Molecular Characterization of the Chicken Parvovirus Based on VP1 Gene Circulating in Brazilian Chicken Flocks
Abstract
:1. Introduction
2. Material and Methods
2.1. Samples
2.2. Nucleic Acid Extraction
2.3. PCR for VP1 Gene Amplification
2.4. Cloning and Sequencing of the Complete VP1 Gene
2.5. Recombination Analysis
2.6. GeneBank Accession Numbers
3. Results
3.1. PCR for VP1 Gene Amplification and Sequencing
3.2. Phylogenetic Analysis
3.3. Recombination Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Kapgate, S.S.; Kumanan, K.; Vijayarani, K.; Barbuddhe, S.B. Avian Parvovirus: Classification, Phylogeny, Pathogenesis and Diagnosis. Avian Pathol. 2018, 47, 536–545. [Google Scholar] [CrossRef] [PubMed]
- De la Torre, D.; Nuñez, L.; Astolfi-Ferreira, C.; Piantino Ferreira, A. Enteric Virus Diversity Examined by Molecular Methods in Brazilian Poultry Flocks. Vet. Sci. 2018, 5, 38. [Google Scholar] [CrossRef] [PubMed]
- Mettifogo, E.; Nuñez, L.F.N.; Chacón, J.L.; Santander Parra, S.H.; Astolfi-Ferreira, C.S.; Jerez, J.A.; Jones, R.C.; Piantino Ferreira, A.J. Emergence of Enteric Viruses in Production Chickens Is a Concern for Avian Health. Sci. World J. 2014, 2014, 1–8. [Google Scholar] [CrossRef]
- Pantin-Jackwood, M.J.; Spackman, E.; Woolcock, P.R. Molecular Characterization and Typing of Chicken and Turkey Astroviruses Circulating in the United States: Implications for Diagnostics. Avian Dis. 2006, 50, 397–404. [Google Scholar] [CrossRef] [PubMed]
- Pantin-Jackwood, M.J.; Spackman, E.; Day, J.M.; Rives, D. Periodic Monitoring of Commercial Turkeys for Enteric Viruses Indicates Continuous Presence of Astrovirus and Rotavirus on the Farms. Avian Dis. 2007, 51, 674–680. [Google Scholar] [CrossRef] [PubMed]
- Day, J.M.; Zsak, L. Determination and Analysis of the Full-Length Chicken Parvovirus Genome. Virology 2010, 399, 59–64. [Google Scholar] [CrossRef] [PubMed]
- Feng, B.; Xie, Z.; Deng, X.; Xie, L.; Xie, Z.; Huang, L.; Fan, Q.; Luo, S.; Huang, J.; Zhang, Y.; et al. Genetic and Phylogenetic Analysis of a Novel Parvovirus Isolated from Chickens in Guangxi, China. Arch. Virol. 2016, 161, 3285–3289. [Google Scholar] [CrossRef]
- Koo, B.-S.; Lee, H.-R.; Jeon, E.-O.; Han, M.-S.; Min, K.-C.; Lee, S.-B.; Bae, Y.-J.; Cho, S.-H.; Mo, J.-S.; Kwon, H.M.; et al. Genetic Characterization of Three Novel Chicken Parvovirus Strains Based on Analysis of Their Coding Sequences. Avian Pathol. 2015, 44, 28–34. [Google Scholar] [CrossRef] [PubMed]
- Kisary, J. Experimental Infection of Chicken Embryos and Day-old Chickens with Parvovirus of Chicken Origin. Avian Pathol. 1985, 14, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Kisary, J.; Nagy, B.; Bitay, Z. Presence of Parvoviruses in the Intestine of Chickens Showing Stunting Syndrome. Avian Pathol. 1984, 13, 339–343. [Google Scholar] [CrossRef] [PubMed]
- Kisary, J. Indirect Immunofluorescence as a Diagnostic Tool for Parvovirus Infection of Broiler Chickens. Avian Pathol. 1985, 14, 269–273. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.-I.; El-Gazzar, M.; Sellers, H.S.; Dorea, F.; Williams, S.M.; Kim, T.; Collett, S.; Mundt, E. Investigation into the Aetiology of Runting and Stunting Syndrome in Chickens. Avian Pathol. 2012, 41, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Zsak, L.; Cha, R.M.; Day, J.M. Chicken Parvovirus-Induced Runting-Stunting Syndrome in Young Broilers. Avian Dis. 2013, 57, 123–127. [Google Scholar] [CrossRef] [PubMed]
