Next Article in Journal
Streptococcus thermophilus iHA318 Improves Dry Eye Symptoms by Mitigating Ocular Surface Damage in a Mouse Model
Next Article in Special Issue
Pathogenicity of Multidrug-Resistant Salmonella typhimurium Isolated from Ducks
Previous Article in Journal
DNA Methylation Levels of the ACE2 Promoter Are Not Associated with Post-COVID-19 Symptoms in Individuals Who Had Been Hospitalized Due to COVID-19
Previous Article in Special Issue
Ovine and Caprine Strains of Corynebacterium pseudotuberculosis on Czech Farms—A Comparative Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 7
10.3390/microorganisms12071305
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Report on the Occurrence and Antibiotic Resistance Profile of Colistin-Resistant Escherichia coli in Raw Beef and Cow Feces in Vietnam

by
Hoang Minh Duc
1,*,
Tran Thi Khanh Hoa
1,
Nguyen Van Thang
2 and
Hoang Minh Son
3
1
Department of Veterinary Public Health, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
2
Veterinary Hospital, Faculty of Veterinary Medicine, Vietnam National University of Agriculture Trau Quy, Gia Lam, Hanoi 12400, Vietnam
3
Department of Anatomy and Histology, Faculty of Veterinary Medicine, Vietnam National University of Agriculture, Trau Quy, Gia Lam, Hanoi 12400, Vietnam
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(7), 1305; https://doi.org/10.3390/microorganisms12071305
Submission received: 6 June 2024 / Revised: 18 June 2024 / Accepted: 21 June 2024 / Published: 27 June 2024
(This article belongs to the Special Issue Bacterial Infections and Antimicrobial Resistance in Animals)
Versions Notes

Abstract

:
Colistin-resistant Escherichia coli (COE) has been recently recognized as a serious threat to animal and human health. This study aimed to determine the prevalence and antibiotic resistance profile of COE isolated from raw beef and cow feces in Vietnam. Our results showed that 16% (16/100) and 32% (32/100) of raw beef and cow feces samples were positive for COE, respectively. A total of 48 COE strains were isolated, with 16 originating from raw beef and 32 from cow feces samples. The antibiotic susceptibility test revealed that the COE isolates were highly resistant to ampicillin, tetracycline, florfenicol, trimethoprim/sulfamethoxazole, streptomycin, and nalidixic acid, with resistance rates ranging from 66.67% to 87.5%. In addition, 87.5% of the isolates were identified to be multidrug-resistant strains. Further molecular characterization indicated that all COE isolates carried the mcr-1 gene, with 16 of them also harboring blaCTX-M-55 genes. Taken together, the findings in this study demonstrate that raw beef and cow feces are important sources of COE, which can be potentially transmitted to humans through the food chain.

1. Introduction

Escherichia coli (E. coli) is a commensal bacterium colonizing the intestinal tract of humans and warm-blooded animals [1]. Therefore, this bacterium can easily contaminate meat during slaughter [2]. As a result, E. coli is usually utilized as an indicator of fecal contamination in meat [3]. In addition, E. coli is also known as an effective indicator microorganism for antibiotic resistance (AMR) monitoring in animals, humans, and food [4,5] since this bacterium is capable of acquiring resistant genes and transferring them to other commensal and pathogenic bacteria in the intestinal tract [6]. The ease of isolation and cost-effectiveness further justify the selection of E. coli for AMR surveillance programs [5,7,8,9].
AMR poses a significant threat to public health, economic development, and food safety worldwide [10,11]. According to the World Health Organization (WHO), AMR is responsible for at least 700,000 annual deaths worldwide [12]. Alarmingly, this number could escalate to a staggering 10 million deaths per year by 2050 [10,12]. Recently, livestock has been increasingly recognized as a reservoir for antibiotic-resistant bacteria that can be transferred to humans through the consumption of contaminated meat products. In Vietnam, antibiotics have been widely used in livestock for disease treatment, prevention, and growth promotion, leading to the development of AMR. It was recently reported that in Vietnam (2016), approximately 77.4 and 286.6 mg of antibiotics were added to feed to produce 1 kg of chickens and pigs, respectively [13]. The most commonly used antibiotics in the chicken industry in Vietnam were bacitracin, chlortetracycline, colistin, and enramycin [13]. In the pig industry, florfenicol, chlortetracycline, colistin, and bacitracin were frequently selected antibiotics [13].
Colistin (polymyxin E) has been classified by the WHO in the group of “Highest Priority Critically Important Antimicrobials for Human Medicine” as this antibiotic is considered to be the last-resort antimicrobial for the treatment of life-threatening infections in humans caused by multidrug-resistant Gram-negative bacteria [11,14]. However, in many countries [15,16,17], including Vietnam [18], colistin has been used extensively for decades for livestock prophylactic, therapeutic, and even growth promotion purposes. Consequently, the prevalence of colistin-resistant E. coli (COE) isolates in meat and food-producing animals has recently been reported worldwide [11,19,20,21,22,23].
β-lactam antibiotics have been widely used in both human and animal healthcare sectors [24]. WHO has also categorized the third-generation cephalosporins as “Highest Priority Critically Important Antimicrobials for human medicine” [25]. Extended-spectrum β-lactamases (ESBLs) are a type of β-lactamase that confer bacterial resistance to the first, second, and third-generation cephalosporins and aztreonam [26]. The genes encoding ESBLs are highly diverse and can be grouped into several families, including blaTEM, blaSHV, and blaCTX-M [27]. The blaCTX-M is commonly found in E. coli isolates of animal origin [28]. Plasmids and mobile genetic elements have been known to be the important factors contributing to the widespread distribution of blaCTX-M [29]. The blaCTX-M family is mainly divided into five groups: blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, blaCTX-M-9 and blaCTX-M-25 [30]. These subtypes have been recently reported to coexist with other antibiotic-resistant genes, including colistin-resistant genes [31,32].
According to Vietnam’s General Statistical Office (GSO) and Department of Livestock Production (DLP), Vietnam had approximately 6.35 million cattle heads in 2022, with 95% being beef cattle. It was estimated by the Agriculture Organization of the United Nations (FAO) that the average beef consumption of Vietnamese in 2022 was around 8.5 kg per capita per year, which is twice as high as China and six times higher than Thailand [33]. To date, there is no report on the occurrence and antibiotic resistance profile of COE isolates from raw beef and cow feces in Vietnam. The aim of this study was to determine the prevalence and antibiotic resistance profile of COE isolates from raw beef and cow feces collected in Hanoi, Vietnam.

