Zhu H, Zhan C, Chen P, Wu B, Peng Z, Qian P, Cheng G. Establishment and Application of a Quadruplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay for Differentiation of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, Porcine Circovirus Type 3, and Streptococcus suis. Microorganisms. 2024; 12(3):427. https://doi.org/10.3390/microorganisms12030427
Chicago/Turabian StyleWang, Geng, Hechao Zhu, Cunlin Zhan, Pin Chen, Bin Wu, Zhong Peng, Ping Qian, and Guofu Cheng. 2024. "Establishment and Application of a Quadruplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assay for Differentiation of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, Porcine Circovirus Type 3, and Streptococcus suis" Microorganisms 12, no. 3: 427. https://doi.org/10.3390/microorganisms12030427