Next Article in Journal
Microbiota Involved in the Degradation of Tremella fuciformis Polysaccharide and Microbial Enzymatic Potential Revealed by Microbiome and Metagenome
Previous Article in Journal
Identification, Genome Characterization, and Growth Optimization of Paenibacillus Peoriae MHJL1 for Biocontrol and Growth Promotion of Cotton Seedlings
Previous Article in Special Issue
Toxoplasma gondii and Rabies—The Parasite, the Virus, or Both?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 2
10.3390/microorganisms13020262
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of Skunks in the Epidemiology of Rabies in the State of Yucatan from 2000 to 2022: Current Perspectives and Future Research Directions

by
Paola Puebla-Rodríguez
1,2,
Octavio Patricio García-González
3,
Rocío Sánchez-Sánchez
3,
Mauricio Díaz-Sánchez
3,
Juan Carlos Del Mazo
1,
Isaías Sauri-González
4,
Adriana Alonzo-Góngora
4,
Gabriel García-Rodríguez
5,
Irma López-Martínez
1 and
Nidia Aréchiga-Ceballos
1,*
1
Instituto de Diagnóstico y Referencia Epidemiológicos, Dirección General de Epidemiología, Secretaría de Salud, Ciudad de México 01480, Mexico
2
Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de Mexico, Ciudad de México 14510, Mexico
3
Instituto Traslacional de Singularidad Genómica, Irapuato 36615, Mexico
4
Laboratorio Central Regional de Mérida, Comité Estatal para el Fomento y Protección Pecuaria del Estado de Yucatán S.C.P., Mérida 97130, Mexico
5
Dirección General de Epidemiología, Secretaría de Salud, Ciudad de México 01480, Mexico
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(2), 262; https://doi.org/10.3390/microorganisms13020262
Submission received: 8 November 2024 / Revised: 6 January 2025 / Accepted: 14 January 2025 / Published: 25 January 2025
(This article belongs to the Special Issue Rabies Virus: Infections, Reservoirs and Vectors)
Browse Figures
Versions Notes

Abstract

:
In 2019, the World Health Organization (WHO) and the Pan American Health Organization (PAHO) bestowed upon Mexico the status of a country free from canine-transmitted human rabies; however, the lingering public health challenge in the nation continues to be the sylvatic cycle of rabies. In Mexico, skunks play a significant role as reservoirs for four antigenic variants of the rabies virus. Nonetheless, up to this point, the specific skunk species involved in this cycle had not been accurately established. This study (2002–2022) aims to identify the taxonomy of skunk specimens diagnosed as rabies-positive in the state of Yucatan, in order to determine the species that serves as the reservoir for the Yucatan sylvatic lineage of rabies. This was achieved through the sequencing of an approximately 680 bp fragment of the mitochondrial gene cytochrome B. All samples belong to the species Spilogale angustifrons yucatanensis. This discovery offers valuable information for understanding and managing the wildlife rabies cycle in Mexico. It also contributes to an improved understanding of the taxonomy within the genus Spilogale.

1. Introduction

Rabies is caused by neurotropic viruses of the genus Lyssavirus in the family Rhabdoviridae. It is transmissible to all mammals and it is almost uniformly fatal [1]. Contact with infected saliva through a bite from a rabid animal is the main route of rabies virus (RABV) infection in humans [2], although it can also occur through contact with infected saliva in open wounds or mucous membranes [3].
Rabies remains a zoonosis of great public health importance, present in 150 countries and causing around 59,000 annual deaths, primarily in Asia and Africa, usually following bites from infected dogs [4]. Mexico successfully controlled human rabies transmitted by dogs in 2006, but the disease remains a challenge due to the presence of other wild mammals that can transmit it to humans and domestic animals [5,6,7]. A large part of Mexican biodiversity has a restricted distribution. Additionally, there is a high number of endemic species due to the diverse geography, climates and types of vegetation, which facilitate the species’ adaptation to specific environmental conditions [8,9].
It has been documented that several carnivore species could act as RABV transmitters and reservoirs, including striped skunks (Mephitis mephitis), spotted skunks (Spilogale putorius), hooded skunks (Mephitis macroura), hog-nosed skunks (Conepatus leuconotus) and gray foxes (Urocyon cinereoargenteus) [7,10,11,12,13].
To facilitate the understanding of the epidemiological scenario of rabies, two key concepts have been defined: “reservoir” and “vector”. A reservoir is a species that can maintain the rabies virus circulating in nature without the need for other host species and that preserves its own antigenic variant or genetic lineage. On the other hand, a vector is a host species that can transmit the virus but does not maintain it circulating independently in nature, and that is not associated with any specific variant or lineage [14].
Skunks, from the family Mephitidae, consist of four genera and 11 species that are globally recognized, characterized by anal odoriferous glands and black-and-white fur patterns [15,16,17]. The geographical distribution of skunk species is not well known, and there are few molecular identification studies [18]. They are almost exclusively found in the Americas, with three genera and nine species, ranging from Canada to Chile [16,19,20].
Skunks are recognized as major rabies transmitters in the United States of America (USA) and Mexico, but specimens sent to laboratories for diagnosis are often not correctly identified [7,21]. In Mexico, at least four rabies virus variants (RABVV) related to skunks have been identified (Figure 1). RABVV 10, restricted to Baja California Sur, has the skunk Spilogale putorius lucasana as its reservoir and is related to the California variant circulating in skunks, although recent studies show they belong to distinct evolutionary lineages [22,23]. In the north, the RABVV1 “atypical” skunk variant, originating from canids but maintained in skunk populations without species identification, has been reported.
In the states of Hidalgo, Jalisco, Nuevo Leon, San Luis Potosi, Tamaulipas, and Veracruz, RABVV8 has been isolated in spotted skunks (S. putorius) and striped skunks (Conepatus leuconotus) [12,23,24]. Unlike other variants, RABVV8 has a chiropteran origin, possibly from hematophagous bats [12,23,24]. However, the Yucatan sylvatic variant, described in 2017, so far, appears to be restricted to the state of Yucatan. This variant has been isolated in both domestic and wild animals such as dogs (Canis lupus familiaris), cats (Felis catus), white-nosed coatis (Nasua narica), and tepezcuintles (Cuniculus paca) [6,25,26]. The evidence suggests that skunks are the main reservoirs of this variant, although it has not been determined which of the two skunk species in Yucatan (Spilogale angustifrons or Conepatus semistriatus) is responsible for actively maintaining and transmitting this RABVV [25,27].
Due to their high susceptibility and long incubation periods, skunks are known for their role in rabies transmission to humans; however, specific knowledge about the reservoir species in Mexico is still lacking. In addition, some skunk species can live near urban areas, increasing the risk of transmission to human populations [7,11,28].
Mitochondrial DNA sequence analyses have shown that skunks form a monophyletic group within the Mephitidae family, which separated from musteloids before the emergence of the Procyonidae and Mustelidae families [29]. Among the 11 currently recognized skunk species, molecular studies have mainly focused on understanding relationships within genera, especially Conepatus [16,17,18]. Phylogenetic studies using cyt b nucleotide sequences revealed that Mephitis and Spilogale share a common ancestor, separating after Conepatus. These studies also provided insights into species relationships within Spilogale, such as S. gracilis vs. S. putorius [30]. Despite these findings, the phylogenetic relationships among these families remain uncertain, highlighting the need for further systematic studies [17].
The taxonomy of Spilogale has evolved and has been controversial due to the difficulty in distinguishing species based on external morphology. Initially, only two species were recognized, but taxonomic revisions increased this number to 14, with the currently accepted number being four [31,32,33]. These changes were based on cranio-dental features, pelage patterns, and geographic distribution, but the external morphology is highly conserved, complicating classical taxonomy [34,35].
Using DNA sequencing and phylogenetic analysis, molecular studies within Spilogale have focused on analyzing genetic diversity and evaluating phylogenetic subdivisions and subspecies boundaries [18,31,32,33].
One of the four Spilogale species, S. angustifrons, described in 1902, was excluded from valid species lists for about 90 years due to reliance on morphological characteristics. Its reinclusion took place in 1996 through molecular techniques, confirming its distinct status as S. angustifrons, and it is now recognized from central Mexico to Costa Rica [16,36,37,38].
A recent study by McDonough et al. (2022) presented evidence that the taxonomic diversity of Spilogale is more extensive than previously documented; it identified seven species instead of four [16,17]. The study confirmed the distribution of S. angustifrons in Mexico and proposed a new endemic species in Yucatan, Spilogale yucatanensis, previously considered a variant of S. angustifrons.
As mentioned above, the objective of this study was to standardize the PCR reactions for the molecular taxonomic identification of skunk specimens diagnosed as RABV-positive in Yucatan, to determine the skunk species that serves as the reservoir for the “Yucatan sylvatic” lineage. The standardization was performed on nervous tissue, which is a contribution to rabies virus surveillance, as no additional tissue is needed beyond that which is routinely received for rabies diagnosis.

