Engineering Terpene Production Pathways in Methylobacterium extorquens AM1
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains, Media, and Growth Conditions
2.2. Plasmid Generation and Electroporation
2.3. Terpene Production and Extraction
2.4. GC-FID/GC-MS Analysis
2.5. Competition Experiments
3. Results and Discussion
- Patchoulol synthase under a constitutive promoter fails to produce patchoulol
- Native methylotrophic promoter successfully produces patchoulol
- Impact of the lanthanide switch on production of patchoulol
- Assessing the methylotrophic engineering of diterpenes
- Methylotrophic engineered strains can compete for colonization in the phyllosphere
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Henke, N.A.; Wichmann, J.; Baier, T.; Frohwitter, J.; Lauersen, K.J.; Risse, J.M.; Peters-Wendisch, P.; Kruse, O.; Wendisch, V.F. Patchoulol production with metabolically engineered Corynebacterium glutamicum. Genes 2018, 9, 219. [Google Scholar] [CrossRef]
- Zhan, X.; Zhang, Y.H.; Chen, D.F.; Simonsen, H.T. Metabolic engineering of the moss Physcomitrella patens to produce the sesquiterpenoids patchoulol and α/β-santalene. Front. Plant Sci. 2014, 5, 536. [Google Scholar] [CrossRef]
- Zhou, F.; Pichersky, E. More is better: The diversity of terpene metabolism in plants. Curr. Opin. Plant Biol. 2020, 55, 1–10. [Google Scholar] [CrossRef]
- Veitch, G.E.; Beckmann, E.; Burke, B.J.; Boyer, A.; Maslen, S.L.; Ley, S.V. Synthesis of azadirachtin: A long but successful journey. Angew. Chem. Int. Ed. 2007, 46, 7629–7632. [Google Scholar] [CrossRef] [PubMed]
- Paddon, C.J.; Keasling, J.D. Semi-synthetic artemisinin: A model for the use of synthetic biology in pharmaceutical development. Nat. Rev. Microbiol. 2014, 12, 355–367. [Google Scholar] [CrossRef] [PubMed]
- Kadkade, P.G.; Prince, C.L.; Roach, B.L.; Antonio, S. Enhanced Production of Taxol and Taxanes by Cell Cultures of Taxus Species. Patent WO/1993/017121, 2013. Available online: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwiTv6Gvy8-EAxVrnK8BHY-OD5EQFnoECBMQAQ&url=https%3A%2F%2Fdata.epo.org%2Fgpi%2FEP0960944A1.pdf%3Fdownload%3Dtrue&usg=AOvVaw0IeO8sGVHlyWVZ6IiGvLAJ&opi=89978449 (accessed on 11 May 2023).
- Mao, G.; Chaturvedula, P.V.S.; Yu, O. Non-Caloric Sweetener. U.S. Patent 9,765,104B2, 2017. Available online: https://uspto.report/patent/grant/9765104 (accessed on 11 May 2023).
- Leonard, E.; Ajikumar, P.K.; Thayer, K.; Xiao, W.-H.; Mo, J.D.; Tidor, B.; Stephanopoulos, G.; Prather, K.L.J. Combining metabolic and protein engineering of a terpenoid biosynthetic pathway for overproduction and selectivity control. Proc. Natl. Acad. Sci. USA 2010, 107, 13654–13659. [Google Scholar] [CrossRef] [PubMed]
- Frontiers|Microbial Platform for Terpenoid Production: Escherichia coli and Yeast [Internet]. Available online: https://www.frontiersin.org/articles/10.3389/fmicb.2018.02460/full (accessed on 22 January 2024).