- Strother, K.O.; Zsak, L. Development of an Enzyme-Linked Immunosorbent Assay to Detect Chicken Parvovirus-Specific Antibodies. Avian Dis. 2009, 53, 585–591. [Google Scholar] [CrossRef] [PubMed]
- Carratalà, A.; Rusinol, M.; Hundesa, A.; Biarnes, M.; Rodriguez-Manzano, J.; Vantarakis, A.; Kern, A.; Suñen, E.; Girones, R.; Bofill-Mas, S. A Novel Tool for Specific Detection and Quantification of Chicken/Turkey Parvoviruses to Trace Poultry Fecal Contamination in the Environment. Appl. Environ. Microbiol. 2012, 78, 7496–7499. [Google Scholar] [CrossRef] [PubMed]
- Nuñez, L.; Santander-Parra, S.; Chaible, L.; De la Torre, D.; Buim, M.; Murakami, A.; Zaidan Dagli, M.; Astolfi-Ferreira, C.; Piantino Ferreira, A. Development of a Sensitive Real-Time Fast-QPCR Based on SYBR® Green for Detection and Quantification of Chicken Parvovirus (ChPV). Vet. Sci. 2018, 5, 69. [Google Scholar] [CrossRef] [PubMed]
- Tarasiuk, K. Occurrence of Chicken Parvovirus Infection in Poland. Open Virol. J. 2012, 6, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Zsak, L.; Strother, K.O.; Kisary, J. Partial genome sequence analysis of parvoviruses associated with enteric disease in poultry. Avian Pathol. 2008, 37, 435–441. [Google Scholar] [CrossRef] [PubMed]
- Zsak, L.; Strother, K.O.; Day, J.M. Development of a Polymerase Chain Reaction Procedure for Detection of Chicken and Turkey Parvoviruses. Avian Dis. 2009, 53, 83–88. [Google Scholar] [CrossRef] [PubMed]
- Finkler, F.; Lima, D.A.; Cerva, C.; Moraes, L.B.; Cibulski, S.P.; Teixeira, T.F.; Santos, H.F.; Almeida, L.L.; Roehe, P.M.; Franco, A.C. Chicken Parvovirus and Its Associations with Malabsorption Syndrome. Res. Vet. Sci. 2016, 107, 178–181. [Google Scholar] [CrossRef] [PubMed]
- Palade, E.A.; Kisary, J.; Benyeda, Z.; Mándoki, M.; Balka, G.; Jakab, C.; Végh, B.; Demeter, Z.; Rusvai, M. Naturally Occurring Parvoviral Infection in Hungarian Broiler Flocks. Avian Pathol. 2011, 40, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Koo, B.S.; Lee, H.R.; Jeon, E.O.; Han, M.S.; Min, K.C.; Lee, S.B.; Mo, I.P. Molecular Survey of Enteric Viruses in Commercial Chicken Farms in Korea with a History of Enteritis. Poult. Sci. 2013, 92, 2876–2885. [Google Scholar] [CrossRef]
- Biđin, M.; Lojkić, I.; Biđin, Z.; Tišljar, M.; Majnarić, D. Identification and Phylogenetic Diversity of Parvovirus Circulating in Commercial Chicken and Turkey Flocks in Croatia. Avian Dis. 2011, 55, 693–696. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Feng, B.; Xie, Z.; Deng, X.; Zhang, M.; Xie, Z.; Xie, L.; Fan, Q.; Luo, S.; Zeng, T.; et al. Epidemiological Surveillance of Parvoviruses in Commercial Chicken and Turkey Farms in Guangxi, Southern China, During 2014–2019. Front. Vet. Sci. 2020, 7, 561371. [Google Scholar] [CrossRef]
- Zsak, L.; Cha, R.M.; Li, F.; Day, J.M. Host Specificity and Phylogenetic Relationships of Chicken and Turkey Parvoviruses. Avian Dis. 2015, 59, 157–161. [Google Scholar] [CrossRef]
- Domanska-Blicharz, K.; Jacukowicz, A.; Lisowska, A.; Minta, Z. Genetic Characterization of Parvoviruses Circulating in Turkey and Chicken Flocks in Poland. Arch. Virol. 2012, 157, 2425–2430. [Google Scholar] [CrossRef]
- Nuñez, L.F.N.; Santander Parra, S.H.; Mettifogo, E.; Astolfi-Ferreira, C.S.; Piantino Ferreira, A.J. Isolation and Molecular Characterisation of Chicken Parvovirus from Brazilian Flocks with Enteric Disorders. Br. Poult. Sci. 2015, 56, 39–47. [Google Scholar] [CrossRef]
- Marusak, R.A.; Guy, J.S.; Abdul-Aziz, T.A.; West, M.A.; Fletcher, O.J.; Day, J.M.; Zsak, L.; Barnes, H.J. Parvovirus-Associated Cerebellar Hypoplasia and Hydrocephalus in Day Old Broiler Chickens. Avian Dis. 2010, 54, 156–160. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Day, J.M.; Zsak, L. Recent Progress in the Characterization of Avian Enteric Viruses. Avian Dis. 2013, 57, 573–580. [Google Scholar] [CrossRef]
- Pérez-Losada, M.; Arenas, M.; Galán, J.C.; Palero, F.; González-Candelas, F. Recombination in viruses: Mechanisms, methods of study, and evolutionary consequences. Infect. Genet. Evol. 2015, 30, 296–307. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Nuñez, L.F.; Santander-Parra, S.H.; De la Torre, D.I.; Sá, L.R.; Buim, M.R.; Astolfi-Ferreira, C.S.; Piantino Ferreira, A.J. Molecular Characterization and Pathogenicity of Chicken Parvovirus (ChPV) in Specific Pathogen-Free Chicks Infected Experimentally. Pathogens 2020, 9, 606. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ling, J.; Wang, Z.; Huang, Y.; Zhu, J.; Zhu, G. Molecular Characterization of a Novel Muscovy Duck Parvovirus Isolate: Evidence of Recombination between Classical MDPV and Goose Parvovirus Strains. BMC Vet. Res. 2017, 13, 327. [Google Scholar] [CrossRef] [PubMed]
Sample | Type of Bird | Age | Clinical Signs of Enteric Disease | Post Mortem Examination | Brazilian State | Molecular Diagnostic of ChPV | |
---|---|---|---|---|---|---|---|
Diarrhea | RSS | Jejunal Dilatation | |||||
USP 93 | Broiler | 36 D | Yes | No | No | SP | + |
USP 162 | Broiler | 40 D | Yes | Yes | No | SP | + |
USP 238-1 | Broiler | 33 D | Yes | Yes | No | SC | + |
USP 238-5 | Broiler | 18 D | Yes | Yes | No | SC | + |
USP 259-10 | Broiler | 15 D | No | No | No | PR | + |
USP 259-11 | Broiler | 15 D | No | No | No | PR | + |
USP 336-7 | Broiler | 8 D | Yes | Yes | No | SC | + |
USP 336-15 | Broiler | 8 D | Yes | Yes | No | SC | + |
USP 336-16 | Broiler | 8 D | Yes | Yes | No | SC | + |
USP 345-15 | Broiler | 17 D | Yes | Yes | No | SP | + |
USP 358-7 | Broiler | 5 D | No | No | No | SC | + |
USP 358-10 | Broiler | 8 D | Yes | Yes | No | SC | + |
USP 362-7 | Broiler | 14 D | Yes | Yes | No | RS | + |
USP 400-7 | Broiler | 14 D | Yes | Yes | No | SP | + |
USP 401-3A | Broiler | 14 D | Yes | Yes | No | SP | + |
USP 507-1 | Layer Hen | 50 W | Yes | No | Yes | SP | + |
USP 507-3 | Layer Hen | 50 W | Yes | Yes | Yes | SP | + |
USP 507-9D | Layer Hen | 50 W | Yes | Yes | Yes | SP | + |
USP 507-20 | Layer Hen | 50 W | Yes | Yes | Yes | SP | + |
USP 507-24 | Layer Hen | 50 W | No | No | Yes | SP | + |
USP 710-1 | Broiler | NI | Yes | Yes | No | SP | + |
USP 711-1 | Broiler | NI | Yes | Yes | No | SP | + |
Virus | Gene Target | Primer Name | Sequence 5′–3′ | Amplicon bp | Assay | Reference |
---|---|---|---|---|---|---|
ChPV | VP1 | VP2CD1-F | TGAAAATGAAAATCGAAGACAAAA | 2289 | PCR | This Study |
VP2CD1-R | GAGAAAGCAAGACTCTTTATTGAAA |
N. | Virus | Group | Sequences | % Amino Acid Similarity | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ChPV | TuPV | GPV | ||||||||||||||||||||||||||||||||||||||||||||||||
Group I | Group II | Group III | Group IV | |||||||||||||||||||||||||||||||||||||||||||||||
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | ||||
1 | ChPV | Group I | KJ486489.1 Korea | - | 100 | 100 | 100 | 98.2 | 98.5 | 98 | 96.5 | 96.5 | 96.5 | 96.7 | 96.8 | 96.5 | 93 | 92.8 | 92.8 | 91.1 | 93.3 | 93.1 | 93 | 93.6 | 93.4 | 93.4 | 92.8 | 93.3 | 93.4 | 93.1 | 92.7 | 92.4 | 95.5 | 92.8 | 92.1 | 93.6 | 94.3 | 92 | 92 | 92 | 92 | 91.8 | 92.5 | 91.8 | 91.7 | 79.7 | 79.7 | 77.9 | 79.7 | 28 |
2 | KJ486490.1 Korea | 99.6 | - | 100 | 100 | 98.2 | 98.5 | 98 | 96.5 | 96.5 | 96.5 | 96.7 | 96.8 | 96.5 | 93 | 92.8 | 92.8 | 91.1 | 93.3 | 93.1 | 93 | 93.6 | 93.4 | 93.4 | 92.8 | 93.3 | 93.4 | 93.1 | 92.7 | 92.4 | 95.5 | 92.8 | 92.1 | 93.6 | 94.3 | 92 | 92 | 92 | 92 | 91.8 | 92.5 | 91.8 | 91.7 | 79.7 | 79.7 | 77.9 | 79.7 | 28 | ||
3 | KJ486491.1 Korea | 99.8 | 99.8 | - | 100 | 98.2 | 98.5 | 98 | 96.5 | 96.5 | 96.5 | 96.7 | 96.8 | 96.5 | 93 | 92.8 | 92.8 | 91.1 | 93.3 | 93.1 | 93 | 93.6 | 93.4 | 93.4 | 92.8 | 93.3 | 93.4 | 93.1 | 92.7 | 92.4 | 95.5 | 92.8 | 92.1 | 93.6 | 94.3 | 92 | 92 | 92 | 92 | 91.8 | 92.5 | 91.8 | 91.7 | 79.7 | 79.7 | 77.9 | 79.7 | 28 | ||
4 | KM254172.1 Korea | 98.8 | 98.8 | 98.9 | - | 98.2 | 98.5 | 98 | 96.5 | 96.5 | 96.5 | 96.7 | 96.8 | 96.5 | 93 | 92.8 | 92.8 | 91.1 | 93.3 | 93.1 | 93 | 93.6 | 93.4 | 93.4 | 92.8 | 93.3 | 93.4 | 93.1 | 92.7 | 92.4 | 95.5 | 92.8 | 92.1 | 93.6 | 94.3 | 92 | 92 | 92 | 92 | 91.8 | 92.5 | 91.8 | 91.7 | 79.7 | 79.7 | 77.9 | 79.7 | 28 | ||
5 | Group II | USP 362-3 Brazil | 95 | 95 | 95.1 | 94.9 | - | 97.9 | 98.2 | 96.2 | 96.8 | 96.8 | 97 | 97.7 | 96.7 | 92.8 | 93 | 93 | 91.1 | 93.4 | 93.3 | 93.1 | 93.7 | 93.6 | 93.6 | 92.8 | 93.4 | 93.6 | 93.3 | 92.5 | 92.2 | 96 | 92.7 | 92.2 | 93.7 | 94.9 | 91.8 | 91.8 | 91.8 | 91.8 | 91.7 | 92.5 | 91.7 | 91.4 | 79.6 | 79.6 | 77.8 | 79.6 | 27,7 | |
6 | KM598414.1 USA | 95 | 94.9 | 95 | 94.7 | 94.8 | - | 97.6 | 95.8 | 96.5 | 96.7 | 96.7 | 97 | 96.7 | 93.3 | 92.8 | 93.1 | 91.2 | 93.6 | 93.4 | 93.3 | 94 | 93.7 | 93.7 | 93.1 | 93.6 | 93.6 | 93.4 | 93.3 | 92.7 | 95.4 | 93.1 | 92.4 | 93.9 | 94.9 | 92.1 | 92.1 | 92.1 | 92.1 | 92 | 93 | 92.2 | 92.4 | 79.3 | 79.3 | 77.5 | 79.3 | 28 | ||
7 | KU569162.1 Brazil | 94.5 | 94.3 | 94.5 | 94.9 | 94.4 | 94.1 | - | 97.3 | 97 | 97.1 | 97.1 | 97.9 | 96.5 | 93.1 | 93.3 | 93.3 | 91.7 | 93.7 | 93.6 | 93.4 | 93.7 | 93.9 | 93.9 | 93.1 | 93.7 | 93.9 | 93.6 | 93.1 | 92.7 | 95.7 | 93 | 92.5 | 94 | 94.5 | 91.8 | 91.8 | 91.8 | 91.8 | 91.7 | 92.8 | 92 | 91.7 | 79 | 79 | 77.2 | 79 | 28 | ||
8 | KM254173.1 Korea | 92.3 | 92.3 | 92.3 | 92.9 | 91.7 | 91.2 | 93.3 | - | 95.4 | 95.2 | 95.5 | 96.2 | 94.8 | 92.7 | 92.8 | 92.8 | 92.2 | 93.3 | 93.1 | 92.7 | 93.1 | 93.1 | 93.1 | 92.7 | 93 | 93.1 | 92.8 | 92.2 | 91.8 | 94.8 | 92.5 | 93.1 | 93.3 | 93.6 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 92.7 | 93.7 | 91.7 | 78.8 | 78.7 | 77.1 | 79 | 28,2 | ||
9 | KX133422.1 China | 92.8 | 92.7 | 92.7 | 93.3 | 93 | 92.5 | 94.7 | 93.3 | - | 99.1 | 99.8 | 96.4 | 95.7 | 93.1 | 93 | 93.3 | 90.6 | 93.4 | 93.6 | 93.1 | 93.9 | 93.9 | 93.9 | 93.1 | 93.7 | 93.9 | 93.6 | 92.8 | 92.5 | 95.7 | 93 | 92.7 | 94.8 | 95.1 | 90.9 | 90.9 | 90.9 | 90.9 | 90.8 | 92 | 90.9 | 90.9 | 79.4 | 79.3 | 77.6 | 79.6 | 28 | ||
10 | KX133424.1 China | 92.7 | 92.7 | 92.7 | 93.2 | 92.9 | 92.5 | 94.7 | 93.2 | 99.5 | - | 99.2 | 96.4 | 95.5 | 92.8 | 92.7 | 93 | 90.5 | 93.1 | 93.3 | 92.8 | 93.6 | 93.6 | 93.6 | 92.8 | 93.4 | 93.6 | 93.3 | 92.7 | 92.2 | 95.4 | 92.7 | 92.4 | 94.5 | 94.8 | 90.8 | 90.8 | 90.8 | 90.8 | 90.6 | 92 | 90.9 | 90.9 | 79.1 | 79.1 | 77.4 | 79.1 | 28.2 | ||
11 | KX133425.1 China | 92.8 | 92.8 | 92.8 | 93.3 | 93 | 92.5 | 94.7 | 93.3 | 99.8 | 99.5 | - | 96.5 | 95.8 | 93.3 | 93.1 | 93.4 | 90.8 | 93.6 | 93.7 | 93.3 | 94 | 94 | 94 | 93.3 | 93.9 | 94 | 93.7 | 93 | 92.7 | 95.8 | 93.1 | 92.8 | 94.9 | 95.2 | 91.1 | 91.1 | 91.1 | 91.1 | 90.9 | 92.1 | 91.1 | 91.1 | 79.6 | 79.4 | 77.8 | 79.7 | 28.2 | ||
12 | KM598416.1 USA | 91.3 | 91 | 91.1 | 91.6 | 91.5 | 91.8 | 93.2 | 90.6 | 92.3 | 92.3 | 92.2 | - | 96.7 | 93 | 93 | 93.1 | 91.7 | 93.6 | 93.4 | 93.3 | 94 | 93.7 | 93.7 | 93.1 | 93.6 | 93.7 | 93.4 | 92.7 | 92.4 | 95.7 | 92.8 | 92.7 | 93.9 | 95.7 | 92.4 | 92.4 | 92.4 | 92.4 | 92.2 | 93 | 92 | 91.8 | 79.4 | 79.4 | 77.6 | 79.4 | 28.2 | ||
13 | KU523900.1 China | 92.1 | 91.8 | 92 | 91.9 | 91.7 | 92.6 | 92.2 | 89.3 | 90.7 | 90.8 | 90.8 | 92.3 | - | 94.8 | 94 | 94.3 | 92.1 | 94.2 | 94.6 | 94.8 | 94.3 | 94.9 | 94.9 | 94.5 | 95.1 | 94.9 | 94.9 | 94.5 | 94.2 | 94.9 | 94.6 | 93.1 | 93.3 | 95.5 | 93 | 93 | 93 | 93 | 92.8 | 93.9 | 92.5 | 93.1 | 79 | 78.7 | 77.2 | 78.8 | 27.9 | ||
14 | Group III | NC_024452.1 ABU P1 Hungary | 88.1 | 88.1 | 88.2 | 88.1 | 88 | 88.5 | 88.3 | 87.5 | 87.7 | 87.7 | 87.8 | 88.3 | 88.8 | - | 98.9 | 99.5 | 94.8 | 99.4 | 99.5 | 99.4 | 98.5 | 99.2 | 99.2 | 99.2 | 99.4 | 98.9 | 99.5 | 98.8 | 97.9 | 96.4 | 99.5 | 97.6 | 97.6 | 96.8 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.7 | 93 | 93.6 | 79 | 78.8 | 77.4 | 79.1 | 27.4 | |
15 | USP 93 Brazil | 89.1 | 89.1 | 89.1 | 89.5 | 88.9 | 89.1 | 90.1 | 88.2 | 89 | 88.9 | 89.1 | 89.1 | 89.5 | 95.5 | - | 99.4 | 95.1 | 98.9 | 99.4 | 99.2 | 98 | 99.1 | 99.1 | 99.2 | 98.9 | 99.1 | 99.1 | 98 | 97.1 | 96.5 | 98.8 | 97.6 | 97.6 | 96.8 | 93.3 | 93.3 | 93.3 | 93.3 | 93.1 | 93.7 | 93.1 | 93.3 | 79 | 78.8 | 77.4 | 79.1 | 27.3 | ||
16 | USP 162 Brazil | 88.5 | 88.3 | 88.4 | 88.9 | 88.6 | 89.1 | 89.3 | 88 | 88.5 | 88.6 | 88.6 | 89.4 | 89.6 | 96.3 | 96.4 | - | 94.9 | 99.5 | 99.7 | 99.5 | 98.3 | 99.4 | 99.4 | 99.5 | 99.2 | 99.4 | 99.4 | 98.3 | 97.4 | 96.5 | 99.1 | 97.7 | 97.7 | 97 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.6 | 93.1 | 93.4 | 78.8 | 78.7 | 77.2 | 79 | 27.4 | ||
17 | USP 238-1 Brazil | 87.9 | 88 | 88 | 88 | 87 | 87.2 | 87.9 | 88.1 | 86.7 | 86.8 | 86.8 | 87.9 | 86.9 | 92.7 | 92 | 91 | - | 94.8 | 95.2 | 94.9 | 94.2 | 94.9 | 94.9 | 95.1 | 94.8 | 94.9 | 94.9 | 94.5 | 93.6 | 93.4 | 94.6 | 95.4 | 93.9 | 93.4 | 94.6 | 94.6 | 94.6 | 94.6 | 94.5 | 94.2 | 94.6 | 93.3 | 77.6 | 77.4 | 76 | 77.8 | 27.3 | ||
18 | USP 238-5 Brazil | 89.3 | 89.2 | 89.3 | 89.6 | 89.9 | 89.7 | 90.5 | 88.9 | 89.5 | 89.4 | 89.5 | 89.7 | 89.3 | 95.3 | 96.5 | 95.5 | 92.1 | - | 99.5 | 99.1 | 98.2 | 99.2 | 99.2 | 99.1 | 99.1 | 98.9 | 99.2 | 98.2 | 97.3 | 97 | 98.9 | 97.6 | 97.6 | 96.8 | 93 | 93 | 93 | 93 | 92.8 | 93.4 | 93 | 93.4 | 79 | 78.8 | 77.4 | 79.1 | 27.3 | ||
19 | USP 259-10 Brazil | 88.3 | 88.3 | 88.3 | 88.7 | 88.8 | 88.6 | 89.4 | 87.6 | 88.7 | 88.7 | 88.7 | 89.9 | 88.8 | 94.2 | 96 | 95.1 | 90.7 | 96.6 | - | 99.5 | 98.6 | 99.7 | 99.7 | 99.5 | 99.5 | 99.4 | 99.7 | 98.6 | 97.7 | 96.8 | 99.4 | 98 | 98 | 97.3 | 93.4 | 93.4 | 93.4 | 93.4 | 93.3 | 93.9 | 93.4 | 93.7 | 79.1 | 79 | 77.5 | 79.3 | 27.3 | ||
20 | USP 259-11 Brazil | 88.3 | 88.3 | 88.4 | 88.4 | 88.2 | 88.7 | 89 | 87.5 | 88.2 | 88.1 | 88.3 | 89.2 | 89.1 | 97.5 | 94.9 | 96.8 | 91.8 | 94.8 | 95.1 | - | 98.5 | 99.2 | 99.2 | 99.5 | 99.1 | 99.2 | 99.2 | 98.5 | 97.6 | 96.4 | 99.2 | 97.6 | 97.6 | 96.8 | 93.3 | 93.3 | 93.3 | 93.3 | 93.1 | 93.6 | 93.1 | 93.7 | 79.3 | 79.1 | 77.6 | 79.4 | 27.3 | ||
21 | USP 336-7 Brazil | 89.4 | 89.4 | 89.4 | 89.5 | 90.1 | 90.2 | 90.5 | 88.5 | 89.5 | 89.4 | 89.4 | 90.2 | 88.6 | 94.2 | 95 | 94.1 | 90.9 | 95.9 | 96.3 | 94.5 | - | 98.6 | 98.6 | 98.3 | 98.5 | 98 | 98.3 | 97.9 | 97 | 97.1 | 98.3 | 97 | 97.9 | 97.6 | 92.7 | 92.7 | 92.7 | 92.7 | 92.5 | 93 | 92.7 | 93 | 79.3 | 79.1 | 77.6 | 79.4 | 27.7 | ||
22 | USP 336-15 Brazil | 88.8 | 88.8 | 88.8 | 89.2 | 88.8 | 88.9 | 89.5 | 87.8 | 88.6 | 88.6 | 88.7 | 88.8 | 88.9 | 93.8 | 96.6 | 95.1 | 90.6 | 96.3 | 97.5 | 94.3 | 96.2 | - | 100 | 99.2 | 99.8 | 99.4 | 99.7 | 98.9 | 98 | 97.1 | 99.1 | 98 | 98 | 97.6 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.6 | 93.1 | 93.4 | 79.1 | 79 | 77.5 | 79.3 | 27.3 | ||
23 | USP 336-16 Brazil | 88.6 | 88.6 | 88.6 | 89 | 88.6 | 88.8 | 89.5 | 87.7 | 88.6 | 88.6 | 88.7 | 88.8 | 88.9 | 93.8 | 96.6 | 95.1 | 90.5 | 96.2 | 97.6 | 94.3 | 96.1 | 99.8 | - | 99.2 | 99.8 | 99.4 | 99.7 | 98.9 | 98 | 97.1 | 99.1 | 98 | 98 | 97.6 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.6 | 93.1 | 93.4 | 79.1 | 79 | 77.5 | 79.3 | 27.3 | ||
24 | USP 345-15 Brazil | 88.3 | 88.1 | 88.2 | 88.5 | 88.3 | 88.5 | 88.8 | 87.5 | 88.2 | 88.3 | 88.3 | 88.7 | 89.2 | 95.6 | 96.5 | 96.5 | 91.4 | 95.7 | 95.6 | 96.1 | 94.4 | 95.8 | 95.9 | - | 99.1 | 99.2 | 99.2 | 98.3 | 97.4 | 96.4 | 99.1 | 97.9 | 97.6 | 96.8 | 93.4 | 93.4 | 93.4 | 93.4 | 93.3 | 93.7 | 93.3 | 93.7 | 79 | 78.8 | 77.4 | 79.1 | 27.4 | ||
25 | USP 358-7 Brazil | 88.1 | 88 | 88 | 88.3 | 88 | 88.4 | 89 | 87.5 | 87.9 | 88 | 88 | 89 | 88.9 | 94.4 | 95.8 | 94.6 | 90.7 | 96 | 97.3 | 94.4 | 96 | 96.9 | 96.8 | 94.7 | - | 99.2 | 99.8 | 99.1 | 98.2 | 97 | 99.2 | 97.9 | 97.9 | 97.4 | 93 | 93 | 93 | 93 | 92.8 | 93.7 | 93 | 93.3 | 79 | 78.8 | 77.4 | 79.1 | 27.3 | ||
26 | USP 358-10 Brazil | 89.1 | 89.1 | 89.2 | 89.2 | 89.3 | 89.3 | 90.4 | 88.7 | 89.3 | 89.3 | 89.4 | 89.9 | 89.6 | 97.2 | 95.1 | 96.1 | 92.2 | 95.5 | 95.3 | 97.8 | 94.5 | 94.1 | 94.2 | 95.4 | 94.5 | - | 99.4 | 98.3 | 97.6 | 96.8 | 98.8 | 97.4 | 97.4 | 97 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.6 | 93.1 | 93.4 | 78.8 | 78.7 | 77.2 | 79 | 27.3 | ||
27 | USP 362-7 Brazil | 88.3 | 88.1 | 88.2 | 88.6 | 88.5 | 88.8 | 89.1 | 87.9 | 88.2 | 88.2 | 88.2 | 88.9 | 89.1 | 95.8 | 96.1 | 96.4 | 91.5 | 95.9 | 95.6 | 94.9 | 94.9 | 95.5 | 95.5 | 97 | 96.6 | 95.1 | - | 98.9 | 98 | 96.8 | 99.4 | 97.7 | 97.7 | 97.3 | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.9 | 93.1 | 93.4 | 79 | 78.8 | 77.4 | 79.1 | 27.3 | ||
28 | USP 400-7 Brazil | 88.4 | 88.2 | 88.3 | 88.7 | 88.4 | 88.9 | 89.3 | 87.7 | 88.2 | 88.3 | 88.2 | 88.4 | 89.3 | 93.7 | 96 | 94.7 | 90.6 | 95.5 | 95.8 | 93.4 | 95 | 96.7 | 96.7 | 94.8 | 97.7 | 93.5 | 96.5 | - | 97.6 | 96.1 | 98.6 | 97 | 97 | 96.5 | 92.2 | 92.2 | 92.2 | 92.2 | 92.1 | 93.1 | 92.4 | 93 | 78.4 | 78.2 | 76.8 | 78.5 | 26.8 | ||
29 | USP 401-3A Brazil | 88.4 | 88.4 | 88.4 | 88.8 | 88.6 | 88.8 | 89.8 | 88 | 88.8 | 88.9 | 88.9 | 89.3 | 89 | 93.6 | 95.6 | 94.5 | 90.5 | 95.4 | 96.2 | 93.4 | 95 | 96.3 | 96.3 | 94.5 | 96 | 94.1 | 95.1 | 96.3 | - | 95.5 | 97.7 | 96.1 | 96.1 | 95.7 | 91.8 | 91.8 | 91.8 | 91.8 | 91.7 | 92.4 | 91.7 | 92.2 | 77.9 | 77.8 | 76.3 | 78.1 | 26.7 | ||
30 | USP 710-1 Brazil | 91.6 | 91.6 | 91.7 | 91.9 | 91.9 | 91.4 | 93.6 | 90.9 | 91.9 | 91.8 | 91.9 | 91.3 | 90.2 | 93.2 | 94.1 | 93 | 91.2 | 94.6 | 93.5 | 93.1 | 94.1 | 93.3 | 93.3 | 92.9 | 93.2 | 94.8 | 93.2 | 92.9 | 93.2 | - | 96.2 | 95.5 | 96.4 | 97.1 | 93 | 93 | 93 | 93 | 92.8 | 93.7 | 93 | 92.7 | 79.3 | 79.1 | 77.6 | 79.4 | 27.3 | ||
31 | USP 711-11 Brazil | 87.8 | 87.8 | 87.8 | 88.1 | 88.1 | 88.4 | 88.6 | 88.1 | 88.2 | 88.2 | 88.3 | 88.9 | 89.6 | 95.8 | 95.8 | 96.6 | 91.1 | 94.8 | 94.6 | 95.6 | 93.8 | 94.8 | 94.8 | 95.8 | 94.5 | 95.2 | 96 | 94.5 | 94.6 | 92.7 | - | 97.7 | 97.7 | 96.7 | 93 | 93 | 93 | 93 | 92.8 | 93.6 | 92.8 | 93.4 | 79 | 78.8 | 77.4 | 79.1 | 27.3 | ||
32 | KX084401.1 China | 87.6 | 87.4 | 87.5 | 88.1 | 87.3 | 87.6 | 88.9 | 88.1 | 87.7 | 87.8 | 87.8 | 88.5 | 88.4 | 92.6 | 94.3 | 93.8 | 90.5 | 93.9 | 94.4 | 92.4 | 93.6 | 94.8 | 94.8 | 93.9 | 93.6 | 92.5 | 94.3 | 93.8 | 94.1 | 92.2 | 93.5 | - | 97.9 | 96.4 | 93.9 | 93.9 | 93.9 | 93.9 | 93.7 | 92.8 | 93.1 | 92.2 | 79 | 78.7 | 77.4 | 79.1 | 27.4 | ||
33 | KX133421.1 China | 89 | 88.7 | 88.9 | 89.2 | 88.7 | 88.9 | 90.1 | 88.1 | 89.7 | 89.6 | 89.7 | 89.4 | 87.9 | 92.1 | 94.1 | 93.6 | 89.5 | 93.7 | 94 | 92.4 | 94.1 | 94.6 | 94.5 | 93 | 92.8 | 92.5 | 93.1 | 93 | 93.4 | 92.6 | 93.1 | 96.1 | - | 96.5 | 92.1 | 92.1 | 92.1 | 92.1 | 92 | 93.1 | 91.8 | 92.1 | 79 | 78.8 | 77.4 | 79.1 | 27.4 | ||
34 | KM598415.1 USA | 92.1 | 92 | 92.1 | 91.7 | 91.7 | 92.1 | 91.8 | 89 | 90.7 | 90.8 | 90.8 | 90.7 | 91.6 | 91.9 | 92.9 | 92.8 | 89.6 | 92.8 | 92.3 | 91.3 | 93.4 | 92.9 | 92.7 | 92.4 | 91.8 | 91.8 | 92.7 | 92.1 | 92 | 93.2 | 92.6 | 91.9 | 91.6 | - | 93.1 | 93.1 | 93.1 | 93.1 | 93 | 93.7 | 93 | 92.8 | 79.6 | 79.4 | 77.9 | 79.7 | 28 | ||
35 | Group IV | USP 507-1 Brazil | 86.9 | 86.9 | 86.9 | 87.1 | 86.4 | 86.9 | 86.6 | 89 | 85.9 | 86 | 85.9 | 87.2 | 85.7 | 86.5 | 87.1 | 86.3 | 91.4 | 87.6 | 86.4 | 86 | 86.7 | 86.5 | 86.4 | 86.7 | 86.3 | 86.7 | 86.2 | 86.1 | 86.2 | 87.4 | 86.1 | 86.3 | 85.5 | 86.8 | - | 100 | 100 | 100 | 99.8 | 98 | 97.6 | 95.8 | 78.8 | 78.5 | 77.1 | 79.1 | 28 | |
36 | USP 507-3 Brazil | 86.9 | 86.9 | 86.9 | 87.1 | 86.4 | 86.9 | 86.6 | 89 | 85.9 | 86 | 85.9 | 87.2 | 85.7 | 86.5 | 87.1 | 86.3 | 91.4 | 87.6 | 86.4 | 86 | 86.7 | 86.5 | 86.4 | 86.7 | 86.3 | 86.7 | 86.2 | 86.1 | 86.2 | 87.4 | 86.1 | 86.3 | 85.5 | 86.8 | 100 | - | 100 | 100 | 99.8 | 98 | 97.6 | 95.8 | 78.8 | 78.5 | 77.1 | 79.1 | 28 | ||
37 | USP 507-9D Brazil | 86.9 | 86.9 | 86.9 | 87.1 | 86.4 | 86.9 | 86.6 | 89 | 85.9 | 86 | 85.9 | 87.2 | 85.7 | 86.5 | 87.1 | 86.3 | 91.4 | 87.6 | 86.4 | 86 | 86.7 | 86.5 | 86.4 | 86.7 | 86.3 | 86.7 | 86.2 | 86.1 | 86.2 | 87.4 | 86.1 | 86.3 | 85.5 | 86.8 | 100 | 100 | - | 100 | 99.8 | 98 | 97.6 | 95.8 | 78.8 | 78.5 | 77.1 | 79.1 | 28 | ||
38 | USP 507-20 Brazil | 86.9 | 86.9 | 86.9 | 87.1 | 86.4 | 86.9 | 86.6 | 89 | 85.9 | 86 | 85.9 | 87.2 | 85.7 | 86.5 | 87.1 | 86.3 | 91.4 | 87.6 | 86.4 | 86 | 86.7 | 86.5 | 86.4 | 86.7 | 86.3 | 86.7 | 86.2 | 86.1 | 86.2 | 87.4 | 86.1 | 86.3 | 85.5 | 86.8 | 100 | 100 | 100 | - | 99.8 | 98 | 97.6 | 95.8 | 78.8 | 78.5 | 77.1 | 79.1 | 28 | ||
39 | USP 507-24 Brazil | 86.9 | 86.9 | 86.9 | 87 | 86.3 | 86.9 | 86.6 | 89 | 85.9 | 86 | 85.9 | 87.1 | 85.7 | 86.5 | 87 | 86.2 | 91.4 | 87.6 | 86.3 | 86 | 86.6 | 86.4 | 86.3 | 86.6 | 86.3 | 86.6 | 86.2 | 86.1 | 86.1 | 87.4 | 86.1 | 86.3 | 85.4 | 86.7 | 99.9 | 99.9 | 99.9 | 99.9 | - | 97.9 | 97.4 | 95.7 | 78.8 | 78.5 | 77.1 | 79.1 | 28 | ||
40 | KX133416.1 China | 86.4 | 86.5 | 86.4 | 86.7 | 85.7 | 86.9 | 86.2 | 87.6 | 85.8 | 86 | 85.9 | 86.7 | 87.3 | 86.8 | 87.2 | 86.6 | 89.9 | 86.8 | 86.2 | 87 | 85.7 | 86.2 | 86 | 86.2 | 86.6 | 86.7 | 86.4 | 86.4 | 86.2 | 86.4 | 86.9 | 85 | 85.1 | 86.2 | 93.2 | 93.2 | 93.2 | 93.2 | 93.1 | - | 97.3 | 96.8 | 78.5 | 78.4 | 76.8 | 78.8 | 28 | ||
41 | KX084400.1 China | 86.2 | 86.3 | 86.2 | 86.3 | 85.5 | 86.3 | 86 | 89.2 | 85.7 | 85.8 | 85.8 | 85.9 | 85.7 | 86.1 | 86.5 | 85.7 | 89.9 | 86.5 | 85.7 | 85.9 | 85.7 | 85.9 | 85.8 | 86.3 | 85.6 | 86.1 | 86.1 | 85.3 | 85.6 | 86.2 | 85.9 | 85.3 | 84.6 | 86 | 93.4 | 93.4 | 93.4 | 93.4 | 93.3 | 92.9 | - | 97.4 | 78.5 | 78.4 | 76.8 | 78.8 | 28.3 | ||
42 | KX133427.1 China | 85.7 | 85.8 | 85.7 | 85.7 | 85 | 86.6 | 85.6 | 88.1 | 85.7 | 85.8 | 85.8 | 86.2 | 86.7 | 86.9 | 86.7 | 86.3 | 89 | 87.1 | 86.1 | 86.6 | 86.1 | 86 | 85.9 | 87 | 85.9 | 86.7 | 86.7 | 85.8 | 85.9 | 86 | 86.6 | 85 | 84.7 | 86.4 | 91.5 | 91.5 | 91.5 | 91.5 | 91.4 | 92.5 | 96.7 | - | 79.4 | 79.3 | 77.6 | 79.7 | 27.7 | ||
43 | TuPV | NC_024454.1 Hungary 1079 | 73.5 | 73.4 | 73.5 | 73.5 | 73.4 | 73.3 | 73.5 | 73.1 | 73.6 | 73.5 | 73.6 | 73.5 | 73.3 | 73.3 | 73.4 | 73.3 | 72.4 | 73.9 | 73.5 | 73.3 | 73.7 | 73.5 | 73.5 | 73.2 | 73.5 | 73.2 | 73.5 | 73.6 | 73.5 | 73.5 | 72.9 | 73.2 | 73.1 | 73.7 | 73.3 | 73.3 | 73.3 | 73.3 | 73.4 | 72.9 | 73.3 | 74.3 | - | 99.4 | 98.2 | 99.2 | 26.7 | |
44 | 30.KM598418.1 USA | 73.5 | 73.4 | 73.4 | 73.5 | 73.4 | 73.1 | 73.5 | 73 | 73.6 | 73.5 | 73.6 | 73.5 | 73 | 73.3 | 73.2 | 73.2 | 72.4 | 73.9 | 73.5 | 73.4 | 73.7 | 73.5 | 73.5 | 73 | 73.6 | 73.2 | 73.4 | 73.5 | 73.5 | 73.6 | 72.8 | 73 | 73.1 | 73.5 | 73.3 | 73.3 | 73.3 | 73.3 | 73.4 | 72.8 | 73.1 | 74.2 | 98.8 | - | 97.6 | 99.1 | 26.8 | ||
45 | 31.KM598420.1 USA | 73 | 72.8 | 72.9 | 73 | 72.8 | 72.7 | 73 | 72.5 | 73.1 | 73 | 73.1 | 73 | 72.7 | 72.7 | 72.8 | 72.8 | 71.8 | 73.3 | 72.8 | 72.7 | 73.1 | 72.8 | 72.9 | 72.6 | 72.9 | 72.6 | 73 | 73 | 72.9 | 73 | 72.4 | 72.6 | 72.6 | 73.1 | 72.7 | 72.7 | 72.7 | 72.7 | 72.8 | 72.3 | 72.7 | 73.7 | 99.3 | 98.1 | - | 97.4 | 26.5 | ||
46 | 32.KM598421.1 USA | 73,3 | 73.2 | 73.2 | 73.4 | 73.2 | 72.9 | 73.3 | 73.1 | 73.6 | 73.5 | 73.6 | 73.4 | 73 | 73.2 | 73.1 | 73.3 | 72.4 | 73.7 | 73.4 | 73.4 | 73.7 | 73.4 | 73.4 | 72.9 | 73.5 | 73.2 | 73.3 | 73.4 | 73.4 | 73.5 | 72.8 | 72.9 | 72.9 | 73.4 | 73.2 | 73.2 | 73.2 | 73.2 | 73.3 | 72.8 | 73.1 | 74.3 | 98.7 | 98.9 | 98 | - | 26.7 | ||
47 | GPV | NC_001701.1 | 46,4 | 46.3 | 46.3 | 46.3 | 46.1 | 46.9 | 46.7 | 46.5 | 46.7 | 46.8 | 46.8 | 47 | 46.7 | 46.3 | 46.8 | 46.2 | 46.3 | 46.5 | 46.9 | 46.4 | 46.8 | 46.9 | 46.9 | 46.5 | 47 | 46.4 | 46.6 | 46.6 | 46.3 | 46.7 | 46.5 | 46.3 | 46.6 | 46.7 | 46.4 | 46.4 | 46.4 | 46.4 | 46.4 | 46.2 | 45.9 | 45.8 | 44.6 | 44.3 | 44.6 | 44.3 | - | |
% Nucleotides Similarity |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nuñez, L.F.N.; Santander-Parra, S.H.; Astolfi-Ferreira, C.S.; Loor-Giler, A.; Ferreira, A.J.P. Molecular Characterization of the Chicken Parvovirus Based on VP1 Gene Circulating in Brazilian Chicken Flocks. Microorganisms 2024, 12, 1065. https://doi.org/10.3390/microorganisms12061065
Nuñez LFN, Santander-Parra SH, Astolfi-Ferreira CS, Loor-Giler A, Ferreira AJP. Molecular Characterization of the Chicken Parvovirus Based on VP1 Gene Circulating in Brazilian Chicken Flocks. Microorganisms. 2024; 12(6):1065. https://doi.org/10.3390/microorganisms12061065
Chicago/Turabian StyleNuñez, Luis F. N., Silvana H. Santander-Parra, Claudete S. Astolfi-Ferreira, Anthony Loor-Giler, and Antonio J. P. Ferreira. 2024. "Molecular Characterization of the Chicken Parvovirus Based on VP1 Gene Circulating in Brazilian Chicken Flocks" Microorganisms 12, no. 6: 1065. https://doi.org/10.3390/microorganisms12061065