2. Materials and Methods

2.1. Samples Selection

All brain tissues from rabies cases in skunks from Yucatan were obtained from the sample bank of the Rabies Laboratory at InDRE and the Merida Regional Central Laboratory from the State Committee for the Promotion and Protection of Livestock of the State of Yucatan from 2000 to 2023. As controls for the cyt b tests, skunks from the states of Chihuahua and Baja California Sur (BCS), were used. These regions were selected due to the absence of Yucatan skunk distribution, according to CONABIO acronym of Comisión Nacional para el Conocimiento y Uso de la Biodiversidad, (in English: National Commission for the Knowledge and Use of Biodiversity) data (Table 1).

2.2. Diagnosis and Antigenic Characterization of the Rabies Virus

All samples from Yucatan, Chihuahua, and Baja California Sur underwent diagnosis using the fluorescent antigen test (FAT), with subsequent antigenic characterization employing a reduced panel of eight monoclonal antibodies (MAbs) standardized by the Center for Disease Control and Prevention (CDC). This panel is capable of identifying 11 reactivity patterns associated with various mammals involved in rabies virus maintenance and transmission in the Americas [39].
Antigenic characterization was directly applied to brain smears, using impressions on an eight-well slide with a 6 mm diameter. Following the technique outlined by Jaramillo Reyna and colleagues in 2020, positive reaction for each monoclonal antibody (20 μL) was determined if more than 50% of the fluorescing foci exhibited a brilliant apple green color. The purpose was to ascertain that the antigenic profile did not correspond to any documented patterns within the designated panel, thereby accurately classifying them as “atypical” samples.

2.3. Genetic Characterization of the Rabies Virus

Following the manufacturer’s instructions, the genetic material was extracted from all brain tissue samples utilizing the QIAGEN® “QIAamp Viral RNA” (QIAGEN, Hilden, Germany) commercial kit. RT-PCR was employed to amplify a specific nucleoprotein region using the following primers: 550 FW (5′ATG TGY GCT AAY TGG AGY AC 3′) [40] and 304 RABV (5′ TTG ACG AAG ATC TTG CTC AT 3′) [41]. Amplification products and partial sequencing procedures were conducted by the methods detailed by Garcés-Ayala et al. (2017) [6].

2.4. Genetic Characterization of Skunk Species

Instructions included in the QIAamp DNA mini kit from QIAGEN® (Hilden, Germany) were followed in order to obtain mitochondrial DNA from all the available samples (brain tissues).

2.4.1. Design of Specific Oligonucleotides

Three pairs of specific oligonucleotides were designed for the cyt b gene of three skunk genera: Spilogale, Conepatus, and Mephitis. These oligonucleotide sets were based on sequences obtained from the GenBank (https://www.ncbi.nlm.nih.gov/genbank/ accessed on 30 July 2023) of the respective species, with a preference for full genome sequences of cyt b. Computational analysis (in silico) was conducted to design oligonucleotides, allowing selective amplification of the target species. This process involved sequence visualization using the Ugene program V47.0 [42] with the selection of the most conserved regions of the cyt b gene for the skunk species of interest. An analysis utilizing tools such as BLAST and Primer-BLAST was performed to ensure that the oligonucleotide designs were suitable for species detection. The sequences of the designed oligonucleotides were synthesized at the T4 oligo laboratory (https://t4oligo.com) (accessed on 8 August 2023) and are detailed in Table 2.

2.4.2. Standardization of Polymerase Chain Reaction (PCR) for Genetic Characterization of Skunks’ Species

The technique was carried out using the commercial kit “Taq DNA Polymerase” from Roche (Mannheim, Germany). The necessary volume of the master mix was prepared for the number of samples to be processed. The reaction is detailed in Table 3. In total, 25 µL of the master mix and 5 µL of the corresponding DNA template were placed in each tube. The tubes were then placed in the thermocycler to start the run, using the protocol described in Table 4.

2.5. Sequencing and Phylogenetic Reconstruction of the Rabies Virus

Once the run was completed, the visualization of the products was carried out following the manufacturer’s instructions using the “Bioanalyzer 2100 Agilent” (Waldbronn, Germany) equipment and the Agilent “DNA Chip 7500” (Winooski, VT, USA) reagent kit.
The sequencing of rabies virus was conducted at InDRE following the methodology described by Garcés-Ayala et al. (2022) [43].
As soon as the results were obtained, the sequences were edited and manually corrected using the BioEdit program V.5.0.9 [44]. Subsequently, a BLAST analysis was performed on the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (accesed on 30 August 2023) to identify the similarity percentage of the sequences obtained in this study compared to the data registered in the database.
A multiple alignment of the sequences was performed using MEGA 11 11.0.13 software with the MUSCLE algorithm [45,46]. The most appropriate evolutionary model for the analysis of the rabies virus was identified as the GTR model.
A phylogenetic analysis was conducted focusing on sequences of a fragment of the nucleoprotein of the virus in order to identify variants of the rabies virus in mammals that are part of the terrestrial cycle in the state of Yucatan. This analysis used rabies virus sequence data from Mexico, North America, and Central America, as well as sequences generated in this project (Supplementary Table S1). The phylogenetic tree was constructed using the Maximum Likelihood method, with 1000 bootstrap replicates to strengthen the robustness of the results. MEGA 11 software V11.0.13was employed for tree construction, and subsequent modifications were made using Inkscape software V 1.4 [47]

2.6. Sequencing and Phylogenetic Reconstruction of Skunks Species

We proceeded as previously described in this section in order to visualize the PCR products, but in the case of the DNA samples obtained from the nervous tissues, these products were sent for sequencing at the Translational Genomic Singularity Institute (ITRASIG by its acronym in Spanish) Irapuato, Guanajuato, Mexico.
The DNA sequences were edited and manually corrected using the BioEdit program [44]. A multiple alignment of the sequences was performed using MEGA 11 software V. 11.0.13 with the MUSCLE algorithm [45,46]. The most appropriate evolutionary model for the skunk analyses was identified as the Tamura 3 model.
A phylogenetic analysis was conducted focusing on mitochondrial DNA sequences or cyt b gene sequences of skunks, using data registered in GenBank corresponding to the eight species previously described for Mexico, as well as sequences generated in this study. Subsequently, a specific analysis was carried out with the skunk sequences belonging to the genus Spilogale, using mitochondrial DNA sequences or cyt b gene sequences available in GenBank, along with sequences generated in this project (Supplementary Table S2). The phylogenetic trees were constructed using the Maximum Likelihood method, with 1000 bootstrap replicates to ensure the robustness of the results. MEGA 11 software V.11.0.13 was used for tree construction, and subsequent modifications were made using Inkscape software V 1.4 [47].