- Kirby, J.; Nishimoto, M.; Chow, R.W.N.; Baidoo, E.E.K.; Wang, G.; Martin, J.; Schackwitz, W.; Chan, R.; Fortman, J.L.; Keasling, J.D. Enhancing Terpene Yield from Sugars via Novel Routes to 1-Deoxy-d-Xylulose 5-Phosphate. Appl. Environ. Microbiol. 2015, 81, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Bohlmann, J.; Keeling, C.I. Terpenoid biomaterials. Plant J. 2008, 54, 656–669. [Google Scholar] [CrossRef] [PubMed]
- Morrone, D.; Lowry, L.; Determan, M.K.; Hershey, D.M.; Xu, M.; Peters, R.J. Increasing diterpene yield with a modular metabolic engineering system in E. coli: Comparison of MEV and MEP isoprenoid precursor pathway engineering. Appl. Microbiol. Biotechnol. 2010, 85, 1893–1906. [Google Scholar] [CrossRef] [PubMed]
- Sonntag, F.; Kroner, C.; Lubuta, P.; Peyraud, R.; Horst, A.; Buchhaupt, M.; Schrader, J. Engineering Methylobacterium extorquens for de novo synthesis of the sesquiterpenoid α-humulene from methanol. Metab. Eng. 2015, 32, 82–94. [Google Scholar] [CrossRef]
- Delmotte, N.; Knief, C.; Chaffron, S.; Innerebner, G.; Roschitzki, B.; Schlapbach, R.; von Mering, C.; Vorholt, J.A. Community proteogenomics reveals insights into the physiology of phyllosphere bacteria. Proc. Natl. Acad. Sci. USA 2009, 106, 16428–16433. [Google Scholar] [CrossRef]
- Good, N.M.; Vu, H.N.; Suriano, C.J.; Subuyuj, G.A.; Skovran, E.; Martinez-Gomez, N.C. Pyrroloquinoline quinone ethanol dehydrogenase in Methylobacterium extorquens AM1 extends lanthanide-dependent metabolism to multicarbon substrates. J. Bacteriol. 2016, 198, 3109–3118. [Google Scholar] [CrossRef]
- Skovran, E.; Martinez-Gomez, N.C. Just add lanthanides. Science 2015, 348, 862–863. [Google Scholar] [CrossRef]
- Van Dien, S.J.; Marx, C.J.; O’Brien, B.N.; Lidstrom, M.E. Genetic Characterization of the Carotenoid Biosynthetic Pathway in Methylobacterium extorquens AM1 and Isolation of a Colorless Mutant. Appl. Environ. Microbiol. 2003, 69, 7563–7566. [Google Scholar] [CrossRef]
- Ma, B.; Liu, M.; Li, Z.H.; Tao, X.; Wei, D.Z.; Wang, F.Q. Significantly Enhanced Production of Patchoulol in Metabolically Engineered Saccharomyces cerevisiae. J. Agric. Food Chem. 2019, 67, 8590–8598. [Google Scholar] [CrossRef]
- Munck, S.L.; Croteau, R. Purification and characterization of the sesquiterpene cyclase patchoulol synthase from Pogostemon cablin. Arch. Biochem. Biophys. 1990, 282, 58–64. [Google Scholar] [CrossRef] [PubMed]
- Dueber, M.; Adolf, W.; West, C. Biosynthesis of the Diterpene Phytoalexin Casbene: Partial Purification and Characterization of Casbene Synthetase from Ricinis communis. Plant Physiol. 1978, 62, 598–603. [Google Scholar] [CrossRef] [PubMed]
- Bibik, J.D.; Weraduwage, S.M.; Banerjee, A.; Robertson, K.; Espinoza-Corral, R.; Sharkey, T.D.; Lundquist, P.K.; Hamberger, B.R. Pathway Engineering, Re-targeting, and Synthetic Scaffolding Improve the Production of Squalene in Plants. ACS Synth. Biol. 2022, 11, 2121–2133. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.; Callari, R.; Hamberger, B.; Wubshet, S.G.; Nielsen, M.T.; Andersen-Ranberg, J.; Hallström, B.M.; Cozzi, F.; Heider, H.; Møller, B.L.; et al. Oxidation and cyclization of casbene in the biosynthesis of Euphorbia factors from mature seeds of Euphorbia lathyris L. Proc. Natl. Acad. Sci. USA 2016, 113, E5082–E5089. [Google Scholar] [CrossRef] [PubMed]