2. Materials and Methods

2.1. Isolation and Identification of COE

A total of 100 raw beef and 100 cow feces samples were randomly obtained from retail markets and beef cattle farms in Hanoi, Vietnam, from 2022 to 2023 for the isolation of COE. Briefly, 25 g of each sample was homogenized with 225 mL of Buffered Peptone Water (BPW, Oxoid Ltd., Hants, UK) and incubated at 37 °C for 18–24 h. The enriched sample was subsequently streaked onto MacConkey Agar (Oxoid Ltd., Hants, UK) supplemented with 2 mg/L of colistin (Sigma-Aldrich, St. Louis, MO, USA) and incubated at 37 °C for 24 h. Following incubation, presumptive colonies showing typical E. coli morphology (pink, flat, and dry) were picked up and re-streaked on Eosin Methylene Blue agar (EMB, Oxoid Ltd., Hants, UK) containing 2 mg/L of colistin and incubated at 37 °C for 24 h. The next day, up to three presumptive colonies of E. coli on EMB agar (black centered and flat with metallic green sheen) were grown into Brain Heart Infusion (BHI, Oxoid Ltd., Hants, UK) for biochemical confirmation using API-20E kit (bioMérieux, Marcy l’Etoile, France). Afterward, E. coli isolates were preserved at −86 °C for further use.

2.2. Antibiotic Susceptibility Test

Verified E. coli isolates were tested for their susceptibility to 15 different antibiotics using broth dilution methods according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI) [34]. Antibiotics used for this study include ampicillin, tetracycline, streptomycin, gentamicin, colistin, azithromycin, trimethoprim/sulfamethoxazole, florfenicol, meropenem, cefotaxime, cefoxitin, cefepime, ceftazidime, ciprofloxacin, and nalidixic acid. E. coli strain ATCC 25922 served as a quality control strain. The minimum inhibitory concentration (MIC) was determined to be the lowest concentration of an antimicrobial that inhibited the visible growth of the isolate tested. Multidrug-resistant strains were defined as isolates resistant to at least one antibiotic from three or more antibiotic classes.
E. coli isolates resistant to cefotaxime and/or ceftazidime were considered as presumptive ESBL producers, and their ESBL-producing ability was phenotypically confirmed using a CLSI confirmatory ESBL test [34].

2.3. Detection of mcr Genes and ESBL Encoding Genes

Phenotypically confirmed colistin-resistant isolates (MIC ≥ 4 mg/L) were subjected to multiplex PCR for the detection of mcr genes (mcr-1, mcr-2, mcr-3, mcr-4, and mcr-5) following the previously described method [35]. The DNA extraction of these isolates was performed using a GeneJet Genomic DNA purification kit (Thermoscientific, Vilnius, Lithuania). Primers used for multiplex PCR amplification of mcr genes in this study are displayed in Table 1.
Each PCR reaction was carried out in 25 μL mixtures containing 12.5 µL DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 5.5 µL of deionized water, 0.5 µL of each of each primer (10 µM), and 2 µL DNA template. The PCR amplification steps consist of one cycle of denaturation at 94 °C for 5 min; 25 cycles at 94 °C for 30 s, 58 °C for 90 s, and 72 °C for 1 min; and a final extension at 72 °C for 10 min. The amplified PCR product was separated on a 1.5% agarose gel at 75 V in an electrophoresis system (BioRad Laboratories, Hercules, CA, USA) and visualized under ultraviolet light using a BioRad Molecular Imager® GelDocTM XR (BioRad Laboratories, Hercules, CA, USA).
Colitin-resistant E. coli isolates capable of producing ESBL were screened for the presence of genes encoding extended-spectrum β-lactamases (ESBL genes) by the multiplex PCR following the method previously described by [37]. The primer pairs used for the detection of ESBL genes are listed in Table 2. The multiplex PCR amplification was carried out under the following conditions: denaturation phase at 95 °C/5 min; 25 cycles with denaturation at 95 °C/30 s, annealing at 60 °C/90 s, extension at 72 °C/90 s followed by a final extension at 68 °C for 10 min. The PCR product was then visualized according to the procedure mentioned above.
For further analysis, PCR amplicons of blaCTX-M-1 group, and mcr-1 genes were generated and sequenced by the Sanger method using an Applied Biosystems 3500 genetic analyzer (ABI 3500, Applied Biosystems, Foster City, CA, USA). The open reading frames (ORFs) were predicted and annotated using the BLASTP version 2.15.0 [38] and Resfinder-3.1 server [39].

3. Results

3.1. Prevalence of COE in Raw Beef and Cow Feces

The results of isolation and identification showed that 16 (16%) out of 100 raw beef samples and 32 (32%) out of 100 cow feces samples were positive for COE. To avoid duplication, only one COE strain from each positive sample was isolated and preserved at −86 °C. A total of 48 isolates, including 16 from raw beef and 32 from cow feces, were subjected to the antimicrobial susceptibility test.