2.7. Genetic Distance Analysis of the Cyt b Sequences

To support the data that were obtained, a genetic distance analysis was conducted to evaluate the genomic relationships among Spilogale skunk sequences in MEGA 11 software V.11.0.13. Genetic divergence percentages were calculated using Kimura’s two-parameter nucleotide substitution model. This analysis provided insights into the evolutionary differences among the analyzed skunk populations included in this study, establishing their genetic variability and confirming the separation between the cyt b sequences of S. angustifrons and S. a. yucatanensis.

3. Results

3.1. Rabies Virus Diagnosis and Antigenic Characterization

The five original brains from skunks in the state of Yucatan were confirmed as positive by FAT. Upon analyzing the samples using the reduced panel of monoclonal antibodies, it was observed that sample 3213MxskkYuc02 exhibited an antigenicity pattern that matched the pattern described for RABVV1 (Table 1). In contrast, all the other samples exhibited similar antigenicity patterns among themselves but did not match any established antigenic variant patterns in the panel; therefore, they were diagnosed as atypical.

Rabies Virus Genetic Characterization

The phylogenetic analysis for the RABV (Figure 2) was concordant with the antigenic characterization. There is a clear separation in the grouping of the sequences. At the top of the phylogenetic tree, all the variants associated with the aerial cycle are clustered, including the strains present in skunks from central Mexico and those related to the aerial cycle in the USA. Conversely, within the clade designated for rabies variants associated with the terrestrial mammal cycle, the group of sequences corresponding to the canine RABVV is observable. A notable example is the sequences derived from dogs, classified as RABVV1. Within this clade, a well-defined subgroup includes the sequences of skunks studied in this project and those previously reported in GenBank carrying the Yucatan Sylvatic variant.

3.2. Skunk Genetic Characterization

The phylogenetic tree was constructed using sequences from the eight species of skunks present in Mexico, belonging to the genera Mephitidae, Spilogale, and Conepatus (Figure 3). There is a clear distinction among the eight species, where the grouping of sequences belonging to each skunk species clearly defines the expected clades. In this phylogenetic analysis, a marked separation between the sequences of S. angustifrons and the sequences of S.a. yucatanensis was evident. The second tree confirmed the distinction observed in the previous analysis. In this case, only sequences from skunks of the genus Spilogale were used, reaffirming the separation between the sequences of S. angustifrons and the sequences of S.a. yucatanensis.
To supplement the geo-epidemiological data, a map was created to visualize the geographic locations where the sequences analyzed in this project were reported (Figure 4).

Genetic Distance Analysis

The genetic divergence percentages of the samples were calculated using Kimura’s two-parameter nucleotide substitution model. The results revealed that the divergence of the cyt b gene within the genus Spilogale ranged from 0.1% to 18%. Additionally, the mean distance between the species S. angustifrons yucatanensis and S. angustifrons was determined to be 8.5%. The mean distance between the species S. angustifrons yucatanensis and S. putorius was 4.6%, while the distance between S. angustifrons and S. putorius was 6.3% (Figure 5).