- Delaney, N.F.; Kaczmarek, M.E.; Ward, L.M.; Swanson, P.K.; Lee, M.C.; Marx, C.J. Development of an Optimized Medium, Strain and High-Throughput Culturing Methods for Methylobacterium extorquens. PLoS ONE 2013, 8, e62957. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.C.; Chou, H.H.; Marx, C.J. Asymmetric, bimodal trade-offs during adaptation of methylobacterium to distinct growth substrates. Evolution 2009, 63, 2816–2830. [Google Scholar] [CrossRef] [PubMed]
- Bose, A.; Metcalf, W.W. Distinct regulators control the expression of methanol methyltransferase isozymes in Methanosarcina acetivorans C2A. Mol. Microbiol. 2008, 67, 649–661. [Google Scholar] [CrossRef] [PubMed]
- Skovran, E.; Palmer, A.D.; Rountree, A.M.; Good, N.M.; Lidstrom, M.E. XoxF is required for expression of methanol dehydrogenase in Methylobacterium extorquens AM1. J. Bacteriol. 2011, 193, 6032–6038. [Google Scholar] [CrossRef] [PubMed]
- Deguerry, F.; Pastore, L.; Wu, S.; Clark, A.; Chappell, J.; Schalk, M. The diverse sesquiterpene profile of patchouli, Pogostemon cablin, is correlated with a limited number of sesquiterpene synthases. Arch. Biochem. Biophys. 2006, 454, 123–136. [Google Scholar] [CrossRef] [PubMed]
- Cyr, A.; Wilderman, P.R.; Determan, M.; Peters, R.J. A modular approach for facile biosynthesis of labdane-related diterpenes. J. Am. Chem. Soc. 2007, 129, 6684–6685. [Google Scholar] [CrossRef] [PubMed]
- Toyama, H.; Anthony, C.; Lidstrom, M.E. Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation. FEMS Microbiol. Lett. 1998, 166, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Gonzales, M.F.; Brooks, T.; Pukatzki, S.U.; Provenzano, D. Rapid protocol for preparation of electrocompetent Escherichia coli and Vibrio cholerae. J. Vis. Exp. 2013, 2013, 50684. [Google Scholar]
- Miller, G.P.; Bhat, W.W.; Lanier, E.R.; Johnson, S.R.; Mathieu, D.T.; Hamberger, B. The biosynthesis of the anti-microbial diterpenoid leubethanol in Leucophyllum frutescens proceeds via an all-cis prenyl intermediate. Plant J. 2020, 104, 693–705. [Google Scholar] [CrossRef]
- Martinez-Gomez, N.C.; Good, N.M.; Lidstrom, M.E. Methenyl-Dephosphotetrahydromethanopterin Is a Regulatory Signal for Acclimation to Changes in Substrate Availability in Methylobacterium extorquens AM1. J. Bacteriol. 2015, 197, 2020–2026. [Google Scholar] [CrossRef]
- Klaus, O.; Hilgers, F.; Nakielski, A.; Hasenklever, D.; Jaeger, K.E.; Axmann, I.M.; Axmann, I.M.; Drepper, T. Engineering phototrophic bacteria for the production of terpenoids. Curr. Opin. Biotechnol. 2022, 77, 102764. [Google Scholar] [CrossRef]
Primer | Description | Target Gene |
---|---|---|
1-pAP5.for | CGTTCCTGACAACGAGCCTCCTT | pAP5 linearization |
2-pAP5.rev | GCAGGCATGCAAGCTTGGCGTAA | pAP5 linearization |
3-mtac.pats.lin.rev | GAAGATCTGAATTCGAGATGGAGTTGTATGCCCAAAG | Patchoulol synthase |
4-Pats.pAP5.rev | GCCAAGCTTGCATGCCTGCTTAATATGGAACAGGGTGAAGGTACAACTGC | Patchoulol synthase |
5-mTac.pAP5.for | GAGGCTCGTTGTCAGGAACGAAGAAATCTGAAATGAGCTGTTGACAATTA | mTac promoter |
6-mTac.pAP5.rev | CTCGAATTCAGATCTTCGGG | mTac promoter |
7-XoxF.pAP5.for | CGAATTCACTGGCCGTCGTTTTACA | pES503 linearization |
8-Pats.xoxf.for | AACGACGGCCAGTGAATTCGATGGAGTTGTATGCCCAAAGT | Patchoulol synthase |
9-DgTPS1.pAP5.for | CCCGAAGATCTGAATTCGAGATGGCTGCTGCTGTGTCCGAGTT | Casbene synthase |
10-DgTPS1.pAP5.rev | CGCCAAGCTTGCATGCCTGCTCATCGGTTATAAGGAATTGGGTGGACGAA | Casbene synthase |
11-DgTPS1.xoxf.for | AACGACGGCCAGTGAATTCGATGGCTGCTGCTGTGTCCGAGTT | Casbene synthase |
12-venus.check.for | CGAGTCAGTGAGCGAGGAA | Sequencing check |
13-venus.check.rev | CTACTTCACTGTTGGGGCCG | Sequencing check |
Strain or Plasmid | Relevant Trait(s) | Source |
---|---|---|
pAP5 | pCM62 promoterless venus | Skovran et al. [26] |
pES503 | pAP5 with pxox1 | Sonntag et al. [16] |
pAH1 | pAP5 ∆venus_pmTac_PcPatS | This study, derived from pAP5, Skovran et al. [26] |
pAH2 | pES503 ∆venus_pxox1_PcPatS | This study, derived from Sonntag et al. [16] |
pAH3 | pES503 ∆venus_pxox1_DgTPS1 | This study, derived from Sonntag et al. [16] |
pAH4 | pAP5 ∆venus_pmTac_DgTPS1 | This study, derived from Sonntag et al. [16] |
pIRS | DXS, DXR, IDI | Morrone et al. [12] |
pGG | pACYCDUet with rAgGGPS | Cyr et al. [28] |
E. coli_pIRS_pGG_pAH1 (strain) | E. coli with pmTac_PcPatS | This study, derived from Morrone et al. and Cyr et al. [12,28] |
E. coli_pIRS_pGG_pAH4 (strain) | E. coli with pmTac_DgTPS1 | This study |
AM1_pES503 (strain) | M. extorquens AM1 with pxox1_venus | This study |
AM1_pAH1 (strain) | M. extorquens AM1 with pmTac_PcPatS | This study |
CM502_pAH1 (strain) | M. extorquens CM502 with pmTac_PcPatS | This study |
AM1_pAH2 (strain) | M. extorquens AM1 with pxox1_PcPatS | This study |
CM502_pAH2 (strain) | M. extorquens CM502 with pxox1_PcPatS | This study |
AM1_pAH3 (strain) | M. extorquens AM1 with pxox1_DgTPS1 | This study |
CM502_pAH3 (strain) | M. extorquens CM502 with pxox1_DgTPS1 | This study |
AM1_pAH4 (strain) | M. extorquens AM1 with pmTac_DgTPS1 | This study |
CM502_pAH4 (strain) | M. extorquens CM502 with pmTac_DgTPS1 | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hurt, A.; Bibik, J.D.; Martinez-Gomez, N.C.; Hamberger, B. Engineering Terpene Production Pathways in Methylobacterium extorquens AM1. Microorganisms 2024, 12, 500. https://doi.org/10.3390/microorganisms12030500
Hurt A, Bibik JD, Martinez-Gomez NC, Hamberger B. Engineering Terpene Production Pathways in Methylobacterium extorquens AM1. Microorganisms. 2024; 12(3):500. https://doi.org/10.3390/microorganisms12030500
Chicago/Turabian StyleHurt, Allison, Jacob D. Bibik, Norma Cecilia Martinez-Gomez, and Björn Hamberger. 2024. "Engineering Terpene Production Pathways in Methylobacterium extorquens AM1" Microorganisms 12, no. 3: 500. https://doi.org/10.3390/microorganisms12030500
APA StyleHurt, A., Bibik, J. D., Martinez-Gomez, N. C., & Hamberger, B. (2024). Engineering Terpene Production Pathways in Methylobacterium extorquens AM1. Microorganisms, 12(3), 500. https://doi.org/10.3390/microorganisms12030500