3.2. Antimicrobial Susceptibility Profile of COE Isolates

The antimicrobial susceptibility of COE isolates is presented in Table 3. COE isolates from raw beef were highly (93.75–100%) resistant to trimethoprim/sulfamethoxazole, tetracycline, florfenicol, and nalidixic acid, followed by ampicillin, streptomycin, gentamicin, and ciprofloxacin with resistance rates ranging from 62.5–87.5%. Lower resistance rates were observed with cefotaxime, ceftazidime, cefepime, and azithromycin, which had the same rate of 37.5%. None of the COE isolates from raw beef were resistant to cefoxitin and meropenem.
Overall, resistance rates of COE isolates from cow feces to antibiotic tested were lower than those from raw beef. However, the resistance trends of COE isolates from raw beef and cow feces were relatively similar. The highest resistance levels of COE isolates from cow feces were recorded with ampicillin (87.5%), tetracycline (75%), streptomycin (65.63%), florfenicol (62.5%), and trimethoprim/sulfamethoxazole (59.38%). On the contrary, only 3.13% (1/32) of the isolates were resistant to cefoxitin and azithromycin, and no resistance to meropenem was detected.
The results of the ESBL test revealed that 16 (33.33%) of 48 COE isolates were ESBL producers, corresponding to 8% (16/200) of the samples tested. Among these 16 isolates, 10 (31.25%; 10/32) strains were recovered from cow feces samples and 6 (37.5%; 6/16) from raw beef samples. All COE isolates capable of producing ESBL were subjected to multiplex PCR for the detection of ESBL genes.
The findings in Table 4 revealed that all COE isolates from raw beef samples were resistant to at least five antibiotics. Moreover, 68.75% (11/16) and 31.25% (5/16) of them showed resistance to 5–10 and 11–15 antibiotics tested, respectively. Regarding COE isolates from cow feces, resistant rates to 1, 1–5, 6–10, and 11–15 antibiotics tested were 100%, 28.13% (9/32), 59.38% (19/32), and 12.5% (4/32), respectively. MDR rates of COE isolates from raw beef and cow feces samples were 100% and 81.25%, respectively.
Antibiotic resistance patterns of COE isolates are shown in Table 4. COE isolates from raw beef and cow feces samples exhibited 11 and 17 antibiotic resistance patterns, respectively. The predominant resistance pattern for COE isolates from raw beef was AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP (3 isolates; 18.75%). Meanwhile, AMP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP was most common in COE isolates from cow feces (6 isolates; 18.75%) (Table 4).

3.3. Detection of mcr Genes and ESBL Genes

The result of multiplex PCR showed that 48 (100%) COE isolates in this study harbored the mcr-1 gene. Among them, 16 isolates were also found to carry the blaCTX-M-1 gene in addition to the mcr-1 gene. Further molecular characterization by sequencing indicated that the genotype of blaCTX-M-1 was blaCTX-M-55 (Table 5). Six COE isolates co-harboring mcr-1 and blaCTX-M-55 from raw beef were resistant to 10–13 antibiotics tested. While 10 mcr-1 and blaCTX-M-55 positive COE isolates from cow feces exhibited resistance to 6–14 antibiotics tested (Table 5).

4. Discussion

The results of our study showed that the prevalence of COE in raw beef and cow feces in Vietnam was 16% and 32%, respectively. These results correlate with a previous study using the same methodological approach that reported that 10% of imported beef was positive for COE [40]. The prevalence of COE in raw beef in this study is higher than in a previous study conducted by Johura et al. (2020) in Egypt [21]. Out of 150 raw beef samples collected in Mansoura city, Egypt, five samples were positive for COE, representing 3.33%. In a study performed in Italia, a total of 17 E. coli strains were isolated from 133 beef samples, but none of them were identified as COE [23]. It is worth mentioning that in our study, selective agar (MacConkey supplemented with 2 mg/mL colistin) was used for the isolation of COE, while in the studies from Egypt and Italia, COE isolates were identified from randomly selected E. coli isolates from non-selective agar. One of the main advantages of using selective agar for the isolation of COE is the high sensitivity, which means that COE can be recovered even in samples with a low proportion of COE in the total E. coli flora, thereby avoiding an underestimation of COE prevalence. This could be one of the reasons for the higher prevalence of COE in raw beef found in this study compared to previous studies. In Vietnam, the prevalence of COE has been recently reported in pork (40%), chicken meat (66%), pig (45.7%) and humans (23.3%) [41,42]. To the best of our knowledge, this is the first report on the prevalence of COE in raw beef and cow feces in Vietnam. Another factor contributing to the variation in COE prevalence is the different geographical locations.
Previous studies have shown that the prevalence of COE in food and food-producing animals was higher in Asia, Africa and especially Latin America than in Europe and North America [11]. This may be attributed to the widespread use of colistin in animal husbandry for disease treatment, prevention, and growth promotion in developing countries in Asia, Africa and Latin America [18,21,43]. For instance, in Vietnam, colistin is reportedly the most widely used antibiotic in the chicken and pig industries [18]. In contrast, the EU has banned the use of colistin as an animal growth promoter [44], while in the United States, colistin is not permitted for use in food-producing animals [45]. Overall, the relatively high prevalence of COE observed in raw beef and cow feces in this study underscores the importance of implementing a monitoring program for antibiotic usage and antibiotic susceptibility of bacteria in food and livestock in Vietnam.
As colistin is considered to be the last-resort antimicrobial for the treatment of multidrug-resistant Gram-negative bacteria, including carbapenem-resistant pathogens, the potential transmission of COE from animals to humans through the food chain has become one of the major concerns for human health [11,46]. Furthermore, if COE isolates harbor mobile colistin-resistant genes in transmissible plasmids, they can horizontally transfer these resistance genes to other bacteria, especially pathogenic strains, leading to an even more worrisome scenario [47]. In this study, all COE isolates from raw beef and cow feces were found to carry the mcr-1 gene. Similar results were also recently observed in previous studies showing that mcr-1 is frequently detected in COE isolates from food and food-producing animals [21,22,48]. The widespread distribution of mcr-1 is attributed to the fact that mcr-1 is located on transferable plasmids that can move horizontally between different bacterial species. In addition, previous studies have reported that mcr-1 can be mobilized with other mobile genetic elements, such as transposons and integrons [48]
The co-existence of mcr-1 and ESBL genes, especially in Gram-negative bacteria such as E. coli, is a serious public health concern as it may lead to the limitation of therapeutic options [21,49]. In this study, 16 (33.33%; 16/48) COE isolates co-carrying mcr-1 and blaCTX-M-55 gene, including 6 isolates originating from raw beef samples and 10 isolates from cow feces samples, were isolated for the first time in Vietnam, and all (100%, 16/16) of them were determined to be multidrug-resistant strains. Among them, nine isolates exhibited resistance to 12 out of 15 antibiotics tested. In particular, one isolate from cow feces was only susceptible to meropenem. These findings in this study are consistent with previous studies reporting a high prevalence of MDR among COE isolates [40,42,50] and the co-existence of mcr-1 and blaCTX-M gene in COE isolates. When characterizing 54 COE isolates co-harboring mcr-1 and ESBL genes of chicken origin, Shafiq et al. (2021) found that the combination of mcr-1 and blaCTX-M-55 was the most common genotype pattern [48]. In a study conducted in Egypt, 0.95% (2/210) of COE isolates from raw beef and read-to-eat beef products simultaneously carried mcr-1 and blaCTX-M-28 [21]. The concurrent carriage of mcr-1 and blaCTX-M genes has also been described by Joshi et al., who reported that 3 out of 27 COE isolates from chicken in Napal simultaneously harbored both genes [51]. Similarly, a local survey in South America showed that 14.6% (6/41) of chicken meat samples were contaminated with COE harboring mcr-1 along with blaCTX-M-2 or blaCTX-M-8 [52]. Also, a recent study on the epidemiology of mcr genes in Enterobacteriaceae isolated from pigs and humans on farms in Thailand found that blaCTX-M-14 and blaCTX-M-55 were the predominant genes co-existing with mcr genes in COE isolates [50]. Until now, the mechanism behind the co-occurrence of mcr-1 and ESBL genes in E. coli isolates has not been fully understood. The discovery of an IncHI2-type plasmid capable of concurrently carrying the mcr-1 gene and blaCTX-M-1 has partly elucidated the genetic mechanism [53]. The emergence of COE harboring both mcr-1 and blaCTX-M-55 observed in this study may be due to the overuse and misuse of colistin and cephalosporins alone or in combination in livestock in Vietnam as previous reports have highlighted colistin and cephalosporins (cefotaxime and ceftiofur) were the most commonly used antibiotics for animal husbandry in Vietnam [13,18,54]. In addition, a study conducted by Cuong et al. (2016) in Vietnam revealed that 21.5% and 5.4% of pig and chicken feed contained at least two antibiotics, respectively [13].