4. Discussion

The identification of skunk species involved in rabies transmission remains challenging due to limited knowledge and complex ecological interactions, such as sympatry. Mexico has the highest level of skunk richness worldwide, including endemic species (e.g., S. pygmae), which is relevant to identifying suitable habitats and establishing priority conservation areas for species [20].
In North America, Mephitis mephitis is considered an important vector of the rabies virus [48,49,50,51,52,53]. In contrast, other skunk species do not play a significant role as reservoirs of this virus [14], and there are few or no documented cases involving other species [12,21,51,54]. In the context of Mexico, the situation is different. While in the state of Nuevo Leon, the importance of Mephitis macroura as a vector of the rabies virus has been demonstrated, in most of the country, it is the genus Spilogale that plays a crucial role as a reservoir of the virus. Several authors have mentioned that the four skunk species belonging to the genus Spilogale, along with two subspecies, play a role in rabies transmission in Mexico. These species include Spilogale putorius leucoparia, Spilogale putorius lucasana, Spilogale gracilis, Spilogale pygmea, and Spilogale angustifrons. There is very little evidence that Mephitis and Conepatus are significant carriers of the RABV [12,13].
In previous works that identified species based on morphology, S. putorius was described as the species responsible for acting as a rabies virus reservoir in Mexico [22,23]. However, the geographical distribution of this species in Mexican territory, according to CONABIO, is very limited. Some authors have even questioned the presence of this species in Mexico [16], raising certain questions about its predominant role in rabies transmission.
The genus Spilogale presents notable taxonomic complexity, and its evolutionary history is still not entirely clear, partly due to the limited number of specimens available for study; this situation has led to a certain confusion in species identification.
At the beginning of this project, the hypothesis was formulated that the species S. angustifrons could act as the natural reservoir of the Yucatan sylvatic lineage of the RABV. This hypothesis is largely based on the particular habits of this species, making it prone to playing a central role in the transmission of the disease. In comparison, the other skunk species present in the state of Yucatan, C. semistriatus, has certain characteristics that influence the dynamics of rabies transmission within the genus [55]. For example, the lower population density detected in these species may result in reduced exposure to the rabies virus, as there would be fewer opportunities for the virus to spread among individuals of the same species. However, more studies are needed to understand the factors that promote rabies outbreaks in skunks [56,57].
According to current reports, in the state of Yucatan, the distribution of the genus Spilogale is limited to a single species, the S. angustifrons [27]. This relationship between geographical distribution and the results of this study, in which all the skunks analyzed from the state of Yucatan belong to this species, provides, for the first time, evidence that allows us to consider S. angustifrons as the species responsible for maintaining and transmitting the RABV in the state of Yucatan.
S. angustifrons are commonly found in forested areas in the Yucatan Peninsula. They tend to inhabit regions with dense vegetation, which provides cover and hunting opportunities. While they can occasionally be found in rural areas, their abundance is generally higher in forested landscapes. The few records of S. angustifrons in this region may be due to the lack of mastozoological surveys in the region; therefore, the population and ecological aspects of the species remain unknown [58,59].
The RABV identified as the Yucatan sylvatic lineage, described in 2017, has significantly affected public health, having been detected in both wild and domestic animals in the state of Yucatan [6,25,26]. According to Garcés-Ayala and collaborators (2017) [6], all the domestic animals identified with this variant had a history of aggression by skunks. This suggests that skunks could play a crucial role as vectors and potential reservoirs of the Yucatan sylvatic lineage, although no taxonomic identification was performed. Further studies involving samples with atypical antigenic characterization revealed RABV sequences clustering in the Yucatan sylvatic lineage clade, indicating that this virus remains present in the region [25,26]. However, the natural reservoir of the Yucatan sylvatic lineage has not yet been definitively identified.
The sample 3213MxskkYuc02, identified as RABVV1 during antigenic characterization, with the domestic dog as its natural reservoir, is particularly significant. This variant is considered “under control” in Mexico, thanks to intensive vaccination campaigns since the 1990s, which have resulted in no recorded cases of infected dogs since 2005 or humans since 2006 [7]. Unfortunately, the poor preservation of this sample prevented its sequencing, thereby hindering the confirmation of the virus characterization and the possibility of conducting evolutionary studies to demonstrate that RABVV1 is an ancestor of the Yucatan sylvatic lineage.
To strengthen these results, phylogenetic analyses were conducted in our study. The results reveal the presence of two genetic lineages, coinciding with previous descriptions [18]. These lineages are the Western Spilogale, including S. angustifrons and S. gracilis, and the Eastern Spilogale, including S.a. yucatanensis and S. putorius. The sequences of S. a. yucatanensis do not isolate within the Western lineage alongside S. angustifrons, as would be expected, since it was previously recognized only as a subspecies.
According to the BLAST analyses performed, it was found that the five sequences of the Yucatan skunks analyzed in this project show similarities ranging from 98.8% to 100% with the previously considered subspecies S. angustifrons yucatanensis. This finding underscores the close genetic relationship between the skunks studied and this particular subspecies.
Additionally, it could be inferred that these lineages have evolved separately due to fragmentation events and/or ecosystem loss or biogeographic barriers [18,60]. This observed diversity could be related to the distinctive characteristics of the Spilogale genus, such as its small size, limited dispersal capacity, and high mortality rate, as demonstrated by various previous studies [61,62,63]. This phenomenon is similar to what is observed in other small mammals, such as bats [64].
The sequences of the skunks described in this project cluster with previously registered sequences in GenBank, which provides solid support for their identification as belonging to the subspecies S. angustifrons yucatanensis. It is widely accepted that a significant portion of Mexico’s biodiversity exhibits a restricted geographic distribution and can only be found in specific geographic regions, which is related to the presence of a high number of endemic species in the country [9,13]. One of the clearest examples of this assertion is the state of Yucatan [65].
In 2022, McDonough and collaborators [18] reported sufficient evidence to accept the existence of an endemic skunk species in the state of Yucatan, S. yucatanensis (referred to by this name from now on), although it has so far been classified as a subspecies of S. angustifrons. The data generated in our study strengthen the theory proposed by McDonough and her collaborators.
In our analysis, a clear distinction is demonstrated between the sequences grouped in the S. angustifrons clade, including sequences from locations other than Yucatan (Mexico City, Oaxaca, and Guatemala), and the sequences of all the skunks from the state of Yucatan, which include the five skunks included in this project, which are grouped together in the “S. yucatanensis” clade. This indicates the presence of two separate evolutionary lineages, evidencing distinct species.
To further our knowledge of the Spilogale genus, a genetic divergence analysis was carried out in this study. A significant difference of 8.5% was observed between S. yucatanensis and S. angustifrons, a percentage higher than that found in a previous study conducted by Dragoo and collaborators in 1993 [30]. These results support the notion that S. yucatanensis should be considered an independent species within the Spilogale genus.
Considering the distribution reported so far for the species S. yucatanensis, which appears to be restricted to the state of Yucatan, we identify an important factor that could explain why the Yucatan sylvatic lineage has not been identified yet in the states of Campeche and Quintana Roo, despite also being part of the Yucatan Peninsula. This reinforces the hypothesis that this skunk species could be the natural reservoir of this variant. Additionally, to enrich the data on the species, future research should focus on describing the distribution range of S. yucatanensis through intentional searches in the states of Campeche and Quintana Roo to determine whether it is an endemic species of the entire Yucatan Peninsula or just of the state of Yucatan.
This project also generated partial results concerning the wild-living rabies cycle panorama in other regions of Mexico. In the context of Baja California Sur, the presence of the RABVV 10 variant has been identified as being restricted to this state, where its existence in skunk populations has been confirmed. The literature has attributed the status of the natural reservoir for this variant to S. putorius [22,23,66,67,68].
However, current data provided by CONABIO do not corroborate the presence of this species in the state. Significantly, the results obtained from sample 70MxskkBCS20 reveal that the genetic sequence clustered with skunks of the species S. gracilis. This is in contrast to the information from CONABIO, which documents the presence of this species in the state of Baja California Sur. These findings constitute initial indications that could lead to the identification of the specific reservoir for the RABVV10 in question. The need for future research focusing on more robust studies to validate and consolidate this emerging hypothesis is emphasized.
Similarly, the so called “RABVV1 atypical”, previously documented in the states of Chihuahua, Sonora, Sinaloa, and Durango, has been associated with the presence of S. putorius according to the literature [12,22,66]. Nevertheless, the genetic sequences generated from skunks in the state of Chihuahua as part of this project show a group in the clade corresponding to the species S. gracilis. It is worth noting that, according to data from the epidemiological bulletin of the General Direction of Epidemiology of the Ministry of Health of Mexico, the state of Chihuahua has the highest incidence of human rabies cases transmitted by skunks. This fact underscores the relevance of undertaking more detailed studies to understand the interaction between the RABVV, the skunks, and the transmission cases in these states. Even records of domestic animals infected with a skunk variant serve to highlight the relevance of skunks in the context of public health [69].
Molecular taxonomic research using advanced genetic and molecular techniques is needed in order to refine the systematics at the species and subspecies level and determine the genetic diversity within populations, particularly for endangered species or those inhabiting fragmented habitats.

5. Conclusions

This study introduces a novel method for the simultaneous surveillance of the rabies virus and identification of skunk species using a single tissue (brain), advancing our understanding of the taxonomy of rabies virus reservoirs and the epidemiology of rabies in Mexico.
Our results reveal that all the rabies-positive individuals analyzed from the state of Yucatan belong to the recently proposed species, Spilogale yucatanensis. Additionally, the described distribution of S. yucatanensis provides a likely explanation for why the Yucatan sylvatic lineage is endemic to this state. This highlights the necessity of implementing rabies control measures tailored to this region. These findings offer critical information that will aid in the control and prevention of rabies.
Furthermore, our study emphasizes that researching zoonotic diseases, such as rabies, is fundamental not only for public health, but also for advancing scientific knowledge of host taxonomy and evolutionary biology.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13020262/s1. Table S1: GenBank accession numbers of sequences used in the phylogenetic analyses of rabies virus from the Americas. Table S2: GenBank accession numbers of skunk-derived sequences used in the analyses.

