Next Article in Journal
Genetic Code Expansion for Controlled Surfactin Production in a High Cell-Density Bacillus subtilis Strain
Previous Article in Journal
Microbial Diversity Drives Decomposition More than Advantage of Home Environment—Evidence from a Manipulation Experiment with Leaf Litter
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 2
10.3390/microorganisms13020352
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Vibrio sp. and Identification of the ctx Gene of Cholera Toxin in the Mandinga Coastal Lagoon, Veracruz, Mexico

by
María del Refugio Castañeda-Chávez
1,
Rosa Elena Aguilar-Muslera
2,
Christian Reyes-Velázquez
1,
Fabiola Lango-Reynoso
1,
Rosa Elena Zamudio-Alemán
1 and
Magnolia Gricel Salcedo-Garduño
1,*
1
Tecnológico Nacional de México/Instituto Tecnológico de Boca del Río, Km 12 Carretera Veracruz-Córdoba, Boca del Río 94290, Mexico
2
Tecnológico Nacional de México/Instituto Tecnológico de Veracruz, Miguel Ángel de Quevedo 2779, Veracruz 91897, Mexico
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(2), 352; https://doi.org/10.3390/microorganisms13020352
Submission received: 21 December 2024 / Revised: 18 January 2025 / Accepted: 22 January 2025 / Published: 6 February 2025
(This article belongs to the Section Molecular Microbiology and Immunology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Coastal lagoons have undergone changes due to anthropogenic activities, the presence of wastewater discharges, and unsustainable practices that alter water quality, favoring the presence of pathogenic microorganisms such as Vibrio. This study identified the presence of the genes for zinc metalloproteinase (HA) Vibrio sp. and choleric toxin (ctx) Vibrio cholerae, associated with the sources of contamination in the Mandinga Coastal Lagoon (MCL). During 2017, samplings were carried out in which sources of contamination associated with anthropogenic activities were identified. At the same time, water samples were collected from which DNA was extracted and the presence/absence of the HA and ctx genes was detected with a PCR analysis. The HA gene was identified in the three seasons of the year, while the ctx gene was only present in the dry and rainy seasons. The prevalence of both genes in the study area was independent of the presence of the pollution sources identified in the area. The absence of the ctx gene during the northern season is associated with the variability of the physicochemical parameters typical of the season.

1. Introduction

The state of Veracruz has 16 coastal lagoons of ecological and economic significance along its coastline [1]. These water bodies exhibit estuarine characteristics, with salinity varying from mesohaline to polyhaline, influenced by hydrological features such as seasonality, tidal exchange, and freshwater influx [2]. Veracruz’s coastal lagoons are essential to produce commercially valuable marine and freshwater organisms, whether in open or closed systems, and for aquaculture conducted in cages or ponds [3]. Among these, the Mandinga Coastal Lagoon (MCL) stands out as one of the most important producers of fishery resources such as oysters, crab, and finfish fishery along the Gulf of Mexico coast [4].
In addition to their productivity, coastal lagoons provide essential environmental services [5,6]. However, these services have been adversely affected by factors such as urbanization and pollution due to cultural and socioeconomic changes. These shifts have led to the development of residential complexes along the lagoon’s periphery, contributing to waste discharge and to increased tourism and commercial activities, which require both domestic and industrial water consumption, subsequently resulting in wastewater production [1,4].
The lack of wastewater treatment can be a significant source of contamination in countries like Mexico, where average annual temperatures and salinity in warm-humid climate regions range between 27.67 and 31.38 °C and 6.27 and 24.18‰ presenting a risk of waterborne disease transmission [7]. Discharges from residential developments, insufficient sanitation measures, and agricultural contaminants have resulted in point sources (urban and industrial waste) and diffuse sources (agrochemical waste). Consequently, it is not surprising to find enterobacteria in filter organisms like oysters and unpleasant odors in the lagoon [8]. Furthermore, surface waters are exposed to meteorological or climatic variations, with climate change likely to raise water temperatures and increase flooding events, thereby elevating the risk of disease transmission to vulnerable coastal populations. This is particularly concerning for bacteria that adapt to aquatic environments, such as Aeromonas spp. and Vibrio spp. [9].
Vibrio cholerae is a pathogenic enterobacterium of the Vibrio genus known to cause a gastroenteric syndrome. It promotes hypersecretion of ions and water in the small intestine and can be highly harmful to humans, especially those who come into direct contact with or consume raw seafood from tropical estuarine environments with significant salinity variations [10,11]. V. cholerae is also associated with cholera epidemics [12]. The pathogenicity of this serogroup is attributed to the presence of the cholera toxin gene (ctx); however, not all bacteria of this genus carry the ctx virulence genes, though they may contain other toxins that cause gastrointestinal inflammation upon ingestion. Therefore, the presence of these bacteria in bodies of water with salinity variability could serve as a reservoir for the spread of virulent strains, posing a potential epidemic risk [10]. One way to detect the cholera toxin gene in Vibrio cholerae is through molecular characterization or analysis of V. cholerae strains collected from aquatic environments [13,14].
In 2009, the National Commission for Knowledge and Use of Biodiversity (CONABIO) conducted a study to identify mangrove sites of biological relevance and those in need of rehabilitation [15]. This study provided insights into the growing anthropogenic development of the area. Therefore, the aim of this study was to identify the presence of the Vibrio sp.-specific zinc metalloproteinase (HA) gene and the Vibrio cholerae-specific ctx gene associated with pollution sources in the Mandinga Coastal Lagoon.

2. Materials and Methods

2.1. Study Area

This research was conducted in the Mandinga Coastal Lagoon (MCL), located in the municipality of Alvarado, Veracruz, Mexico, between latitudes 19°00′ and 19°06′ North and longitudes 96°02′ and 96°06′ West. The lagoon system runs north–south, while the nearby coastline is oriented northwest-southeast, forming the tip of Antón Lizardo and borders Boca del Río municipality to the north and Medellín de Bravo to the southwest (Figure 1). The system covers an area of 3250 hectares and spans a total length of 20 km [16]. It is connected to the Atoyac and Jamapa river basins, which link the Sierra Madre Oriental with the coastal plains of the Gulf of Mexico.
The prevailing climate in the area is warm sub-humid or semi-humid with summer rains, with an average maximum temperature of 28.9 °C and a minimum of 17.2 °C, and an annual precipitation range of 1731 mm [17]. The MCL experiences a dry season (March to June), a rainy summer season (July to October), and a windy season (November to February) [18,19].

2.2. Identification of Pollution Sources

To identify sources of pollution, a characterization of the MCL was performed by comparing satellite images from 2007 and 2017 to locate areas of highest population growth (Figure 2). Using this information, a reconnaissance visit was conducted to refine the sampling design and to identify potential pollution sources and activities in the area. Information was gathered on local activities, the area’s history, and issues perceived by local fishers, with the assistance of the “Cooperativa Fraternidad”. This collaboration helped identify both point and diffuse sources discharging into the MCL. Key informants provided data on sites of interest, which were cross-referenced with bibliographic information about the area. Based on these findings, sampling sites were selected to best represent the different activities conducted in the area.

2.3. Selection and Location of Sampling Sites

Based on the reconnaissance visit and collected information, the MCL was divided into three zones for this study, with 10 sampling sites selected based on their influence from pollution sources and their distribution throughout the system. Zone 1 (one site) encompasses Grande Lagoon; Zone 2 (five sites) covers Redonda Lagoon; and Zone 3 (four sites) includes Larga Lagoon. All sites were georeferenced (Table 1).

2.4. Sample Collection

Sampling was carried out during the rainy season, north winds, and dry season, with six water samples collected at each site following the guidelines of current regulations, which specify sampling at a depth of 15 to 30 cm. Samples were collected in sterile bags (Whirlpak) of 120 mL were used. All water samples were refrigerated at 4° C [20]. In situ measurements of physicochemical parameters, including water temperature, pH, and salinity, were recorded using a YSI 6600 multiparameter probe (584 Park East Drive Woonsocket, RI 02895, USA). Samples were refrigerated at ±4 °C and transported to the Research and Postgraduate Laboratory (LIRA) at the Technological Institute of Boca del Río for processing within 4 h of collection.

2.5. Molecular Identification

After water samples were collected, they were pre-enriched in flasks with 90 mL of alkaline peptone water (APA) + 3% NaCl, adjusted to a pH of 8.4. Each flask was inoculated with 10 mL of sample and incubated for 24 h at 35 °C. After incubation, the flasks were vortexed to homogenize the contents, and 1 mL was extracted for bacterial DNA using the Wizard® Genomic DNA Purification kit (Promega Corporation; Madison, WI, USA). Optimal conditions for PCR amplification were determined through preliminary assays modifying the FDA Bacteriological Analytical Manual: Vibrio specifications, and to the specifications of other authors [21,22], resulting in the following concentrations (Table 2).
PCR analysis was conducted to identify the zinc metalloproteinase gene of the Vibrionaceae family [23,24]. For positive samples, the presence of the cholera toxin gene (ctx) was further identified.
The oligonucleotides used for the polymerase reaction are shown in Table 3, including the gene for zinc metalloproteinase (HA) specific to the Vibrionaceae family and the ctx gene specific to Vibrio cholerae.
PCR assays were performed using PROMEGA reagents, with amplification reactions conducted on an Apollo ATC201 thermocycler. Conditions for Vibrio sp. reactions are shown in Table 4, and those for V. cholerae in Table 5.
For each PCR amplification product, 7 μL were loaded onto a 1% agarose gel (Promega) containing ethidium bromide, a DNA stain, to enable visualization. The gel was then placed in an electrophoresis chamber with 1X TAE buffer (composed of Tris, acetic acid, and EDTA) and subjected to a constant voltage of 90 V for 60 min. To estimate fragment sizes, a 1000 bp molecular weight marker was used alongside positive and negative controls. Finally, the DNA bands were visualized under ultraviolet light using a UVP transilluminator. Successful amplifications were indicated by DNA fragments of approximately 225 bp for Vibrio sp. and 777 bp for V. cholerae.

2.6. Statistical Analysis

Descriptive statistics were used to analyze the physicochemical parameters recorded in the Mandinga coastal lagoon, located in Alvarado, Veracruz, Mexico. In addition, a non-parametric comparative analysis Mann–Whitney U test (p ≤ 0.05) was applied to identify significant differences between the sources of contamination and the presence of the HA gene, specific to Vibrio sp., and the ctx gene, characteristic of Vibrio cholerae, recorded at the sampling sites during the study period. The analyses were performed using the Jamovi program® (version 2.3.26).

3. Results

3.1. Identification and Description of Point Sources in the Study Area

In Zone 1 (S1), water is primarily used for fishing and some aquaculture activities, while the land serves partly as an environmental protection area, preserving mangrove and wetland zones. However, nearby housing developments like the Lomas de la Rioja II subdivision have led to deforestation around the lagoon due to heavy machinery use, causing environmental degradation (Table 6). Site S1 was considered the least impacted, with diffuse pollution sources identified in the area (Table 7).
Zone 2 (S2, S3, S4, S5, and S6) experiences higher levels of human activity, especially around the locality of Mandinga. Water use is mainly divided between two types of activities: (1) tourism, including boat tours, and (2) primary production activities such as oyster farming and shrimp cultivation. The land in this area is predominantly used for residential and commercial purposes, with many local restaurants and cooperative groups dedicated to fishing and the extraction of aquatic resources, especially oysters. An oyster purification plant is also located here. Some mangrove areas remain intact, while others have been converted to agricultural use, primarily for pineapple cultivation (Table 6). Point-source pollution was identified from wastewater outlets near restaurant areas that discharge directly into the lagoon, alongside diffuse sources, such as the pineapple cultivation area (Table 7).
In Zone 3 (S7, S8, S9, and S10), the primary land use consists of residential subdivisions and a commercial plaza, El Dorado. Water activities are mainly tourism-oriented, such as boat tours and recreational watercraft like jet skis. Many residences have private docks and visible drainage outlets. The land use here is primarily urban development, supporting both commercial and residential needs. However, near the connection between Redonda Lagoon and Larga Lagoon, an area is used for cattle grazing (Table 6). In this zone, point-source pollution sources were identified, including direct discharges from homes and the shopping center, along with diffuse sources, such as the grazing area (Table 7).

3.2. Physicochemical Parameters of Water

During the dry season, the highest average water temperature was recorded at Site 7. The lowest temperature was observed at Site 10. In the rainy season, the highest recorded temperature was at Sites 4 and 5, while the lowest was at Site 9. During the windy season, the maximum average water temperature was measured at Sites 7 and 8, with the other sites recording a consistent 25 °C. In terms of pH, the highest average value during the dry season was at Site 8, while the lowest was at Site 1. During the rainy season, Site 5 showed the highest pH, and Site 1 had the lowest. In the windy season, the maximum pH was recorded at Site 6, while the lowest was at Site 1. Salinity peaked during the dry season at Site 9, while the lowest was at Site 1. In the rainy season, the highest average salinity was recorded at Site 8, and the lowest was at Site 10. During the windy season, the highest salinity was measured at Site 10, and the lowest at Site 4 (Table 8).

3.3. HA Genes of Vibrio sp. and of the ctx Gene of Vibrio cholerae

Positive results for the Vibrio sp.-specific zinc metalloproteinase (HA) gene were obtained at sites S4, S5, S6, S7 and S8 during the dry and rainy seasons. Likewise, sites S6, S7 and S8 were positive for Vibrio sp. during the northern season. At site S5, the Vibrio sp.-specific zinc metalloproteinase (HA) gene and the V. cholerae-specific cholera toxin (ctx) gene were detected (Table 9).
The PCR analysis results are shown in Figure 3. Lane M displays the 1000 bp marker ladder, Lane C-includes a negative control, Lanes 1 to 6 contain sample results, and Lane C+ has a positive control for Vibrio sp. In Lane 6, a 225 bp band was amplified, corresponding to Vibrio sp. (Figure 3a). In Figure 3b, Lane C+ shows the positive control for the cholera toxin gene (ctx). Lane 1 shows a 777 bp band, which corresponds to V. cholerae (Figure 3b).
Regarding the relationship between Vibrio sp. and V. cholerae and both point and diffuse contamination sources in the Mandinga Coastal Lagoon (MCL), Zone 1 yielded negative results for both bacteria. This zone is used primarily for fishing activities and aquaculture enclosures, with some protected environmental areas remaining intact. In Zone 2, where point sources included wastewater discharges from restaurants and residences and diffuse sources stemmed from agricultural activities like pineapple cultivation, both bacteria were detected. Specifically, Site 5 showed the presence of both bacteria during the dry and rainy seasons, though results were negative during the windy season. At Site 6, Vibrio sp. was present during the dry and windy seasons, but V. cholerae was not detected.
Zone 3, characterized by extensive residential, tourism, and commercial activities, also showed positive results for Vibrio sp. Site 7 was positive during the dry and windy seasons, while Site 8 showed positivity during the rainy and dry seasons. However, no V. cholerae was detected in this zone. The primary point sources of contamination here were direct discharges from residences and the commercial center, with diffuse sources linked to livestock grazing areas.
The results showed a higher prevalence of the presence of the HA gene specific to Vibrio sp. in the disuse, diffuse and point sources. However, the statistical analysis carried out determined that there are no significant differences (p > 0.05) between the sources of contamination and the detection of the presence of the HA gene p = (0.270) and the ctx gene specific to V. Cholerae p = (0.307) during the study period.