5. Conclusions

The findings in our study showed a relatively high prevalence of COE in raw beef and cow feces in Hanoi, Vietnam. Out of 48 COE isolates, 87.5% were identified as MDR strains. All COE isolates were found to carry the mcr-1 gene, with 33.33% also harboring the blaCTX-M-55 gene. The presence of these isolates in the food chain (raw beef and cow feces) in Vietnam may pose a significant threat to animal and human health, indicating the necessity for future investigation and intervention measures.

Author Contributions

Conceptualization, H.M.D.; methodology, H.M.D.; software, H.M.D., validation, H.M.D. and H.M.S.; formal analysis, H.M.D., investigation, H.M.D. and H.M.S. resources, H.M.D.; data curation, H.M.D. and T.T.K.H.; writing—original draft preparation, H.M.D.; writing—review and editing, N.V.T., H.M.S. and T.T.K.H.; visualization, H.M.D.; supervision, H.M.D.; project administration, H.M.D. and H.M.S.; funding acquisition, H.M.D. and N.V.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors are grateful for the support of the Vietnam National University of Agriculture (VNUA).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, R.Q.; Ying, G.G.; Su, H.C.; Zhou, L.J.; Liu, Y.S. Antibiotic Resistance and Genetic Diversity of Escherichia Coli Isolates from Traditional and Integrated Aquaculture in South China. J. Environ. Sci. Health B 2013, 48, 999–1013. [Google Scholar] [CrossRef] [PubMed]
  2. Skočková, A.; Koláčková, I.; Bogdanovičová, K.; Karpíšková, R. Characteristic and Antimicrobial Resistance in Escherichia Coli from Retail Meats Purchased in the Czech Republic. Food Control 2015, 47, 401–406. [Google Scholar] [CrossRef]
  3. Khan, F.M.; Gupta, R. Escherichia Coli (E. Coli) as an Indicator of Fecal Contamination in Groundwater: A Review. In Sustainable Development of Water and Environment: Proceedings of the ICSDWE2020, Incheon, Republic of Korea, 13–14 January 2020; Jeon, H.-Y., Ed.; Springer International Publishing: Cham, Switzerland, 2020; pp. 225–235. [Google Scholar]
  4. Burow, E.; Rostalski, A.; Harlizius, J.; Gangl, A.; Simoneit, C.; Grobbel, M.; Kollas, C.; Tenhagen, B.A.; Käsbohrer, A. Antibiotic Resistance in Escherichia Coli from Pigs from Birth to Slaughter and Its Association with Antibiotic Treatment. Prev. Vet. Med. 2019, 165, 52–62. [Google Scholar] [CrossRef] [PubMed]
  5. Puangseree, J.; Prathan, R.; Srisanga, S.; Angkittitrakul, S.; Chuanchuen, R. Plasmid Profile Analysis of Escherichia Coli and Salmonella Enterica Isolated from Pigs, Pork and Humans. Epidemiol. Infect. 2022, 150, e110. [Google Scholar] [CrossRef]
  6. Ma, F.; Xu, S.; Tang, Z.; Li, Z.; Zhang, L. Use of Antimicrobials in Food Animals and Impact of Transmission of Antimicrobial Resistance on Humans. Biosaf. Health 2021, 3, 32–38. [Google Scholar] [CrossRef]
  7. EFSA. Scientific Opinion on the Public Health Risks of Bacterial Strains Producing Extended-Spectrum β-Lactamases and/or AmpC β-Lactamases in Food and Food-Producing Animals. EFSA J. 2011, 9. [Google Scholar] [CrossRef]
  8. EFSA. The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria from Humans, Animals and Food in 2020/2021. EFSA J. 2023, 21, e07867. [Google Scholar] [CrossRef]
  9. EFSA. The European Union Summary Report on Antimicrobial Resistance in Zoonotic and Indicator Bacteria from Humans, Animals and Food in 2018/2019. EFSA J. 2021, 19, e06490. [Google Scholar] [CrossRef]
  10. WHO. Antimicrobial Resistance; WHO: Geneva, Switzerland, 2021. [Google Scholar]
  11. Lencina, F.A.; Bertona, M.; Stegmayer, M.A.; Olivero, C.R.; Frizzo, L.S.; Zimmermann, J.A.; Signorini, M.L.; Soto, L.P.; Zbrun, M.V. Prevalence of Colistin-Resistant Escherichia Coli in Foods and Food-Producing Animals through the Food Chain: A Worldwide Systematic Review and Meta-Analysis. Heliyon 2024, 10, e26579. [Google Scholar] [CrossRef] [PubMed]
  12. O’Neill, J. Antimicrobial Resistance: Tackling a Crisis for the Health and Wealth of Nations; Review on Antimicrobial Resistance, Chaired by Jim O’Neill, December 2014. Rev. Antimicrob. Resist. 2016. Available online: https://www.who.int/news/item/29-04-2019-new-report-calls-for-urgent-action-to-avert-antimicrobial-resistance-crisis (accessed on 25 January 2024).
  13. Van Cuong, N.; Nhung, N.T.; Nghia, N.H.; Mai Hoa, N.T.; Trung, N.V.; Thwaites, G.; Carrique-Mas, J. Antimicrobial Consumption in Medicated Feeds in Vietnamese Pig and Poultry Production. Ecohealth 2016, 13, 490–498. [Google Scholar] [CrossRef] [PubMed]