Author Contributions

Conceptualization N.A.-C. and P.P.-R.; methodology, P.P.-R., J.C.D.M., O.P.G.-G., R.S.-S. and M.D.-S.; software, P.P-R., R.S.-S. and M.D.-S.; validation N.A.-C. and O.P.G.-G.; formal analysis, P.P.-R. and N.A.-C.; investigation, P.P.-R. and N.A.-C.; resources, N.A.-C., I.L.-M., I.S.-G. and A.A.-G.; data curation, P.P.-R., R.S.-S., M.D.-S., O.P.G.-G. and N.A.-C.; writing—original draft preparation, P.P.-R. and N.A.-C.; writing—review and editing, all authors.; visualization, P.P.-R. and N.A.-C.; supervision, N.A.-C., I.L.-M., O.P.G.-G. and G.G.-R.; project administration, I.L.-M., O.P.G.-G. and G.G.-R.; funding acquisition, I.L.-M. and O.P.G.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was partially supported by a CONAHCYT scholarship awarded to Paola Puebla-Rodríguez.

Institutional Review Board Statement

This study does not require approval by an ethics committee, since the animals tested are part of the passive surveillance of the rabies virus in Mexico in accordance with the NOM-011-SSA2-2011, “For the prevention and control of rabies human and in dogs and cats”, which indicates the following: 10.5.4. In case of contact with secretions of domestic animals suspected of being sick with rabies or with wild animal aggressors, if they can be located, their brains must be studied in the laboratory to corroborate the presence or absence of rabies virus. The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the funding agency.

Informed Consent Statement

Not applicable.

Data Availability Statement

We are in the process of submitting the sequences generated in this work at GenBank.

Acknowledgments

We would like to extend our sincere thanks to all the staff at the Instituto de Diagnóstico y Referencia Epidemiológicos (InDRE) of the Mexican Ministry of Health for their technical support and the facilities provided for the development of this work, especially the staff of the Rabies Reference Laboratory. We are also grateful to the entire team at ITRASIG for their hospitality and the use of their facilities. Nidia Aréchiga thanks José Luis Jiménez for reviewing the manuscript and his valuable comments to improve the writing.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rupprecht, C.E.; Hanlon, C.A.; Hemachudha, T. Rabies re-examined. Lancet Infect. Dis. 2002, 2, 327–343. [Google Scholar] [CrossRef] [PubMed]
  2. Frantchez, V.; Medina, J. Rabia: 99.9% mortal, 100% prevenible. Rev. Medica Del. Urug. 2018, 34, 164–171. [Google Scholar] [CrossRef]
  3. Fisher, C.R.; Streicker, D.G.; Schnell, M.J. The spread and evolution of rabies virus: Conquering new frontiers. Nat. Rev. Microbiol. 2018, 16, 241–255. [Google Scholar] [CrossRef] [PubMed]
  4. World Health Organization (WHO). Rabies Fact Sheet; WHO: Geneva, Switzerland, 2019; Available online: http://www.who.int/mediacentre/factsheets/fs099/es/ (accessed on 15 May 2024).
  5. Krebs, J.W.; Wilson, M.L.; Childs, J.E. Rabies: Epidemiology, Prevention, and Future Research. J. Mammal. 1995, 76, 681–694. [Google Scholar] [CrossRef]
  6. Garcés-Ayala, F.; Aréchiga-Ceballos, N.; Ortiz-Alcántara, J.M.; González-Durán, E.; Pérez-Agüeros, S.I.; Méndez-Tenorio, A.; Torres-Longoria, B.; López-Martínez, I.; Hernández-Rivas, L.; Díaz-Quiñonez, J.A.; et al. Molecular characterization of atypical antigenic variants of canine rabies virus reveals its reintroduction by wildlife vectors in southeastern Mexico. Arch. Virol. 2017, 162, 3629–3637. [Google Scholar] [CrossRef]
  7. Aréchiga Ceballos, N.; Puebla Rodríguez, P.; Aguilar Setién, Á. The New Face of Human Rabies in Mexico, What’s Next After Eradicating Rabies in Dogs. Vector-Borne Zoonotic Dis. 2022, 22, 69–75. [Google Scholar] [CrossRef]
  8. Ramírez-Pulido, J.; Castro-Campillo, A. Lista Taxonómica de los Mamíferos Terrestres de México; Museum of Texas Tech University: Lubbock, TX, USA, 1996. [Google Scholar] [CrossRef]
  9. Juárez Agis, N.; García Sánchez, S.; Olivier Salomé, B.; Zeferino Torres, J.Y.; Rivas González, M. Los Zorrillos en México un grupo vulnerable poco conocido. Biodiversitas 2020, 153, 12–16. [Google Scholar]
  10. Fehlner-Gardiner, C. Rabies control in North America-past, present and future. Rev. Sci. Et Tech. 2018, 37, 421–437. [Google Scholar] [CrossRef]
  11. Jaramillo-Reyna, E.; Almazán-Marín, C.; de la O-Cavazos, M.E.; Valdéz-Leal, R.; Bañuelos-Álvarez, A.H.; Zúñiga-Ramos, M.A.; Melo-Munguía, M.; Gómez-Sierra, M.; Sandoval-Borja, A.; Chávez-López, S.; et al. Public veterinary medicine: Public health rabies virus variants identified in Nuevo Leon State, Mexico, from 2008 to 2015. J. Am. Vet. Med. Assoc. 2020, 256, 438–443. [Google Scholar] [CrossRef] [PubMed]
  12. Aranda, M.; López-de Buen, L. Rabies in skunks from Mexico. J. Wildl. Dis. 1999, 35, 574–577. [Google Scholar] [CrossRef] [PubMed]
  13. Ramírez-Pulido, J.; Arroyo-Cabrales, J.; Castro-Campillo, A. Estado actual y relación nomenclatural de los mamíferos terrestres de México. Acta Zoológica Mex. 2005, 21, 21–82. [Google Scholar] [CrossRef]
  14. Gilbert, A.T. Rabies virus vectors and reservoir species. Rev. Sci. Et Tech. 2018, 37, 371–384. [Google Scholar] [CrossRef]
  15. Ewer, R.F. The Carnivores; Cornell University Press: Ithaca, NY, USA, 1998. [Google Scholar]
  16. Dragoo, J.W.; Sheffield, S.R. Conepatus leuconotus (Carnivora: Mephitidae). Mamm. Species 2009, 827, 1–8. [Google Scholar] [CrossRef]
  17. Koepfli, K.P.; Dragoo, J.W.; Wang, X. The evolutionary history and molecular systematics of the Musteloidea. In Biology and Conservation of Musteloids; Oxford University Press: Oxford, UK, 2017; pp. 75–91. [Google Scholar]
  18. McDonough, M.M.; Ferguson, A.W.; Dowler, R.C.; Gompper, M.E.; Maldonado, J.E. Phylogenomic systematics of the spotted skunks (Carnivora, Mephitidae, Spilogale): Additional species diversity and Pleistocene climate change as a major driver of diversification. Mol. Phylogenetics Evol. 2022, 167, 107266. [Google Scholar] [CrossRef] [PubMed]
  19. Macdonald, D.; Harrington, L.; Newman, C. Dramatis Personae: An Introduction to the Wild Musteloids; Macdonald, D., Newman, C., Harrington, l., Eds.; Oxford University Press: Oxford, UK, 2017. [Google Scholar]
  20. Hernández-Sánchez, A.; Santos-Moreno, A.; Pérez-Irineo, G. The Mephitidae in the Americas: A review of the current state of knowledge and future research priorities. Mamm. Biol. 2022, 102, 307–320. [Google Scholar] [CrossRef]
  21. Hass, C.C.; Dragoo, J.W. Rabies in hooded and striped skunks in Arizona. J. Wildl. Dis. 2006, 42, 825–829. [Google Scholar] [CrossRef] [PubMed]
  22. Loza-Rubio, E.; Nadin-Davis, S.A.; Morales Salinas, E. Caracterización molecular y biológica del virus de la Rabia que circula en zorrillos de México enfocado a la variante del gen de la fosfoproteína (P). Rev. Mex. De Cienc. Pecu. 2012, 3, 155–170. [Google Scholar]
  23. Velasco-Villa, A.; Reeder, S.A.; Orciari, L.A.; Yager, P.A.; Franka, R.; Blanton, J.D.; Zuckero, L.; Hunt, P.; Oertli, E.H.; Robinson, L.E.; et al. Enzootic rabies elimination from dogs and reemergence in wild terrestrial carnivores, United States. Emerg. Infect. Dis. 2008, 14, 1849. [Google Scholar] [CrossRef]
  24. Ceballos, G.; Miranda, A. Los Mamíferos de Chamela, Jalisco: Manual de Campo; Instituto de Biología, Universidad Nacional Autónoma de México: Mexico City, Mexico, 1986. [Google Scholar]
  25. Puebla-Rodríguez, P.; Almazán-Marín, C.; Garcés-Ayala, F.; Rendón-Franco, E.; Chávez-López, S.; Gómez-Sierra, M.; Sandoval-Borja, A.; Martínez-Solís, D.; Escamilla-Ríos, B.; Sauri-González, I.; et al. Rabies virus in white-nosed coatis (Nasua narica) in Mexico: What do we know so far? Front. Vet. Sci. 2023, 10, 1090222. [Google Scholar] [CrossRef]
  26. Salgado-Cardoso, A.M.; Olave-Leyva, J.I.; Morales, I.; Aguilar-Setién, A.; López-Martínez, I.; Aréchiga-Ceballos, N. Cats: The New Challenge for Rabies Control in the State of Yucatan, Mexico. Pathogens 2024, 13, 907. [Google Scholar] [CrossRef] [PubMed]
  27. CONABIO. National Commission for the Knowledge and Use of Biodiversity. 2024. Available online: http://www.conabio.gob.mx/informacion/gis/ (accessed on 21 June 2024).
  28. Leopold, S.A. Fauna Silvestre de México: Aves y Mamíferos de Caza; Primera Edición en Español; Instituto Mexicano de Recursos Naturales Renovables: Mexico City, Mexico, 1965. [Google Scholar]
  29. Marmi, J.; López-Giráldez, J.F.; Domingo-Roura, X. Phylogeny, evolutionary history and taxonomy of the Mustelidae based on sequences of the cytochrome b gene and a complex repetitive flanking region. Zool. Scr. 2004, 33, 481–499. [Google Scholar] [CrossRef]
  30. Dragoo, J.W.; Bradley, R.D.; Honeycutt, R.L.; Templeton, J.W. Phylogenetic relationships among the skunks: A molecular perspective. J. Mamm. Evol. 1993, 1, 255–267. [Google Scholar] [CrossRef]
  31. Floyd, C.H.; Van Vuren, D.H.; Crooks, K.R.; Jones, K.L.; Garcelon, D.K.; Belfiore, N.M.; Dragoo, J.W.; May, B. Genetic differentiation of island spotted skunks, Spilogale gracilis amphiala. J. Mammal. 2011, 92, 148–158. [Google Scholar] [CrossRef]
  32. Ferguson, A.W.; McDonough, M.M.; Guerra, G.I.; Rheude, M.; Dragoo, J.W.; Ammerman, L.K.; Dowler, R.C. Phylogeography of a widespread small carnivore, the western spotted skunk (Spilogale gracilis) reveals temporally variable signatures of isolation across western North America. Ecol. Evol. 2017, 7, 4229–4240. [Google Scholar] [CrossRef] [PubMed]
  33. Shaffer, A.A.; Dowler, R.C.; Perkins, J.C.; Ferguson, A.W.; McDonough, M.M.; Ammerman, L.K. Genetic variation in the eastern spotted skunk (Spilogale putorius) with emphasis on the plains spotted skunk (S. p. interrupta). J. Mammal. 2018, 99, 1237–1248. [Google Scholar] [CrossRef]
  34. Howell, A.H. Revision of the Skunks of the Genus Spilogale (No. 26); US Government Printing Office: Washington, DC, USA, 1906.
  35. Van Gelder, R.G. A Taxonomic Revision of the Spotted Skunks (Genus Spilogale); University of Illinois at Urbana-Champaign: Champaign, IL, USA, 1958; Bulletin of the American Museum of Natural History. 117 (5). Manhattan, New York, USA 1959. [Google Scholar]
  36. Howell, A.H. Three new skunks of the genus Spilogale. Proc. Biol. Soc. Wash. 1902, 15, 242. [Google Scholar]
  37. Owen, J.G.; Baker, R.J.; Williams, S.L. Karyotypic Variation in Spotted Skunks (Carnivora: Mustelidae: Spilogale) from Texas, Mexico and El Salvador. Tex. J. Sci. 1996, 48, 119–122. [Google Scholar]
  38. Wozencraft, W.C. Order carnivora. In Mammal Species of the World: A Taxonomic and Geographic Reference; Johns Hopkins University Press: Baltimore, MD, USA, 2005; Volume 1, pp. 532–628. [Google Scholar]
  39. Diaz, A.M.; Papo, S.; Rodriguez, A.; Smith, J.S. Antigenic analysis of rabies-virus isolates from Latin America and the Caribbean. J. Vet. Med. Ser. B 1994, 41, 153–160. [Google Scholar] [CrossRef]
  40. Markotter, W.; Kuzmin, I.; Rupprecht, C.E.; Randles, J.; Sabeta, C.T.; Wandeler, A.I.; Nel, L.H. Isolation of Lagos bat virus from water mongoose. Emerg. Infect. Dis. 2006, 12, 1913–1918. [Google Scholar] [CrossRef] [PubMed]
  41. Murray, P.R.; Baron, E.J.; Pfaller, M.A.; Tenover, F.C.; Yolken, R.H.; Morgan, D.R. Manual of Clinical Microbiology, 6th ed.; 1995; Volume 3, p. 449. [Google Scholar]
  42. Okonechnikov, K.; Golosova, O.; Fursov, M.; The UGENE team. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  43. Garcés-Ayala, F.; Aguilar-Setién, Á.; Almazán-Marín, C.; Cuautle-Zavala, C.; Chávez-López, S.; Martínez-Solís, D.; Gómez-Sierra, M.; Sandoval-Borja, A.; Escamilla-Ríos, B.; López-Martínez, I.; et al. Rabies Virus Variants Detected from Cougar (Puma concolor) in Mexico 2000–2021. Pathogens 2022, 11, 265. [Google Scholar] [CrossRef] [PubMed]
  44. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  45. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  46. Edgar, R.C. MUSCLE: Multiple sequence alignment high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
  47. Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef]
  48. Greenwood, R.J.; Newton, W.E.; Pearson, G.L.; Schamber, G.J. Population and movement characteristics of radio-collared striped skunks in North Dakota during an epizootic of rabies. J. Wildl. Dis. 1997, 33, 226–241. [Google Scholar] [CrossRef]
  49. Krebs, J.W.; Mandel, E.J.; Swerdlow, D.L.; Rupprecht, C.E. Rabies surveillance in the United States during 2004. J. Am. Vet. Med. Assoc. 2005, 227, 1912–1925. [Google Scholar] [CrossRef] [PubMed]
  50. Leslie, M.J.; Messenger, S.; Rohde, R.E.; Smith, J.; Cheshier, R.; Hanlon, C.; Rupprecht, C.E. Bat-associated rabies virus in skunks. Emerg. Infect. Dis. 2006, 12, 1274. [Google Scholar] [CrossRef] [PubMed]
  51. Oertli, E.H.; Wilson, P.J.; Hunt, P.R.; Sidwa, T.J.; Rohde, R.E. Epidemiology of rabies in skunks in Texas. J. Am. Vet. Med. Assoc. 2009, 234, 616–620. [Google Scholar] [CrossRef] [PubMed]
  52. Raghavan, R.K.; Hanlon, C.A.; Goodin, D.G.; Davis, R.; Moore, M.; Moore, S.; Anderson, G.A. Bayesian spatiotemporal pattern and eco-climatological drivers of striped skunk rabies in the North Central Plains. PLoS Neglected Trop. Dis. 2016, 10, e0004632. [Google Scholar] [CrossRef]
  53. Wohlers, A.; Lankau, E.W.; Oertli, E.H.; Maki, J. Challenges to controlling rabies in skunk populations using oral rabies vaccination: A review. Zoonoses Public Health 2018, 65, 373–385. [Google Scholar] [CrossRef] [PubMed]
  54. Dragoo, J.W.; Honeycutt, R.L.; Schmidly, D.J. Taxonomic status of white-backed hog-nosed skunks, genus Conepatus (Carnivora: Mephitidae). J. Mammal. 2003, 84, 159–176. [Google Scholar] [CrossRef]
  55. Parker, R.L. Rabies in skunks. In The Natural History of Rabies; Baer, G.M., Ed.; Academic Press: New York, NY, USA, 1975; pp. 41–51. [Google Scholar]
  56. Tinline, R.R.; MacInnes, C. D Ecogeographic patterns of rabies in southern Ontario based on time series analysis. J. Wildl. Dis. 2004, 40, 212–221. [Google Scholar] [CrossRef] [PubMed]
  57. Davis, R.; Nadin-Davis, S.A.; Moore, M.; Hanlon, C. Genetic characterization and phylogenetic analysis of skunk-associated rabies viruses in North America with special emphasis on the central plains. Virus Res. 2013, 174, 27–36. [Google Scholar] [CrossRef] [PubMed]
  58. Mejenes-López, S.d.M.A.; Gálvez-Aguilera, X.; Escalona-Segura, G.; Vargas-Contreras, J.A.; Retana-Guiascón, O.G.; Cab-Paat, G.d.L. First record of the coexistence of two mesocarnivores in the Yucatán Peninsula, México. Therya Notes 2021, 2, 79–84. [Google Scholar] [CrossRef]
  59. Contreras-Moreno, F.; E Simá-Pantí, D.; Cruz-Romo, L.; Petrone, S.; Méndez-Saint, G.; Méndez-Tun, J.; Jesús-Espinosa, D.; Cruz-Molina, I.; Mayor, C.C.-C.Y.; Duque, V. Registros destacados de Spilogale angustifrons en la Reserva de la Biosfera Calakmul. Rev. Colomb. De Cienc. Anim.—RECIA 2022, 14, e913. [Google Scholar] [CrossRef]
  60. Riddle, B.R.; Hafner, D.J. A step-wise approach to integrating phylogeographic and phylogenetic biogeographic perspectives on the history of a core North American warm deserts biota. J. Arid. Environ. 2006, 66, 435–461. [Google Scholar] [CrossRef]
  61. Hillman, S.S.; Drewes, R.C.; Hedrick, M.S.; Hancock, T.V. Physiological vagility and its relationship to dispersal and neutral genetic heterogeneity in vertebrates. J. Exp. Biol. 2014, 217, 3356–3364. [Google Scholar] [CrossRef] [PubMed]
  62. Jones, K.L.; Van Vuren, D.H.; McEachern, M.B.; Crooks, K.R.; Dragoo, J.W.; May, B. Spatial and genetic organization of the island spotted skunk, Spilogale gracilis amphiala. Southwest. Nat. 2013, 58, 481–486. [Google Scholar] [CrossRef]
  63. Lesmeister, D.B.; Millspaugh, J.J.; Gompper, M.E.; Mong, T.W. Eastern spotted skunk (Spilogale putorius) survival and cause-specific mortality in the Ouachita Mountains, Arkansas. Am. Midl. Nat. 2010, 164, 52–60. [Google Scholar] [CrossRef]
  64. Weyandt, S.E.; Van Den Bussche, R.A. Phylogeographic structuring and volant mammals: The case of the pallid bat (Antrozous pallidus). J. Biogeogr. 2007, 34, 1233–1245. [Google Scholar] [CrossRef]
  65. Vázquez-Domínguez, E.; Arita, H.T. The Yucatan peninsula: Biogeographical history 65 million years in the making. Ecography 2010, 33, 212–219. [Google Scholar] [CrossRef]
  66. Loza, E.; Aguilar-Setien, A.; Tordo, N. Evidencias de una nueva variante de virus de rabia en México, que circula en zorrillos. In Folleto de Investigación; Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP): Ciudad de México, México, 1998. [Google Scholar]
  67. Velasco-Villa, A.; Orciari, L.A.; Souza, V.; Juárez-Islas, V.; Gomez-Sierra, M.; Castillo, A.; Flisser, A.; Rupprecht, C.E. Molecular epizootiology of rabies associated with terrestrial carnivores in Mexico. Virus Res. 2005, 111, 13–27. [Google Scholar] [CrossRef] [PubMed]
  68. Velasco-Villa, A.; Mauldin, M.R.; Shi, M.; Escobar, L.E.; Gallardo-Romero, N.F.; Damon, I.; Olson, V.A.; Streicker, D.G.; Emerson, G. The history of rabies in the Western Hemisphere. Antivir. Res. 2017, 146, 221–232. [Google Scholar] [CrossRef]
  69. Rupprecht, C.E.; Smith, J.S.; Fekadu, M.; Childs, J.E. The ascension of wildlife rabies: A cause for public health concern or intervention? Emerg. Infect. Dis. 1995, 1, 107. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 13 00262 g001
Figure 1. Map of the Mexican Republic showing the distribution of the four rabies virus variants related to skunks. RABVV 10 light purple, RABVV 1 in green, RABVV 8 in magenta, and atypical RABVV Yucatan sylvatic in lime green.
Figure 1. Map of the Mexican Republic showing the distribution of the four rabies virus variants related to skunks. RABVV 10 light purple, RABVV 1 in green, RABVV 8 in magenta, and atypical RABVV Yucatan sylvatic in lime green.
Microorganisms 13 00262 g001
Microorganisms 13 00262 g002
Figure 2. Phylogenetic analysis for the RABV. The Maximum Likelihood method was utilized with the general time-reversible model and a discrete gamma distribution, incorporating 1000 bootstrap replicates to enhance the robustness of the results. This analysis used 90 partial sequences (900 bp) of the nucleoprotein gene from several rabies virus variants circulating in the Americas. The sequences generated in this work are indicated in bold.
Figure 2. Phylogenetic analysis for the RABV. The Maximum Likelihood method was utilized with the general time-reversible model and a discrete gamma distribution, incorporating 1000 bootstrap replicates to enhance the robustness of the results. This analysis used 90 partial sequences (900 bp) of the nucleoprotein gene from several rabies virus variants circulating in the Americas. The sequences generated in this work are indicated in bold.
Microorganisms 13 00262 g002
Microorganisms 13 00262 g003
Figure 3. The Maximum Likelihood method was utilized with the Tamura 3 model and a discrete gamma distribution, incorporating 1000 bootstrap replicates to enhance the robustness of the results. This analysis used 45 partial sequences (680 bp) of the cyt b gene from the eight species of skunks present in Mexico, belonging to the genera Mephitis, Spilogale, and Conepatus. The sequences generated in this work are indicated in bold.
Figure 3. The Maximum Likelihood method was utilized with the Tamura 3 model and a discrete gamma distribution, incorporating 1000 bootstrap replicates to enhance the robustness of the results. This analysis used 45 partial sequences (680 bp) of the cyt b gene from the eight species of skunks present in Mexico, belonging to the genera Mephitis, Spilogale, and Conepatus. The sequences generated in this work are indicated in bold.
Microorganisms 13 00262 g003
Microorganisms 13 00262 g004
Figure 4. Map including sampling localities where the sequences of the Spilogale species analyzed in this study were reported.
Figure 4. Map including sampling localities where the sequences of the Spilogale species analyzed in this study were reported.
Microorganisms 13 00262 g004
Microorganisms 13 00262 g005
Figure 5. Genetic divergence percentages of the cyt b gene within the genus Spilogale, including the sequences generated in this study (indicated in bold).
Figure 5. Genetic divergence percentages of the cyt b gene within the genus Spilogale, including the sequences generated in this study (indicated in bold).
Microorganisms 13 00262 g005
Table 1. Samples of skunks analyzed in this project.
Table 1. Samples of skunks analyzed in this project.
No. InDREYearInstitutionMunicipalityStateOrigin
Diagnosis		Antigenic
Variant		GenBank
Access
Rabies Virus		GenBank
Access
Cyt b
3203MxskYuc022002State Public Health Laboratory of YucatanNDYucatanPositiveAtypicalNPPV012461
3213MxskYuc022002State Public Health Laboratory of YucatanNDYucatanPositiveRABVV1NPPV012462
482MxskYuc192019State Public Health Laboratory of YucatanNDYucatanPositiveAtypicalPQ963930PV012463
203MxskYuc202020State Public Health Laboratory of YucatanKinchilYucatanPositiveAtypicalPQ963931PV012464
204MxskYuc202020State Public Health Laboratory of YucatanKinchilYucatanPositiveAtypicalPQ963932PV012465
270MxskBCS202020State Public Health Laboratory of BCSNDBaja California SurPositiveRABVV10NPPV012466
349MxskChih152015State Public Health Laboratory of ChihuahuaNDChihuahuaPositiveRABVV1-“ Atypical”NPPV012467
3124MxskChih162016State Public Health Laboratory of ChihuahuaNDChihuahuaPositiveRABVV1-“ Atypical”NPPV012468
ND: No data available. NP: Not performed.
Table 2. The sequences of the designed oligonucleotides.
Table 2. The sequences of the designed oligonucleotides.
GenusOligoSequence Expected
Molecular Weight
SpilogaleSa FW5′ TCAWCATGATGAAACTTCGGTTCC 3′Fw678 bp
SpilogaleSa RV5′ CCTGTTTCATGAAGGAACAGTAAATG 3′Rv
ConepatusCs FW5′ GCTCTCTACTCGGAAyCTGC 3′Fw679 bp
ConepatusCs RV5′ TCGTGTAGGAATAATAGGTGGAC 3′Rv
MephitisMm FW5′ TCAwCATGATGAAACTTCGGTTCC 3′Fw678 bp
MephitisMm RV5′ CCTGTTTCATGTAGGAAATAGTAAGTG3′Rv
Table 3. PCR protocol used for the cyt b gene of skunks.
Table 3. PCR protocol used for the cyt b gene of skunks.
ReagentVolume
Buffer Mix5 µL
Taq DNA Polymerasa1 µL
Primer Fw (20 pmol/µL)2 µL
Primer Rv (20 pmol/µL)2 µL
Water PCR9.5 µL
dNTPs (10 nM)2.5 µL
MgCl23 µL
Table 4. Thermocycler program for cyt b gene of skunks.
Table 4. Thermocycler program for cyt b gene of skunks.
ThermocyclerProgram
Step
1 cycle3 min 94 °C
39 cycles30 seg 94 °C
39 cycles15 seg 60 °C
39 cycles30 seg 72 °C
1 cycle7 min 72 °C
∞4 °C
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Puebla-Rodríguez, P.; García-González, O.P.; Sánchez-Sánchez, R.; Díaz-Sánchez, M.; Del Mazo, J.C.; Sauri-González, I.; Alonzo-Góngora, A.; García-Rodríguez, G.; López-Martínez, I.; Aréchiga-Ceballos, N. The Role of Skunks in the Epidemiology of Rabies in the State of Yucatan from 2000 to 2022: Current Perspectives and Future Research Directions. Microorganisms 2025, 13, 262. https://doi.org/10.3390/microorganisms13020262

AMA Style

Puebla-Rodríguez P, García-González OP, Sánchez-Sánchez R, Díaz-Sánchez M, Del Mazo JC, Sauri-González I, Alonzo-Góngora A, García-Rodríguez G, López-Martínez I, Aréchiga-Ceballos N. The Role of Skunks in the Epidemiology of Rabies in the State of Yucatan from 2000 to 2022: Current Perspectives and Future Research Directions. Microorganisms. 2025; 13(2):262. https://doi.org/10.3390/microorganisms13020262

Chicago/Turabian Style

Puebla-Rodríguez, Paola, Octavio Patricio García-González, Rocío Sánchez-Sánchez, Mauricio Díaz-Sánchez, Juan Carlos Del Mazo, Isaías Sauri-González, Adriana Alonzo-Góngora, Gabriel García-Rodríguez, Irma López-Martínez, and Nidia Aréchiga-Ceballos. 2025. "The Role of Skunks in the Epidemiology of Rabies in the State of Yucatan from 2000 to 2022: Current Perspectives and Future Research Directions" Microorganisms 13, no. 2: 262. https://doi.org/10.3390/microorganisms13020262

APA Style

Puebla-Rodríguez, P., García-González, O. P., Sánchez-Sánchez, R., Díaz-Sánchez, M., Del Mazo, J. C., Sauri-González, I., Alonzo-Góngora, A., García-Rodríguez, G., López-Martínez, I., & Aréchiga-Ceballos, N. (2025). The Role of Skunks in the Epidemiology of Rabies in the State of Yucatan from 2000 to 2022: Current Perspectives and Future Research Directions. Microorganisms, 13(2), 262. https://doi.org/10.3390/microorganisms13020262

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop