Effects of Salmonella Typhimurium Infection on the Gut Microbiota of Cherry Valley Meat Ducks
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design of the Duck Model
2.2. Bacterial Strains and Growth Conditions
2.3. Sample Collection and Processing
2.4. Bacterial Burden
2.5. Real-Time PCR
2.6. Bioinformatic Processing and Analysis of the Sequencing Data
2.7. Metabolic Pathways Prediction
2.8. Statistical Analysis
3. Results
3.1. Growth Performance after Infection
3.2. Salmonella Typhimurium Translocation
3.3. Inflammatory Cytokine Expression
3.4. Diversity Analysis of Gut Microbiota after Salmonella Infection
3.5. Compositional Change in Gut Microbiota Induced by Salmonella
3.6. Metabolic Pathway Analysis of Potential Metabolite
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Grigar, M.K.; Cummings, K.J.; Rankin, S.C. Prevalence of Salmonella among waterfowl along the Texas Gulf coast. Zoonoses Public Health 2017, 64, 689–692. [Google Scholar] [CrossRef]
- Wang, J.; Li, J.; Liu, F.; Cheng, Y.; Su, J. Characterization of Salmonella enterica Isolates from Diseased Poultry in Northern China between 2014 and 2018. Pathogens 2020, 9, 95. [Google Scholar] [CrossRef]
- Ruby, T.; McLaughlin, L.; Gopinath, S.; Monack, D. Salmonella’s long-term relationship with its host. FEMS Microbiol. Rev. 2012, 36, 600–615. [Google Scholar] [CrossRef]
- van Asten, A.J.; van Dijk, J.E. Distribution of “classic” virulence factors among Salmonella spp. FEMS Immunol. Med. Microbiol. 2005, 44, 251–259. [Google Scholar] [CrossRef]
- Stevens, M.P.; Humphrey, T.J.; Maskell, D.J. Molecular insights into farm animal and zoonotic Salmonella infections. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2009, 364, 2709–2723. [Google Scholar] [CrossRef] [PubMed]
- Lostroh, C.P.; Lee, C.A. The Salmonella pathogenicity island-1 type III secretion system. Microbes Infect. 2001, 3, 1281–1291. [Google Scholar] [CrossRef] [PubMed]
- Martin, R.; Miquel, S.; Ulmer, J.; Langella, P.; Bermudez-Humaran, L.G. Gut ecosystem: How microbes help us. Benef. Microbes 2014, 5, 219–233. [Google Scholar] [CrossRef] [PubMed]
- Ducarmon, Q.R.; Zwittink, R.D.; Hornung, B.V.H.; van Schaik, W.; Young, V.B.; Kuijper, E.J. Gut Microbiota and Colonization Resistance against Bacterial Enteric Infection. Microbiol. Mol. Biol. Rev. 2019, 83, e00007-19. [Google Scholar] [CrossRef]
- Santos, R.L.; Raffatellu, M.; Bevins, C.L.; Adams, L.G.; Tukel, C.; Tsolis, R.M.; Baumler, A.J. Life in the inflamed intestine, Salmonella style. Trends Microbiol. 2009, 17, 498–506. [Google Scholar] [CrossRef]
- Thiennimitr, P.; Winter, S.E.; Baumler, A.J. Salmonella, the host and its microbiota. Curr. Opin. Microbiol. 2012, 15, 108–114. [Google Scholar] [CrossRef]
- Winter, S.E.; Thiennimitr, P.; Winter, M.G.; Butler, B.P.; Huseby, D.L.; Crawford, R.W.; Russell, J.M.; Bevins, C.L.; Adams, L.G.; Tsolis, R.M.; et al. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 2010, 467, 426–429. [Google Scholar] [CrossRef] [PubMed]
- Langille, M.G.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Vega Thurber, R.L.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef]
- Besser, J.M. Salmonella epidemiology: A whirlwind of change. Food Microbiol. 2018, 71, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Liu, B.; Li, F.; He, Y.; Wang, L.; Fakhar, E.A.K.M.; Li, H.; Fu, Y.; Zhu, H.; Wang, Y.; et al. Integrated Bacterial and Fungal Diversity Analysis Reveals the Gut Microbial Alterations in Diarrheic Giraffes. Front. Microbiol. 2021, 12, 712092. [Google Scholar] [CrossRef] [PubMed]
- Kang, X.; Wang, M.; Meng, C.; Li, A.; Jiao, X.; Pan, Z. Prevalence and whole-genome sequencing analysis of Salmonella reveal its spread along the duck production chain. Poult. Sci. 2022, 101, 101993. [Google Scholar] [CrossRef]
- Ohl, M.E.; Miller, S.I. Salmonella: A model for bacterial pathogenesis. Annu. Rev. Med. 2001, 52, 259–274. [Google Scholar] [CrossRef]
- Miller, C.P.; Bohnhoff, M. Changes in the Mouse’s Enteric Microflora Associated with Enhanced Susceptibility to Salmonella Infection Following Streptomycin Treatment. J. Infect. Dis. 1963, 113, 59–66. [Google Scholar] [CrossRef]
- Baumler, A.J.; Sperandio, V. Interactions between the microbiota and pathogenic bacteria in the gut. Nature 2016, 535, 85–93. [Google Scholar] [CrossRef]
- Litvak, Y.; Byndloss, M.X.; Baumler, A.J. Colonocyte metabolism shapes the gut microbiota. Science 2018, 362, eaat9076. [Google Scholar] [CrossRef]
- Rogers, A.W.L.; Tsolis, R.M.; Baumler, A.J. Salmonella versus the Microbiome. Microbiol. Mol. Biol. Rev. 2021, 85, e00027-19. [Google Scholar] [CrossRef]
- Mon, K.K.; Saelao, P.; Halstead, M.M.; Chanthavixay, G.; Chang, H.C.; Garas, L.; Maga, E.A.; Zhou, H. Salmonella enterica Serovars Enteritidis Infection Alters the Indigenous Microbiota Diversity in Young Layer Chicks. Front. Vet. Sci. 2015, 2, 61. [Google Scholar] [CrossRef]
- Yuan, X.; Xue, H.; Xu, X.; Jiao, X.; Pan, Z.; Zhang, Y. Closely related Salmonella Derby strains triggered distinct gut microbiota alteration. Gut Pathog. 2022, 14, 6. [Google Scholar] [CrossRef] [PubMed]
- Tap, J.; Mondot, S.; Levenez, F.; Pelletier, E.; Caron, C.; Furet, J.P.; Ugarte, E.; Munoz-Tamayo, R.; Paslier, D.L.; Nalin, R.; et al. Towards the human intestinal microbiota phylogenetic core. Environ. Microbiol. 2009, 11, 2574–2584. [Google Scholar] [CrossRef] [PubMed]
- Biddle, A.; Stewart, L.; Blanchard, J.; Leschine, S. Untangling the genetic basis of fibrolytic specialization by Lachnospiraceae and Ruminococcaceae in diverse gut communities. Diversity 2013, 5, 627–640. [Google Scholar] [CrossRef]
- Gupta, A.; Bansal, M.; Liyanage, R.; Upadhyay, A.; Rath, N.; Donoghue, A.; Sun, X. Sodium butyrate modulates chicken macrophage proteins essential for Salmonella Enteritidis invasion. PLoS ONE 2021, 16, e0250296. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhu, W.; Qin, N.; Ren, X.; Xia, X. Propionate and Butyrate Inhibit Biofilm Formation of Salmonella Typhimurium Grown in Laboratory Media and Food Models. Foods 2022, 11, 3493. [Google Scholar] [CrossRef] [PubMed]
- Onrust, L.; Baeyen, S.; Haesebrouck, F.; Ducatelle, R.; Van Immerseel, F. Effect of in feed administration of different butyrate formulations on Salmonella Enteritidis colonization and cecal microbiota in broilers. Vet. Res. 2020, 51, 56. [Google Scholar] [CrossRef]
- Litwinowicz, K.; Gamian, A. Microbiome Alterations in Alcohol Use Disorder and Alcoholic Liver Disease. Int. J. Mol. Sci. 2023, 24, 2461. [Google Scholar] [CrossRef]
- Van den Abbeele, P.; Ghyselinck, J.; Marzorati, M.; Koch, A.M.; Lambert, W.; Michiels, J.; Chalvon-Demersay, T. The Effect of Amino Acids on Production of SCFA and bCFA by Members of the Porcine Colonic Microbiota. Microorganisms 2022, 10, 762. [Google Scholar] [CrossRef]
- Sorbara, M.T.; Littmann, E.R.; Fontana, E.; Moody, T.U.; Kohout, C.E.; Gjonbalaj, M.; Eaton, V.; Seok, R.; Leiner, I.M.; Pamer, E.G. Functional and Genomic Variation between Human-Derived Isolates of Lachnospiraceae Reveals Inter- and Intra-Species Diversity. Cell Host Microbe 2020, 28, 134–146.e134. [Google Scholar] [CrossRef]
- Juge, N. Microbe Profile: Ruminococcus gnavus: The yin and yang of human gut symbionts. Microbiology 2023, 169, 001383. [Google Scholar] [CrossRef] [PubMed]
- Rainey, F.A.; Janssen, P.H. Phylogenetic analysis by 16S ribosomal DNA sequence comparison reveals two unrelated groups of species within the genus Ruminococcus. FEMS Microbiol. Lett. 1995, 129, 69–73. [Google Scholar] [CrossRef] [PubMed]
Gene | Genbank | Primer Position | Primer Sequences (5′→3′) |
---|---|---|---|
TNF-α | XM_046927265 | Forward | CAGGACAGCCTATGCCAACA |
Reverse | ACAACCAGCTATGCACCCCA | ||
NF-κB | XM_046915553 | Forward | CAACGCAGGACCTAAAGACAT |
Reverse | CAGTAAACATAAGACGCACCACA | ||
β-actin | L08165 | Forward | GCTGTCCCTGTATGCCTCTG |
Reverse | TCTCGGCTGTGGTGGTGAAG |
Phylum | Class | Order | Family | Genus | |
---|---|---|---|---|---|
ASV_9097 | Firmicutes | Clostridia | Clostridiales | Ruminococcaceae | Ruminococcus |
ASV_10517 | Firmicutes | Clostridia | Clostridiales | Ruminococcaceae | Ruminococcus |
ASV_6282 | Firmicutes | Clostridia | Clostridiales | Ruminococcaceae | unclassified_Ruminococcaceae |
ASV_3796 | Firmicutes | Clostridia | Clostridiales | Ruminococcaceae | unclassified_Ruminococcaceae |
ASV_464 | Firmicutes | Clostridia | Clostridiales | Ruminococcaceae | Oscillospira |
ASV_3867 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | Blautia |
ASV_3653 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | [Ruminococcus] |
ASV_7943 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | unclassified_Lachnospiraceae |
ASV_5638 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | unclassified_Lachnospiraceae |
ASV_6430 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | unclassified_Lachnospiraceae |
ASV_10443 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | [Ruminococcus] |
ASV_4472 | Firmicutes | Clostridia | Clostridiales | Lachnospiraceae | [Ruminococcus] |
ASV_6554 | Firmicutes | Bacilli | Lactobacillales | Leuconostocaceae | Weissella |
ASV_2867 | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus |
ASV_8936 | Firmicutes | Bacilli | Lactobacillales | Enterococcaceae | Enterococcus |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Y.; Pan, X.; Hou, J.; Shi, W.; Sun, S.; Song, M.; Gao, Z. Effects of Salmonella Typhimurium Infection on the Gut Microbiota of Cherry Valley Meat Ducks. Microorganisms 2024, 12, 602. https://doi.org/10.3390/microorganisms12030602
Zheng Y, Pan X, Hou J, Shi W, Sun S, Song M, Gao Z. Effects of Salmonella Typhimurium Infection on the Gut Microbiota of Cherry Valley Meat Ducks. Microorganisms. 2024; 12(3):602. https://doi.org/10.3390/microorganisms12030602
Chicago/Turabian StyleZheng, Yue, Xue Pan, Jialei Hou, Wenchong Shi, Shuhong Sun, Mengze Song, and Zheng Gao. 2024. "Effects of Salmonella Typhimurium Infection on the Gut Microbiota of Cherry Valley Meat Ducks" Microorganisms 12, no. 3: 602. https://doi.org/10.3390/microorganisms12030602
APA StyleZheng, Y., Pan, X., Hou, J., Shi, W., Sun, S., Song, M., & Gao, Z. (2024). Effects of Salmonella Typhimurium Infection on the Gut Microbiota of Cherry Valley Meat Ducks. Microorganisms, 12(3), 602. https://doi.org/10.3390/microorganisms12030602