  14. Of, R.; Cid, A.-I.A. Colistin: The Revival of Polymyxins for the Management of Multidrug-Resistant Gram-Negative Bacterial Infections. Clin. Infect. Dis. 2005, 40, 1333–1341. [Google Scholar]
  15. de Alcântara Rodrigues, I.; Ferrari, R.G.; Panzenhagen, P.H.N.; Mano, S.B.; Conte-Junior, C.A. Antimicrobial Resistance Genes in Bacteria from Animal-Based Foods. In Advances in Applied Microbiology; Academic Press: Cambridge, MA, USA, 2020; Volume 112. [Google Scholar]
  16. Catry, B.; Cavaleri, M.; Baptiste, K.; Grave, K.; Grein, K.; Holm, A.; Jukes, H.; Liebana, E.; Navas, A.L.; Mackay, D.; et al. Use of Colistin-Containing Products within the European Union and European Economic Area (EU/EEA): Development of Resistance in Animals and Possible Impact on Human and Animal Health. Int. J. Antimicrob. Agents 2015, 46, 297–306. [Google Scholar] [CrossRef] [PubMed]
  17. Vidovic, N.; Vidovic, S. Antimicrobial Resistance and Food Animals: Influence of Livestock Environment on the Emergence and Dissemination of Antimicrobial Resistance. Antibiotics 2020, 9, 52. [Google Scholar] [CrossRef] [PubMed]
  18. Di, K.N.; Pham, D.T.; Tee, T.S.; Binh, Q.A.; Nguyen, T.C. Antibiotic Usage and Resistance in Animal Production in Vietnam: A Review of Existing Literature. Trop. Anim. Health Prod. 2021, 53, 340. [Google Scholar] [CrossRef] [PubMed]
  19. Chopjitt, P.; Boueroy, P.; Morita, M.; Iida, T.; Akeda, Y.; Hamada, S.; Kerdsin, A. Genetic Characterization of Multidrug-Resistant Escherichia Coli Harboring Colistin-Resistant Gene Isolated from Food Animals in Food Supply Chain. Front. Cell Infect. Microbiol. 2024, 14, 1289134. [Google Scholar] [CrossRef] [PubMed]
  20. Johura, F.T.; Tasnim, J.; Barman, I.; Biswas, S.R.; Jubyda, F.T.; Sultana, M.; George, C.M.; Camilli, A.; Seed, K.D.; Ahmed, N.; et al. Colistin-Resistant Escherichia Coli Carrying Mcr-1 in Food, Water, Hand Rinse, and Healthy Human Gut in Bangladesh. Gut Pathog. 2020, 12, 5. [Google Scholar] [CrossRef] [PubMed]
  21. Sabala, R.F.; Usui, M.; Tamura, Y.; Abd-Elghany, S.M.; Sallam, K.I.; Elgazzar, M.M. Prevalence of Colistin-Resistant Escherichia Coli Harbouring Mcr-1 in Raw Beef and Ready-to-Eat Beef Products in Egypt. Food Control 2021, 119, 107436. [Google Scholar] [CrossRef]
  22. Bastidas-Caldes, C.; de Waard, J.H.; Salgado, M.S.; Villacís, M.J.; Coral-Almeida, M.; Yamamoto, Y.; Calvopiña, M. Worldwide Prevalence of Mcr-Mediated Colistin-Resistance Escherichia Coli in Isolates of Clinical Samples, Healthy Humans, and Livestock—A Systematic Review and Meta-Analysis. Pathogens 2022, 11, 659. [Google Scholar] [CrossRef]
  23. Nobili, G.; La Bella, G.; Basanisi, M.G.; Damato, A.M.; Coppola, R.; Migliorelli, R.; Rondinone, V.; Leekitcharoenphon, P.; Bortolaia, V.; La Salandra, G. Occurrence and Characterisation of Colistin-Resistant Escherichia Coli in Raw Meat in Southern Italy in 2018–2020. Microorganisms 2022, 10, 1805. [Google Scholar] [CrossRef]
  24. Gelalcha, B.D.; Kerro Dego, O. Extended-Spectrum Beta-Lactamases Producing Enterobacteriaceae in the USA Dairy Cattle Farms and Implications for Public Health. Antibiotics 2022, 11, 1313. [Google Scholar] [CrossRef] [PubMed]
  25. Tian, T.; Dai, S.; Liu, D.; Wang, Y.; Qiao, W.; Yang, M.; Zhang, Y. Occurrence and Transfer Characteristics of BlaCTX-M Genes among Escherichia Coli in Anaerobic Digestion Systems Treating Swine Waste. Sci. Total Environ. 2022, 834, 155321. [Google Scholar] [CrossRef] [PubMed]
  26. Rawat, D.; Nair, D. Extended-Spectrum ß-Lactamases in Gram Negative Bacteria. J. Glob. Infect. Dis. 2010, 2, 263–274. [Google Scholar] [CrossRef] [PubMed]
  27. Husna, A.; Rahman, M.M.; Badruzzaman, A.T.M.; Sikder, M.H.; Islam, M.R.; Rahman, M.T.; Alam, J.; Ashour, H.M. Extended-Spectrum β-Lactamases (ESBL): Challenges and Opportunities. Biomedicines 2023, 11, 2937. [Google Scholar] [CrossRef] [PubMed]
  28. Shi, X.; Li, Y.; Yang, Y.; Shen, Z.; Cai, C.; Wang, Y.; Walsh, T.R.; Shen, J.; Wu, Y.; Wang, S. High Prevalence and Persistence of Carbapenem and Colistin Resistance in Livestock Farm Environments in China. J. Hazard. Mater. 2021, 406, 124298. [Google Scholar] [CrossRef]
  29. Zhao, X.; Zhao, H.; Zhou, Z.; Miao, Y.; Li, R.; Yang, B.; Cao, C.; Xiao, S.; Wang, X.; Liu, H.; et al. Characterization of Extended-Spectrum β-Lactamase-Producing Escherichia Coli Isolates That Cause Diarrhea in Sheep in Northwest China. Microbiol. Spectr. 2022, 10, e0159522. [Google Scholar] [CrossRef]
  30. D’Andrea, M.M.; Arena, F.; Pallecchi, L.; Rossolini, G.M. CTX-M-Type β-Lactamases: A Successful Story of Antibiotic Resistance. Int. J. Med. Microbiol. 2013, 303, 305–317. [Google Scholar] [CrossRef] [PubMed]
  31. Haenni, M.; Poirel, L.; Kieffer, N.; Châtre, P.; Saras, E.; Métayer, V.; Dumoulin, R.; Nordmann, P.; Madec, J.Y. Co-Occurrence of Extended Spectrum β Lactamase and MCR-1 Encoding Genes on Plasmids. Lancet Infect. Dis. 2016, 16, 281–282. [Google Scholar] [CrossRef] [PubMed]
  32. Li, Q.; Wang, H.; Xu, Y.; Bai, X.; Wang, J.; Zhang, Z.; Liu, X.; Miao, Y.; Zhang, L.; Li, X.; et al. Multidrug-Resistant Escherichia Albertii: Co-Occurrence of β-Lactamase and MCR-1 Encoding Genes. Front. Microbiol. 2018, 9, 258. [Google Scholar] [CrossRef]
  33. USDA. Report Name: Beef Market Overview—Tariff Disadvantages Undercut US Opportunities in Growing Market for Imported Beef. Available online: https://apps.fas.usda.gov/newgainapi/api/Report/DownloadReportByFileName?fileName=Beef%20Market%20Overview%20-%20Tariff%20Disadvantages%20Undercut%20US%20Opportunities%20in%20Growing%20Market%20for%20Imported%20Beef%20_Ho%20Chi%20Minh%20City_Vietnam_VM2023-0066.pdf (accessed on 18 June 2024).
  34. M100; Performance Standards for Antimicrobial Susceptibility Testing. CLSI Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2018.
  35. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for Detection of Plasmid-Mediated Colistin Resistance Determinants, Mcr-1, Mcr-2, Mcr-3, Mcr-4 and Mcr-5 for Surveillance Purposes. Eurosurveillance 2018, 23, 17-00672. [Google Scholar] [CrossRef]
  36. Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a Novel Transposon-Associated Phosphoethanolamine Transferase Gene, Mcr-5, Conferring Colistin Resistance in d-Tartrate Fermenting Salmonella Enterica Subsp. Enterica Serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef] [PubMed]
  37. Nguyen, D.T.A.; Kanki, M.; Nguyen, P.D.; Le, H.T.; Ngo, P.T.; Tran, D.N.M.; Le, N.H.; Dang, C.V.; Kawai, T.; Kawahara, R.; et al. Prevalence, Antibiotic Resistance, and Extended-Spectrum and AmpC β-Lactamase Productivity of Salmonella Isolates from Raw Meat and Seafood Samples in Ho Chi Minh City, Vietnam. Int. J. Food Microbiol. 2016, 236, 115–122. [Google Scholar] [CrossRef] [PubMed]
  38. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed]
  39. Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of Acquired Antimicrobial Resistance Genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef] [PubMed]
  40. Sismova, P.; Sukkar, I.; Kolidentsev, N.; Palkovicova, J.; Chytilova, I.; Bardon, J.; Dolejska, M.; Nesporova, K. Plasmid-Mediated Colistin Resistance from Fresh Meat and Slaughtered Animals in the Czech Republic: Nation-Wide Surveillance 2020–2021. Microbiol. Spectr. 2023, 11, e0060923. [Google Scholar] [CrossRef] [PubMed]
  41. Nguyen, T.N.; Khong, D.T.; Le, H.V.; Tran, H.T.; Phan, Q.N.; Le, H.T.T.; Kawahara, R.; Yamamoto, Y. Quantitative Analysis of Colistin-Resistant Escherichia Coli in Retail Meat from Local Vietnamese Markets. Biomed. Res. Int. 2021, 2021, 6678901. [Google Scholar] [CrossRef] [PubMed]
  42. Dang, S.T.T.; Truong, D.T.Q.; Olsen, J.E.; Tran, N.T.; Truong, G.T.H.; Vu, H.T.K.; Dalsgaard, A. Research Note: Occurrence of Mcr- Encoded Colistin Resistance in Escherichia Coli from Pigs and Pig Farm Workers in Vietnam. FEMS Microbes 2021, 1, 1–6. [Google Scholar] [CrossRef]
  43. Ahmed, S.; Das, T.; Islam, M.Z.; Herrero-Fresno, A.; Biswas, P.K.; Olsen, J.E. High Prevalence of Mcr-1-Encoded Colistin Resistance in Commensal Escherichia Coli from Broiler Chicken in Bangladesh. Sci. Rep. 2020, 10, 18637. [Google Scholar] [CrossRef] [PubMed]
  44. Maron, D.F.; Smith, T.J.S.; Nachman, K.E. Restrictions on Antimicrobial Use in Food Animal Production: An International Regulatory and Economic Survey. Glob. Health 2013, 9, 48. [Google Scholar] [CrossRef]
  45. Wang, Y.; Hou, N.; Johnston, J.; Sarreal, C.; Jarosh, J.; Hughes, A.C.; Gu, Y.; He, X. Low Prevalence of Mobile Colistin-Resistance in U.S. Meat, Catfish, Poultry and Genomic Characterization of a Mcr-1 Positive Escherichia Coli Strain. Food Control 2020, 118, 107434. [Google Scholar] [CrossRef]
  46. Kurekci, C.; Aydin, M.; Nalbantoglu, O.U.; Gundogdu, A. First Report of Escherichia Coli Carrying the Mobile Colistin Resistance Gene Mcr-1 in Turkey. J. Glob. Antimicrob. Resist. 2018, 15, 169–170. [Google Scholar] [CrossRef] [PubMed]
  47. EFSA. Foodborne Antimicrobial Resistance as a Biological Hazard—Scientific Opinion of the Panel on Biological Hazards. EFSA J. 2008, 6, 765–852. [Google Scholar] [CrossRef]
  48. Shafiq, M.; Huang, J.; Shah, J.M.; Ali, I.; Rahman, S.U.; Wang, L. Characterization and Resistant Determinants Linked to Mobile Elements of ESBL-Producing and Mcr-1-Positive Escherichia Coli Recovered from the Chicken Origin. Microb. Pathog. 2021, 150, 104722. [Google Scholar] [CrossRef] [PubMed]
  49. Pitout, J.D.; Laupland, K.B. Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae: An Emerging Public-Health Concern. Lancet Infect. Dis. 2008, 8, 159–166. [Google Scholar] [CrossRef] [PubMed]
  50. Leangapichart, T.; Stosic, M.S.; Hickman, R.A.; Lunha, K.; Jiwakanon, J.; Angkititrakul, S.; Magnusson, U.; Van Boeckel, T.P.; Järhult, J.D.; Sunde, M. Exploring the Epidemiology of Mcr Genes, Genetic Context and Plasmids in Enterobacteriaceae Originating from Pigs and Humans on Farms in Thailand. J. Antimicrob. Chemother. 2023, 78, 1395–1405. [Google Scholar] [CrossRef] [PubMed]
  51. Joshi, P.R.; Thummeepak, R.; Paudel, S.; Acharya, M.; Pradhan, S.; Banjara, M.R.; Leungtongkam, U.; Sitthisak, S. Molecular Characterization of Colistin-Resistant Escherichia Coli Isolated from Chickens: First Report from Nepal. Microb. Drug Resist. 2019, 25, 846–854. [Google Scholar] [CrossRef] [PubMed]
  52. Monte, D.F.; Mem, A.; Fernandes, M.R.; Cerdeira, L.; Esposito, F.; Galvão, J.A.; Franco, B.D.G.M.; Lincopan, N.; Landgraf, M. Chicken Meat as a Reservoir of Colistin-Resistant Escherichia Coli Strains Carrying Mcr-1 Genes in South America. Antimicrob. Agents Chemother. 2017, 61, e02718-16. [Google Scholar] [CrossRef] [PubMed]
  53. Sun, J.; Yang, R.S.; Zhang, Q.; Feng, Y.; Fang, L.X.; Xia, J.; Li, L.; Lv, X.Y.; Duan, J.H.; Liao, X.P.; et al. Co-Transfer of BlaNDM-5 and Mcr-1 by an IncX3-X4 Hybrid Plasmid in Escherichia Coli. Nat. Microbiol. 2016, 1, 16176. [Google Scholar] [CrossRef]
  54. Carrique-Mas, J.J.; Trung, N.V.; Hoa, N.T.; Mai, H.H.; Thanh, T.H.; Campbell, J.I.; Wagenaar, J.A.; Hardon, A.; Hieu, T.Q.; Schultsz, C. Antimicrobial Usage in Chicken Production in the Mekong Delta of Vietnam. Zoonoses Public Health 2015, 62, 70–78. [Google Scholar] [CrossRef]
Table 1. Primer sequences for the detection of mcr genes.
Table 1. Primer sequences for the detection of mcr genes.
Target GenePrimerPrimer SequenceAmplicon Size (bp)Reference
mcr-1mcr1 fAGTCCGTTTGTTCTTGTGGC320[35]
mcr1 rAGATCCTTGGTCTCGGCTTG
mcr-2mcr2 fCAAGTGTGTTGGTCGCAGTT715[35]
mcr2 rTCTAGCCCGACAAGCATACC
mcr-3mcr3 fAAATAAAAATTGTTCCGCTTATG929[35]
mcr3 rAATGGAGATCCCCGTTTTT
mcr-4mcr4 fTCACTTTCATCACTGCGTTG1116[35]
mcr4 rTTGGTCCATGACTACCAATG
mcr-5mcr5 fATGCGGTTGTCTGCATTTATC1644[36]
mcr5 rTCATTGTGGTTGTCCTTTTCTG
Table 2. Primer sequences for the detection of ESBL genes.
Table 2. Primer sequences for the detection of ESBL genes.
Target GenePrimerPrimer SequenceAmplicon Size (bp)
blaTEMTEM-FGGTCGCCGCATACACTATTCTC372
TEM-RTTTTATCCGCCTCCATCCAGTC
blaSHVSHV-FCCAGCAGGATCTGGTGGACTAC231
SHV-RCCGGGAAGCGCCCTCCAT
blaCTX-M-1CTX-M1-FGAATTAGAGCGGGAGTCGGG588
CTX-M1-RCACAACCCAGGAAGCAGGC
blaCTX-M-2CTX-M2-FGATGGCGACGCTACCCC107
CTX-M2-RCAAGCCGACCTCCCGAAC
blaCTX-M-9CTX-M9-FGTGCAACGGATGATGTTCGC475
CTX-M9-RGAAACGTCTCATCGCCGATC
blaCTX-M-8/25CTX-M8/25-FGCGACCCGCGCGATAC186
CTX-M8/25-RTGCCGGTTTTATCCCCG
Table 3. Antimicrobial resistance profile of COE isolates.
Table 3. Antimicrobial resistance profile of COE isolates.
Antibiotic ClassAntibioticsCow Feces (n = 32)Raw Beef (n = 16)Total (n = 48)
No. Isolates%No. Isolates%No. Isolates%
Penicillinampicillin2887.51487.50 4287.5
Cephalosporinscefotaxime1031.25637.50 1633.33
cefoxitin13.1300.00 12.08
cefepime1031.25637.51633.33
ceftazidime1031.25637.51633.33
Cabarpenemsmeropenem0000.00 00
Tetracyclinestetracycline24751593.75 3981.25
Phenicolsflorfenicol2062.51593.75 3572.92
Polymyxinscolistin3210016100.00 48100
Sulfonamidestrimethoprim/sulfamethoxazole1959.3816100.00 3572.92
Quinolonesnalidixic acid1753.131593.753266.67
Fluoroquinolonesciprofloxacin1546.881062.52552.08
Aminoglycosidesgentamicin1753.131168.75 2858.33
streptomycin2165.631275.00 3368.75
Macrolidesazithromycin13.13637.50 714.58
Table 4. Antibiotic resistance patterns of COE isolates.
Table 4. Antibiotic resistance patterns of COE isolates.
No. of AntibioticsResistance PatternNo. of E. coli Isolates (%)
Cow FecesRaw BeefTotal
1CST3 (9.38)0 (0)3 (6.25)
2AMP-CST2 (6.25)0 (0)2 (4.17)
TET-CST1 (3.13)0 (0)1 (2.08)
3AMP-CST-NAL1 (3.13)0 (0)1 (2.08)
4AMP-CST-NAL-CIP2 (6.25)0 (0)2 (4.17)
5AMP-TET-FLO-CST-SXT0 (0)1 (6.25)1 (2.08)
6AMP-CTX-CAZ-FEP-TET-CST2 (6.25)0 (0)2 (4.17)
AMP-STR-TET-FLO-CST-SXT2 (6.25)0 (0)2 (4.17)
AMP-TET-FLO-CST-SXT-NAL0 (0)2 (12.5)2 (4.17)
AMP-STR-TET-CST-SXT-NAL0 (0)1 (6.25)1 (2.08)
7AMP-STR-TET-FLO-CST-SXT-CIP1 (3.13)0 (0)1 (2.08)
AMP-GEN-STR-TET-FLO-CST-SXT1 (3.13)0 (0)1 (2.08)
8AMP-GEN-STR-TET-FLO-CST-SXT-NAL2 (6.25)1 (6.25)3 (6.25)
AMP-STR-TET-FLO-CST-SXT-NAL-CIP1 (3.13)0 (0)1 (2.08)
GEN-STR-TET-FLO-CST-SXT-NAL-CIP0 (0)2 (12.5)2 (4.17)
9AMP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP6 (18.75)2 (12.5)8 (16.67)
AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST1 (3.13)0 (0)1 (2.08)
10AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT2 (6.25)0 (0)2 (4.17)
AMP-CTX-CAZ-FEP-GEN-STR-TET-CST-NAL-CIP1 (3.13)0 (0)1 (2.08)
AMP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP0 (0)1 (6.25)1 (2.08)
AMP-CTX-CAZ-FEP-GEN-FLO-CST-SXT-NAL-CIP0 (0)1 (6.25)1 (2.08)
12AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP3 (9.38)0 (0)3 (6.25)
AMP-CTX-CAZ-FEP-STR-AZM-TET-FLO-CST-SXT-NAL-CIP0 (0)1 (6.25)1 (2.08)
AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL0 (0)1 (6.25)1 (2.08)
13AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP0 (0)3 (18.75)3 (6.25)
14AMP-CTX-FOX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP1 (3.13)0 (0)1 (2.08)
AMP—ampicillin; CTX—cefotaxime; FOX—cefoxitin; FEP—cefepime; CAZ—ceftazidime; TET—tetracycline; STR—streptomycin; GEN—gentamicin; AZM—azithromycin; FLO—florfenicol; SXT—Trimethoprim/sulfamethoxazole; CIP—ciprofloxacin; NAL—nalidixic acid; CST—colistin.
Table 5. Phenotypic and genotypic antibiotic resistance of COE isolates capable of producing ESBL.
Table 5. Phenotypic and genotypic antibiotic resistance of COE isolates capable of producing ESBL.
SourceStrain IDESBL Genemcr GeneResistance Phenotype
Cow fecesEPBC3blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT
EPBC5blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-TET-CST
EPBC7blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP
EPBC10blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP
EPBC19blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT
EPBC20blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST
EPBC22blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-FLO-CST-SXT-NAL-CIP
EPBC24blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-TET-CST
EPBC26blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-TET-CST-NAL-CIP
EPBC31blaCTX-M-55mcr-1AMP-CTX-FOX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP
Raw beefETBC12blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-STR-AZM-TET-FLO-CST-SXT-NAL-CIP
ETBC15blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP
ETBC18blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP
ETBC19blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL-CIP
ETBC22blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-STR-AZM-TET-FLO-CST-SXT-NAL
ETBC23blaCTX-M-55mcr-1AMP-CTX-CAZ-FEP-GEN-FLO-CST-SXT-NAL-CIP
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Duc, H.M.; Hoa, T.T.K.; Thang, N.V.; Son, H.M. First Report on the Occurrence and Antibiotic Resistance Profile of Colistin-Resistant Escherichia coli in Raw Beef and Cow Feces in Vietnam. Microorganisms 2024, 12, 1305. https://doi.org/10.3390/microorganisms12071305

AMA Style

Duc HM, Hoa TTK, Thang NV, Son HM. First Report on the Occurrence and Antibiotic Resistance Profile of Colistin-Resistant Escherichia coli in Raw Beef and Cow Feces in Vietnam. Microorganisms. 2024; 12(7):1305. https://doi.org/10.3390/microorganisms12071305

Chicago/Turabian Style

Duc, Hoang Minh, Tran Thi Khanh Hoa, Nguyen Van Thang, and Hoang Minh Son. 2024. "First Report on the Occurrence and Antibiotic Resistance Profile of Colistin-Resistant Escherichia coli in Raw Beef and Cow Feces in Vietnam" Microorganisms 12, no. 7: 1305. https://doi.org/10.3390/microorganisms12071305

APA Style

Duc, H. M., Hoa, T. T. K., Thang, N. V., & Son, H. M. (2024). First Report on the Occurrence and Antibiotic Resistance Profile of Colistin-Resistant Escherichia coli in Raw Beef and Cow Feces in Vietnam. Microorganisms, 12(7), 1305. https://doi.org/10.3390/microorganisms12071305

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop