Critical Involvement of the Thioredoxin Reductase Gene (trxB) in Salmonella Gallinarum-Induced Systemic Infection in Chickens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Growth Conditions
2.2. Construction of trxB::Cm Mutant
2.3. Assays of Growth Kinetics and Sensitivity
2.4. Chicken Embryo Infection Model
2.5. Chicken Oral Infection Model
2.6. Quantitative Real-Time PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Deletion of trxB Gene Does Not Affect the Morphology and Growth
3.2. Deletion of trxB Gene Did Not Affect the Pathogenicity of SG in Chicken Embryo Infection
3.3. Deletion of trxB Gene Significantly Reduced Bacterial Load and Clinical Symptoms in the Chicken Infection Model
3.4. Deletion of trxB Gene Significantly Reduced Lower Level of Immune Response in Chicken Infection Model
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paul, A.B.; Neto, O.C.F. Pullorum disease and fowl typhoid-new thoughts on old diseases: A review. Avian Pathol. 2011, 40, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Nam-Hyung, K.; Eun-Jin, H.; Dae-Sung, K.; Chung-Young, L.; Jae-Hong, K.; Hyuk-Joon, K. Molecular evolution of Salmonella enterica subsp. enterica serovar Gallinarum biovar Gallinarum in the field. Vet. Microbiol. 2019, 235, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Foley, S.L.; Johnson, T.J.; Ricke, S.C.; Nayak, R.; Danzeisen, J. Salmonella pathogenicity and host adaptation in chicken-associated serovars. Microbiol. Mol. Biol. Rev. 2013, 77, 582–607. [Google Scholar] [CrossRef] [PubMed]
- Chacana, P.A.; Terzolo, H.R. Protection conferred by a live Salmonella Enteritidis vaccine against fowl typhoid in laying hens. Avian Dis. 2006, 50, 280–283. [Google Scholar] [CrossRef] [PubMed]
- Gordon, R.F.; Gars Ide, J.S.; Tucker, J.F. The use of living attenuated vaccines in the control of fowl typhoid. Vet. Rec. 1959, 71, 300–304. [Google Scholar]
- Winter, S.E.; Raffatellu, M.; Wilson, R.P.; Rüssmann, H.; Bäumler, A.J. The Salmonella enterica serotype Typhi regulator TviA reduces interleukin-8 production in intestinal epithelial cells by repressing flagellin secretion. Cell Microbiol. 2008, 10, 247–261. [Google Scholar] [CrossRef] [PubMed]
- Wigley, P. Salmonella enterica serovar Gallinarum: Addressing fundamental questions in bacteriology sixty years on from the 9R vaccine. Avian Pathol. 2017, 46, 119–124. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, G.H.D.; Berchieri, J.A.; Fernandes, A.C. Experimental infection of laying hens with Salmonella enterica serovar Gallinarum. Braz. J. Microbiol. 2005, 36, 51–56. [Google Scholar] [CrossRef]
- Kwon, H.J.; Cho, S.H. Pathogenicity of SG 9R, a rough vaccine strain against fowl typhoid. Vaccine 2011, 29, 1311–1318. [Google Scholar] [CrossRef]
- Bjørklund, G.; Zou, L.; Wang, J.; Chasapis, C.T.; Peana, M. Thioredoxin reductase as a pharmacological target. Pharmacol. Res. 2021, 174, 105854. [Google Scholar] [CrossRef]
- Kidd, S.P.; Potter, A.J.; Apicella, M.A.; Jennings, M.P.; McEwan, A.G. NmlR of Neisseria gonorrhoeae: A novel redox responsive transcription factor from the MerR family. Mol. Microbiol. 2005, 57, 1676–1689. [Google Scholar] [CrossRef] [PubMed]
- Potter, A.J.; Kidd, S.P.; Edwards, J.L.; Falsetta, M.L.; Apicella, M.A.; Jennings, M.P.; McEwan, A.G. Thioredoxin reductase is essential for protection of Neisseria gonorrhoeae against killing by nitric oxide and for bacterial growth during interaction with cervical epithelial cells. J. Infect. Dis. 2009, 199, 227–235. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Dong, Z.; Han, X.; Wang, H.; Jiang, L.; Sun, J.; Yang, Y.; Ma, T.; Shao, C.; Wang, X.; et al. Thioredoxin A is essential for motility and contributes to host infection of Listeria monocytogenes via redox interactions. Front. Cell. Infect Microbiol. 2017, 7, 287. [Google Scholar] [CrossRef]
- Rozhkova, A.; Stirnimann, C.U.; Frei, P.; Grauschopf, U.; Brunisholz, R.; Grütter, M.G.; Capitani, G.; Glockshuber, R. Structural basis and kinetics of inter-and intramolecular disulfide exchange in the redox catalyst DsbD. EMBO J. 2004, 23, 1709–1719. [Google Scholar] [CrossRef] [PubMed]
- Missiakas, D.; Georgopoulos, C.; Raina, S. Identification and characterization of the Escherichia coli gene dsbB, whose product is involved in the formation of disulfide bonds in vivo. Proc. Natl. Acad. Sci. USA 1993, 90, 7084–7088. [Google Scholar] [CrossRef] [PubMed]
- Ito, K.; Inaba, K. The disulfide bond formation (Dsb) system. Curr. Opin. Struct. Biol. 2008, 18, 450–458. [Google Scholar] [CrossRef]
- Zeller, T.; Klug, G. Thioredoxins in bacteria: Functions in oxidative stress response and regulation of thioredoxin genes. Naturwissenschaften 2006, 93, 259–266. [Google Scholar] [CrossRef]
- Thomson, N.R.; Clayton, D.J.; Windhorst, D.; Vernikos, G.; Davidson, S.; Churcher, C.; Quail, M.A.; Stevens, M.; Jones, M.A.; Watson, M.; et al. Comparative genome analysis of Salmonella Enteritidis PT4 and Salmonella Gallinarum 287/91 provides insights into evolutionary and host adaptation pathways. Genome Res. 2008, 18, 1624–1637. [Google Scholar] [CrossRef]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef]
- Ojima, S.; Okamura, M.; Osawa, N.; Tamura, A.; Yoshioka, K.; Kashimoto, T.; Haneda, T.; Ono, H.K.; Hu, D.L. Characteristics of systemic infection and host responses in chickens experimentally infected with Salmonella enterica serovar Gallinarum biovar Gallinarum. J. Vet. Med. Sci. 2021, 83, 1147–1154. [Google Scholar] [CrossRef]
- Ojima, S.; Ono, H.K.; Okimoto, R.; Yu, X.; Sugiyama, M.; Yoshioka, K.; Haneda, T.; Okamura, M.; Hu, D.L. wecB Gene of Salmonella Gallinarum plays a critical role in systemic infection of fowl typhoid. Front. Microbiol. 2022, 13, 880932. [Google Scholar] [CrossRef] [PubMed]
- An, J.U.; Song, Y.S.; Kim, K.R.; Ko, Y.J.; Yoon, D.Y.; Oh, D.K. Biotransformation of polyunsaturated fatty acids to bioactive hepoxilins and trioxilins by microbial enzymes. Nat. Commun. 2018, 9, 128. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.D.; Day, A.M.; Taylor, S.R.; Tomalin, L.E.; Morgan, B.A.; Veal, E.A. A peroxiredoxin promotes H2O2 signaling and oxidative stress resistance by oxidizing a thioredoxin family protein. Cell Rep. 2013, 5, 1425–1435. [Google Scholar] [CrossRef] [PubMed]
- Oktyabr, O.N.; Ushakov, V.Y.; Muzyka, N.G.; Smirnova, G.V. The role of thiol redox systems in the response of Escherichia coli to far-UV irradiation. Microbiology 2009, 78, 290–295. [Google Scholar] [CrossRef]
- Takemoto, T.; Zhang, Q.M.; Yonei, S. Different mechanisms of thioredoxin in its reduced and oxidized forms in defense against hydrogen peroxide in Escherichia coli. Free Radic. Biol. Med. 1998, 24, 556–562. [Google Scholar] [CrossRef] [PubMed]
- Varatnitskaya, M.; Degrossoli, A.; Leichert, L.I. Redox regulation in host-pathogen interactions: Thiol switches and beyond. Biol. Chem. 2021, 402, 299–316. [Google Scholar] [CrossRef] [PubMed]
- Stewart, E.J.; Aslund, F.; Beckwith, J. Disulfide bond formation in the Escherichia coli cytoplasm: An in vivo role reversal for the thioredoxins. EMBO J. 1998, 17, 5543–5550. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, R.; Kosugi, K.; Mizukami, M.; Ishibashi, M.; Tokunaga, H.; Tokunaga, M. Expression and purification of thioredoxin (TrxA) and thioredoxin reductase (TrxB) from Brevibacillus choshinensis. Protein Expr. Purif. 2004, 37, 385–391. [Google Scholar] [CrossRef]
- Bjur, E.; Eriksson-Ygberg, S.; Aslund, F.; Rhen, M. Thioredoxin 1 promotes intracellular replication and virulence of Salmonella enterica serovar Typhimurium. Infect. Immune 2006, 74, 5140–5151. [Google Scholar] [CrossRef]
- Jakob, U.; Muse, W.; Eser, M.; Bardwell, J.C. Chaperone activity with a redox switch. Cell 1999, 96, 341–352. [Google Scholar] [CrossRef]
- Cremers, C.M.; Knoefler, D.; Vitvitsky, V.; Banerjee, R.; Jakob, U. Bile salts act as effective protein-unfolding agents and instigators of disulfide stress in vivo. Proc. Natl. Acad. Sci. USA 2014, 111, E1610–E1619. [Google Scholar] [CrossRef] [PubMed]
- Sottosanti, J. Incubation Temperature and Post-Hatch Stress Effects on Immune Parameters, Immune System Development, and Performance in Commercial Broilers. Doctoral Thesis, Virginia Tech, Blacksburg, Virginia, 2009. Available online: http://hdl.handle.net/10919/34605 (accessed on 13 August 2009).
- Panda, A.K.; Bhanja, S.K.; Sunder, G.S. Early post hatch nutrition on immune system development and function in broiler chickens. Worlds Poult. Sci. J. 2015, 71, 285–296. [Google Scholar] [CrossRef]
- Garcia, P.; Wang, Y.; Viallet, J.; Macek, J.Z. The chicken embryo model: A novel and relevant model for immune-based studies. Front. Immunol. 2021, 12, 791081. [Google Scholar] [CrossRef] [PubMed]
- Anjou, C.; Lotoux, A.; Zhukova, A.; Royer, M.; Caulat, L.C.; Capuzzo, E.; Morvan, C.; Martin-Verstraete, I. The multiplicity of thioredoxin systems meets the specific lifestyles of Clostridia. PLoS Pathog. 2024, 20, e1012001. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Lin, Y.; Huang, Y.; Shen, Y.Q.; Chen, Q. Thioredoxin (Trx): A redox target and modulator of cellular senescence and aging-related diseases. Redox Biol. 2024, 13, 103032. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Holmgren, A. The thioredoxin antioxidant system. Free Radic. Biol. Med. 2014, 66, 75–87. [Google Scholar] [CrossRef] [PubMed]
- Mishra, P.K.K.; Parvathy, R.; Dixit, S.K.; Kumawat, M. Cloning and sequencing of Thioredoxin reductase (trxB) gene of Salmonella enterica serovar Typhimurium isolated from poultry. J. Anim. Res. 2016, 6, 21–26. [Google Scholar] [CrossRef]
- Prieto, A.M.J.; Jurado, J.; Gallardo-Madueno, R.; Monje-Casas, F.; Holmgren, A.; Pueyo, C. Transcriptional regulation of glutaredoxin and thioredoxin pathways and related enzymes in response to oxidative stress. J. Biol. Chem. 2000, 275, 13398–13405. [Google Scholar] [CrossRef]
Primers | Sequences | Amplicon (bp) |
---|---|---|
SG-F1 | ACAATTCTGCTCATTGTCTGCCAACAACTATGGGGATCTCGTGTAGGCTGGAGCTGCTTCTT | 1014 |
SG-R1 | TCTATAGTCGCCTTTTTTACTTTTGTTACTGATTTGTAAAAACATATGAATATCCTCCTTAG | |
SG-F2 | CTCACATCACTGTTCAGAGTCGCTG | 764 |
SG-R2 | TTTTCACCATGGGCAAATAT |
Primers | Sequences | Amplicon (bp) | Accession No. |
---|---|---|---|
GAPDH-F | GGCACTGTCAAGGCTGAGAA | 99 | NM_204305.2 |
GAPDH-R | TGCATCTGCCCATTTGATGT | ||
IL-1β-F | CGAGGAGCAGGGACTTTGC | 71 | NM_204524.2 |
IL-1β-R | GAAGGTGACGGGCTCAAAAA | ||
IL-6-F | CCTGGCGGCCACGAT | 61 | NM_204628.2 |
IL-6-R | CGAGTCTGGGATGACCACTTC | ||
TNF-α-F | GAGGCAGGGAGAAAAATAGGTTTC | 83 | NM_001037837.2 |
TNF-α-R | GCTTTTACTATGGGGTAACCAACTC | ||
IFN-γ-F | ATGTAGCTGACGGTGGACCT | 102 | NM_205149.2 |
IFN-γ-R | CCAAGTACATCGAAACAATCTGGC | ||
IL-12-F | AAGTAGACTCCAATGGGCAAATG | 66 | NM_213571.1 |
IL-12-R | ACGTCTTGCTTGGCTCTTTATAGC | ||
CXCLi1-F | GGCTGGAGCAAAAGGTATGG | 58 | NM_205018.2 |
CXCLi1-R | GCACTGGCATCGGAGTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Z.; Hu, Z.; Ojima, S.; Yu, X.; Sugiyama, M.; Ono, H.K.; Hu, D.-L. Critical Involvement of the Thioredoxin Reductase Gene (trxB) in Salmonella Gallinarum-Induced Systemic Infection in Chickens. Microorganisms 2024, 12, 1180. https://doi.org/10.3390/microorganisms12061180
Zhu Z, Hu Z, Ojima S, Yu X, Sugiyama M, Ono HK, Hu D-L. Critical Involvement of the Thioredoxin Reductase Gene (trxB) in Salmonella Gallinarum-Induced Systemic Infection in Chickens. Microorganisms. 2024; 12(6):1180. https://doi.org/10.3390/microorganisms12061180
Chicago/Turabian StyleZhu, Zhihao, Zuo Hu, Shinjiro Ojima, Xiaoying Yu, Makoto Sugiyama, Hisaya K. Ono, and Dong-Liang Hu. 2024. "Critical Involvement of the Thioredoxin Reductase Gene (trxB) in Salmonella Gallinarum-Induced Systemic Infection in Chickens" Microorganisms 12, no. 6: 1180. https://doi.org/10.3390/microorganisms12061180