Analysis of the Mycotoxin Levels and Expression Pattern of SWN Genes at Different Time Points in the Fungus Slafractonia leguminicola
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Culture Conditions
2.2. Plant Materials
2.3. Pathogen Inoculations
2.4. Total RNA Isolation from the Cultures and the Leaves
2.5. Quantitative Real-Time PCR (RT-qPCR)
2.6. Determination of Swainsonine and Slaframine Concentrations
2.6.1. Sample Preparation
2.6.2. Preparation of Standards
2.6.3. HPLC-HRMS Analysis
3. Results
3.1. Determination of Swainsonine and Slaframine in the Culture and in the Leaves of S. leguminicola in Different Periods
3.2. RT-qPCR Analysis of Key Catalytic Enzyme Genes in the SW Biosynthesis Pathway of S. leguminicola Both In Vitro and In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gough, F.J.; Elliott, E.S. Blackpatch of red clover and other legumes caused by Rhizoctonia leguminicola sp. nov. Bull. West Va. Univ. Agric. Exp. Stn. 1956, 387, 23. [Google Scholar]
- Alhawatema, M.S.; Sanogo, S.; Baucom, D.L.; Creamer, R. A search for the phylogenetic relationship of the ascomycete Rhizoctonia leguminicola using genetic analysis. Mycopathologia 2015, 179, 381–389. [Google Scholar] [CrossRef] [PubMed]
- Cook, D.; Gardner, D.R.; Pfister, J.A. Swainsonine-containing plants and their relationship to endophytic fungi. J. Agric. Food Chem. 2014, 62, 7326–7334. [Google Scholar] [CrossRef]
- Croom, W.J., Jr.; Hagler, W.M., Jr.; Froetschel, M.A.; Johnson, A.D. The involvement of slaframine and swainsonine in slobbers syndrome: A review. J. Anim. Sci. 1995, 73, 1499–1508. [Google Scholar] [CrossRef]
- Kagan, I.A. Blackpatch of clover, cause of slobbers syndrome: A review of the disease and the pathogen, Rhizoctonia leguminicola. Front. Vet. Sci. 2016, 3, 3. [Google Scholar] [CrossRef] [PubMed]
- Grum, D.S.; Cook, D.; Baucom, D.; Mott, I.W.; Gardner, D.R.; Creamer, R.; Allen, J.G. Production of the alkaloid swainsonine by a fungal endophyte in the host Swainsona canescens. J. Nat. Prod. 2013, 76, 1984–1988. [Google Scholar] [CrossRef]
- Cook, D.; Donzelli, B.; Creamer, R.; Baucom, D.L.; Gardner, D.R.; Pan, J.; Moore, N.; Krasnoff, S.B.; Jaromczyk, J.W.; Schardl, C.L. Swainsonine biosynthesis genes in diverse symbiotic and pathogenic fungi. G3 Genes Genomes Genet. 2017, 7, 1791–1797. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Zhao, Q.; Wang, J.; Wang, J.; Wang, Y.; Song, Y.; Geng, G.; Li, Q. Swainsonine-producing fungal endophytes from major locoweed species in China. Toxicon 2010, 56, 330–338. [Google Scholar] [CrossRef] [PubMed]
- Pryor, B.M.; Creamer, R.; Shoemaker, R.A.; McLain-Romero, J.; Hambleton, S. Undifilum, a new genus for enophytic Embellisia oxytropis and parasitic Helminthosporium bornmuelleri on legumes. Botany 2009, 87, 178–194. [Google Scholar] [CrossRef]
- Li, Y.Z.; Nan, Z.B. Symptomology and etiology of a new disease, yellow stunt and root rot of standing milk vetch caused by Embellisia sp. in Northern China. Mycopathologia 2007, 163, 327–334. [Google Scholar] [CrossRef]
- Shi, M.; Li, Y.-Z. Alternaria gansuense, a plant systematic fungal pathogen producing swainsonine in vivo and in vitro. Curr. Microbiol. 2023, 80, 232. [Google Scholar] [CrossRef] [PubMed]
- Colegate, S.M.; Dorling, P.R.; Huxtable, C.R. A spectroscopic investigation of swainsonine: An α-mannosidase inhibitor isolated from Swainsona canescens. Aust. J. Chem. 1979, 32, 2257–2264. [Google Scholar] [CrossRef]
- Zhao, B.Y.; Liu, Z.Y.; Wang, J.J.; Sun, L.S.; Wang, Z.X.; Wang, Y.C. Isolation and NMR study on swainsonine from locoweed, Astragalus strictus. Agric. Sci. China 2009, 8, 115–120. [Google Scholar] [CrossRef]
- Barbosa, R.C.; Riet-Correa, F.; Lima, E.F.; Medeiros, R.M.T.; Guedes, K.M.R.; Gardner, D.R.; Molyneux, R.J.; de Melo, L.E.H. Experimental swainsonine poisoning in goats ingesting Ipomoea sericophylla and Ipomoea riedelii (Convolvulaceae). Pesqui. Vet. Bras. 2007, 27, 409–414. [Google Scholar] [CrossRef]
- Haraguchi, M.; Gorniak, S.L.; Ikeda, K.; Minami, Y.; Kato, A.; Watson, A.A.; Nash, R.J.; Molyneux, R.J.; Asano, N. Alkaloidal components in the poisonous plant, Ipomoea carnea (Convolvulaceae). J. Agric. Food Chem. 2003, 51, 4995–5000. [Google Scholar] [CrossRef] [PubMed]
- Molyneux, R.J.; McKenzie, R.A.; O’Sullivan, B.M.; Elbein, A.D. Identification of the glycosidase inhibitors swainsonine and calystegine B2 in weir vine (Ipomoea sp. Q6 {aff. calobra}) and correlation with toxicity. J. Nat. Prod. 1995, 58, 878–886. [Google Scholar] [CrossRef] [PubMed]
- Colodel, E.M.; Gardner, D.R.; Zlotowski, P.; Driemeier, D. Identification of swainsonine as a glycoside inhibitor responsible for Sida carpinifolia poisoning. Vet. Hum. Toxicol. 2002, 44, 177–178. [Google Scholar] [PubMed]
- Micheloud, J.F.; Marin, R.; Colque-Caro, L.A.; Martínez, O.G.; Gardner, D.; Gimeno, E.J. Swainsonine-induced lysosomal storage disease in goats caused by the ingestion of Sida rodrigoi Monteiro in North-western Argentina. Toxicon 2017, 128, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Baucom, D.L.; Romero, M.; Belfon, R.; Creamer, R. Two new species of Undifilum, fungal endophytes of Astragalus (locoweeds) in the United States. Botany 2012, 90, 866–875. [Google Scholar] [CrossRef]
- Cook, D.; Beaulieu, W.T.; Mott, I.W.; Riet-Correa, F.; Gardner, D.R.; Grum, D.; Pfister, J.A.; Clay, K.; Marcolongo-Pereira, C. Production of the alkaloid swainsonine by a fungal endosymbiont of the Ascomycete order Chaetothyriales in the host Ipomoea carnea. J. Agric. Food Chem. 2013, 61, 3797–3803. [Google Scholar] [CrossRef]
- Ralphs, M.H.; James, L.F.; Nielsen, D.B.; Panter, K.E. Management practices reduce cattle loss to locoweed on high mountain range. Rangel. Arch. 1984, 6, 175–177. [Google Scholar]
- Panter, K.E.; James, L.F.; Stegelmeier, B.L.; Ralphs, M.H.; Pfister, J.A. Locoweeds: Effects on reproduction in livestock. J. Nat. Toxins 1999, 8, 53–62. [Google Scholar] [PubMed]
- Stegelmeier, B.L.; James, L.F.; Panter, K.E.; Ralphs, M.H.; Gardner, D.R.; Molyneux, R.J.; Pfister, J.A. The pathogenesis and toxicokinetics of locoweed (Astragalus and Oxytropis spp.) poisoning in livestock. J. Nat. Toxins 1999, 8, 35–45. [Google Scholar] [PubMed]
- Panter, K.E.; James, L.F.; Gardner, D.R.; Ralphs, M.H.; Pfister, J.A.; Stegelmeier, B.L.; Lee, S.T. Reproductive losses to poisonous plants: Influence of management strategies. Rangel. Ecol. Manag. J. Range Manag. Arch. 2002, 55, 301–308. [Google Scholar]
- Ralphs, M.H.; Mickelsen, L.V.; Turner, D.L. Cattle grazing white locoweed: Diet selection patterns of native and introduced cattle. J. Range Manag. 1987, 40, 33–335. [Google Scholar] [CrossRef]
- Turner, J.L.; Allison, C. Locoweed Poisoning of Horses; Guide B-713; New Mexico State University Cooperative Extension: Las Cruces, NM, USA, 2023; Available online: https://pubs.nmsu.edu/_b/B713/ (accessed on 12 February 2021).
- Schneider, M.J.; Ungemach, F.S.; Broquist, H.P.; Harris, T.M. (1S, 2R, 8R, 8aR)-1, 2, 8-trihydroxyoctahydroindolizine (swainsonine), an α-mannosidase inhibitor from Rhizoctonia leguminicola. Tetrahedron 1983, 39, 29–32. [Google Scholar] [CrossRef]
- Dorling, P.R.; Huxtable, C.R.; Colegate, S.M. Inhibition of lysosomal α-mannosidase by swainsonine, an indolizidine alkaloid isolated from Swainsona canescens. Biochem. J. 1980, 191, 649–651. [Google Scholar] [CrossRef] [PubMed]
- Broquist, H.P. The indolizidine alkaloids, slaframine and swainsonine: Contaminants in animal forages. Annu. Rev. Nutr. 1985, 5, 391–409. [Google Scholar] [CrossRef] [PubMed]
- Crump, M.H. Slaframine (slobber factor) toxicosis. J. Am. Vet. Med. Assoc. 1973, 163, 1300–1302. [Google Scholar]
- Smalley, E.B.; Nichols, R.E.; Crump, M.H.; Henning, J.N. A physiological disturbance in animals resulting from ingestion of Rhizoctonia leguminicola-infested red clover forage. Phytopathology 1962, 52, 753. [Google Scholar]
- Osweiler, G.D. Toxicology; Williams & Wilkins: Philadelphia, PA, USA, 1996; pp. 428–429. [Google Scholar]
- Borges, A.S.; Oliveira-Filho, J.P.; Simon, J.J.; Palumbo, M.I.P.; Imerman, P.M. Slaframine toxicosis in Brazilian horses causing excessive salivation. Equine Vet. Educ. 2012, 24, 279–283. [Google Scholar] [CrossRef]
- Broquist, H.P.; Mason, P.S.; Hagler, W.M.; Harris, T.M. Identification of swainsonine as a probable contributory mycotoxin in moldy forage mycotoxicosis. Appl. Environ. Microbiol. 1984, 48, 386–388. [Google Scholar] [CrossRef] [PubMed]
- Hagler, W.; Behlow, R.F. Salivary syndrome in horses: Identification of slaframine in red clover hay. Appl. Environ. Microbiol. 1981, 42, 1067–1073. [Google Scholar] [CrossRef] [PubMed]
- Daniel, L.R.; Hagler, W.M.; Croom, W.J. Slaframine and swainsonine production by Rhizoctonia leguminicola isolated from six outbreaks of slobbers in cattle and horses. In Mycotoxins, Wood Decay, Plant Stress, Biocorrosion, and General Biodeterioration; Biodeterioration Research; Llewellyn, G.C., Dashek, W.V., O’Rear, C.E., Eds.; Springer: Boston, MA, USA, 1994; Volume 4. [Google Scholar] [CrossRef]
- Aust, S.D.; Broquist, H.P.; Rinehart, K.L., Jr. Slaframine: A parasympathomimetric from Rhizoctonia leguminicola. Biotechnol. Bioeng. 1968, 10, 403–412. [Google Scholar] [CrossRef]
- Das, S.; Gardner, D.R.; Neyaz, M.; Charleston, A.B., III; Cook, D.; Creamer, R. Silencing of the transmembrane transporter (swnT) gene of the fungus Slafractonia leguminicola results in a reduction of mycotoxin transport. J. Fungi 2023, 9, 370. [Google Scholar] [CrossRef] [PubMed]
- Noor, A.I.; Nava, A.; Cooke, P.; Cook, D.; Creamer, R. Evidence of non-pathogenic relationship of Alternaria section Undifilum endophytes within three host locoweed plant species. Botany 2018, 96, 187–200. [Google Scholar] [CrossRef]
- Cook, D.; Gardner, D.R.; Ralphs, M.H.; Pfister, J.A.; Welch, K.D.; Green, B.T. Swainsoninine concentrations and endophyte amounts of Undifilum oxytropis in different plant parts of Oxytropis sericea. J. Chem. Ecol. 2009, 35, 1272–1278. [Google Scholar] [CrossRef] [PubMed]
- Neyaz, M.; Gardner, D.R.; Creamer, R.; Cook, D. Localization of the swainsonine-producing Chaetothyriales symbiont in the seed and shoot apical meristem in its host Ipomoea carnea. Microorganisms 2022, 10, 545. [Google Scholar] [CrossRef]
- Bartlett, H.S.; Wilson, M.E.; Croom, J.; Broquist, H.P.; Hagler, W.M. Slaframine and swainsonine production by Rhizoctonia leguminicola: Strain comparsion. In Biodeterioration Research; Llewellyn, G.C., O’Rear, C.E., Eds.; Springer: Boston, MA, USA, 1987; Volume 1. [Google Scholar] [CrossRef]
- Wickwire, B.M.; Harris, C.M.; Harris, T.M.; Broquist, H.P. Pipecolic acid biosynthesis in Rhizoctonia leguminicola. I. The lysine saccharopine, delta 1-piperideine-6-carboxylic acid pathway. J. Biol. Chem. 1990, 265, 14742–14747. [Google Scholar] [CrossRef]
- Wickwire, B.M.; Wagner, C.; Broquist, H.P. Pipecolic acid biosynthesis in Rhizoctonia leguminicola. II. Saccharopine oxidase: A unique flavin enzyme involved in pipecolic acid biosynthesis. J. Biol. Chem. 1990, 265, 14748–14753. [Google Scholar] [CrossRef]
- Harris, C.M.; Schneider, M.J.; Ungemach, F.S.; Hill, J.E.; Harris, T.M. Biosynthesis of the toxic indolizidine alkaloids slaframine and swainsonine in Rhizoctonia leguminicola: Metabolism of 1-hydroxyindolizidines. J. Am. Chem. Soc. 1988, 110, 940–949. [Google Scholar] [CrossRef]
- Schneider, M.J.; Ungemach, F.S.; Broquist, H.P.; Harris, T.M. Biosynthesis of swainsonine in Rhizoctonia leguminicola. Epimerization at the ring fusion. J. Am. Chem. Soc. 1982, 104, 6863–6864. [Google Scholar] [CrossRef]
- Li, H.; Gao, R.; Liu, Y.; Wang, J.; Hu, Y.; Yang, Z.; Yang, G.; Creamer, R. Proteomics analysis of Rhizoctonia leguminicola, the phytopathogenic fungus that produces slaframine and swainsonine. J. Food Agric. Environ. 2012, 10, 956–961. [Google Scholar]
- Ren, Z.; Song, R.; Wang, S.; Quan, H.; Yang, L.; Sun, L.; Zhao, B.; Lu, H. The biosynthesis pathway of swainsonine, a new anticancer drug from three endophytic fungi. J. Microbiol. Biotechnol. 2017, 27, 1897–1906. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Lu, P. Transcriptome profiles of Alternaria oxytropis provides insights into swainsonine biosynthesis. Sci. Rep. 2019, 9, 6021. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Zhao, Q.; Yu, K.; Gao, Y.; Ma, Z.; Li, H.; Yu, Y. Transcriptomic screening of Alternaria oxytropis isolated from locoweed plants for genes involved in mycotoxin swaisonine production. J. Fungi 2024, 10, 88. [Google Scholar] [CrossRef] [PubMed]
- Neyaz, M.; Das, S.; Cook, D.; Creamer, R. Phylogenetic comparison of swainsonine biosynthetic gene clusters among fungi. J. Fungi 2022, 8, 359. [Google Scholar] [CrossRef] [PubMed]
- Luo, F.; Hong, S.; Chen, B.; Yin, Y.; Tang, G.; Hu, F.; Zhang, H.; Wang, C. Unveiling of swainsonine biosynthesis via a multibranched pathway in fungi. ACS Chem. Biol. 2020, 15, 2476–2484. [Google Scholar] [CrossRef]
- Huang, E.; Zhang, Y.; Sun, L.; Zhu, Y.; Tang, S.; Mo, C.; Zhao, B.; Lu, H. swnK plays an important role in the biosynthesis of swainsonine in Metarhizium anisopliae. Biotechnol. Lett. 2023, 45, 509–519. [Google Scholar] [CrossRef]
- Sun, L.; Song, R.; Wang, J.; Liu, Y.; Zhang, Y.; Zhu, Y.; Guo, Q.; Mo, C.; Wang, B.; Zhao, B.; et al. The role of swnR gene on the biosynthesis pathway of swainsonine in Metarhizium anisopliae. Acta Vet. Zootech. Sin. 2022, 52, 1439–1446. [Google Scholar] [CrossRef]
- Alhawatema, M.S.; Gebril, S.; Cook, D.; Creamer, R. RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola. World J. Microbiol. Biotechnol. 2017, 33, 179. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.Q.; Skinner, J.; Bennett, J.E. Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment. BMC Mol. Biol. 2012, 13, 22. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Primers | Sequence 5′ → 3′ |
---|---|
swnK F | TCGCACAACAAACAGGACAC |
swnK R | GACCGCGGAGCTTGCTAAAC |
swnN F | AAGAACTCTTGCGCCACCCA |
swnN R | AGGCCAACTAAGCGCTCGAT |
swnH2 F | AACTTGGCTCACGGAGCTGG |
swnH2 R | ACTGCTGCCAAGTCTTTCGT |
swnH1 F | AGATTCTCTGCTGGGTCACCA |
swnH1 R | TCCCAGGCACATTACGTCCA |
swnR F | AGCAGGGTGTTGCCCAGATT |
swnR R | CATCTCACGGATGGGCTCGT |
swnT F | TCCGGATTGCTTGTCATCTT |
swnT R | GATTCACGGCTCAGTGTCCA |
RDN5.8 (F) | CTTGGTTCTCGCATCGATGA |
RDN5.8 (R) | GGCGCAATGTGCGTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Das, S.; Gardner, D.R.; Cook, D.; Creamer, R. Analysis of the Mycotoxin Levels and Expression Pattern of SWN Genes at Different Time Points in the Fungus Slafractonia leguminicola. Microorganisms 2024, 12, 670. https://doi.org/10.3390/microorganisms12040670
Das S, Gardner DR, Cook D, Creamer R. Analysis of the Mycotoxin Levels and Expression Pattern of SWN Genes at Different Time Points in the Fungus Slafractonia leguminicola. Microorganisms. 2024; 12(4):670. https://doi.org/10.3390/microorganisms12040670
Chicago/Turabian StyleDas, Sumanjari, Dale R. Gardner, Daniel Cook, and Rebecca Creamer. 2024. "Analysis of the Mycotoxin Levels and Expression Pattern of SWN Genes at Different Time Points in the Fungus Slafractonia leguminicola" Microorganisms 12, no. 4: 670. https://doi.org/10.3390/microorganisms12040670