4. Discussion

The zoning conducted in this study was based on land and water usage patterns, which reflect the various anthropogenic activities occurring in the Mandinga Coastal Lagoon (MCL). Coastal lagoons are productive, biodiverse environments with high-quality landscapes, supporting diverse activities [25,26]. This is consistent with the land use trend reported in the area by another study, such as anthropogenic and agricultural-livestock development, where anthropogenic development continues to be a growing constant [27]. Unfortunately, these activities are associated with the production of sources of pollution, as revealed by a study in the coastal area adjacent to the MCL, where 88 storm drains were identified, 50 drains with the presence of wastewater discharge and four drains with the presence of unidentified water. The main economic activities identified were tourism, commerce, fishing and services [28]. During the dry season, a positive correlation was found between the presence of hotels and the presence of point source pollution discharges on the surrounding beaches of the Veracruz-Boca del Río coastal zone; these pollution sources have a dispersion radius of 31.398 km to 73.965 km of influence around the zone. Therefore, it was determined that the persistence of nearby wastewater can affect the transparency and dissolved oxygen of the water, facilitating the growth of pathogenic organisms in the area [29].
In the vicinity of Zone 1 (Grande Lagoon), diffuse pollution sources were identified, with signs of land subdivision and the presence of heavy machinery used for street construction, lighting, and sewer systems. However, in the Grande Lagoon sampling site, land and water use is primarily designated for fishing and environmental protection, making it the least impacted zone. It was thus used as a reference site for other samplings since areas of natural vegetation, particularly mangrove forests, are still conserved here. This low-impact status likely contributed to the absence of Vibrio sp. and V. cholerae.
The MCL has natural and coastal areas with characteristics of economic interest and a privileged location, where urban growth is a constant. Therefore, it is recommended to periodically carry out evaluations on the change in land use, which allows the protection and preservation of this ecosystem [27]. The implementing strategies aimed at protecting coastal wetlands in buffer zones near human settlements could reduce pollutant discharges, particularly during climatic events, and that measures raising awareness of environmental protection activities could help decrease water contamination in coastal systems [30].
Other authors argue that coastal lagoons are typically impacted by human activities like wastewater discharges, hydrological modifications, and land use changes [31], which can disrupt ecological functioning, system self-regulation, and provision of ecosystem services [5]. There are antecedents of the presence of Vibrionaceae in the coastal lagoon of Mandinga [32,33]. In this study, the HA gene specific to Vibrio sp. was identified during the three seasons of the year and the ctx gene during the dry and rainy seasons in zones 2 and 3. The presence of the specific gene for V. Cholerae may vary with seasonal changes in environmental parameters [33]. In addition, these zones presented point and diffuse sources of contamination. This indicates that this type of bacteria is typical of these ecosystems that have a tendency to change land use, which generates a negative impact that favors the presence of genes related to the HA and ctx. These bacteria in these environments in other parts of the world are considered ubiquitous organisms [34]. This shows that brackish water bodies are reservoirs of this type of bacteria [26,35]. These results align with findings from other authors, who observed human-pathogenic Vibrio species present year-round, indicating a continuous potential for infection. They also detected three potentially pathogenic Vibrio strains in coastal waters [36].
The increase in organic matter during summer in coastal lagoons stems from human activities that produce dissolved and suspended particulate matter, originating from agricultural and industrial runoff [26]. These conditions could correlate with the presence of Vibrio in Zone 2 of the MCL, which had average temperatures of 20–29 °C, pH up to 7.9, and salinity levels between 18 and 20 PSU. In Site 5, where the cholera toxin gene was detected in the dry and rainy seasons, higher organic matter levels may result from shrimp and oyster farming, which serve as reservoirs for Vibrio strains, posing potential risks to consumers, as described by other authors [22,37]. They identified Vibrio spp. in Crassostrea virginica oyster samples from other Veracruz lagoon systems, with V. cholerae strains detected during the north wind season in oysters obtained from cooperatives. This suggests that Vibrio strains show adaptability to low temperatures and the ability to colonize organisms post-harvest for consumption.
That aquaculture activities in coastal ecosystems maintain high salinity, suspended solids, organic matter, and bacteria similar to Vibrio spp. [38,39]. The presence of Vibrio spp. in cultivated organisms poses infection risks when consumed raw, potentially causing gastrointestinal illness [40]. Socioeconomic activities such as tourism could also have an impact, given that Mandinga is the most densely populated area in the study [1,41].
Vibrio presence is also linked to lagoon depth; in another study, significant differences were determined between water samples taken at the surface and at the bottom, with sediment resuspension promoting the presence of these bacteria in the water column [42]. The MCL has an average depth of 1 m, with maximum depths of 3.6 m and minimum levels of 0.5 m, categorizing it as a shallow system [43]. The shallow depth and water currents could have influenced Vibrio sp. presence in the sampling sites. Other researchers found higher concentrations of Vibrio spp. and Enterococcus spp. in sediments compared to the water column [44]. They also found that bacteria like E. coli, Salmonella paratyphi, and V. parahaemolyticus survive better in sediment than in surface water, likely due to sediment characteristics that enhance pathogen survival. This is explained by the fact that in the sediment, the particle size as well as the high content of organic carbon enhance the survival of indicator and pathogenic bacteria [45]. That the water column is composed of up to 71% organic matter, while sediments are mainly composed of protein-like components and provide protection and nutrient supply and adhesion substrates for these types of bacteria [26,44].
During the study period in the MCL, activities like mechanical dredging, boat tours, anchoring with wooden posts, and manual shellfish collection disturbed the bottom, promoting sediment resuspension and water quality degradation. Besides depth, Vibrio presence in Sites 4, 5, 6, 7, and 8 may have been influenced by wastewater discharges from tourist and residential areas, which, while lacking detailed composition data, may provide nutrients that promote microbial growth [46]. Zone 3 had two positive sites, S7 and S8, showing Vibrio sp. presence but no V. cholerae.
Regarding anthropogenic activity, Zone 3 has fewer inhabitants since many residential subdivisions are used as vacation homes, resulting in a lower population density than Zone 2. This zone, located near the sea, also contains the navigation channel and is the deepest area in the system. Spatial-temporal variations in Vibrio sp. patterns in our study may relate to suspended particle concentrations, indicating the importance of determining an appropriate sampling depth, as recommendations often favor sediment-based sampling [47]. It is important to highlight that Vibrio species in coastal marine systems form a bacterial group involved in various interactions with other ecosystem components, contributing significantly to the life cycles of different marine organisms. However, some Vibrio species are pathogenic [48]. Even though environmental isolates of V. cholerae may occasionally lack the ctx gene, this does not rule out the potential for its presence [49].
The detecting Vibrio strains and V. cholerae-related genes via PCR techniques in coastal lagoons can help manage microbial risks from contaminated shellfish [50]. Continued environmental education through scientific research is crucial to fostering environmental discipline and sustainable coastal resource management [51]. Regulatory authorities, marine resource producers, and health professionals must also monitor coastal lagoons to mitigate bacterial risks [52]. In the MCL, proper hygiene practices, responsible fishery management [53], and environmental monitoring are essential for maintaining resource health and public safety [8].

5. Conclusions

Identifying the sources of both point and diffuse contamination in the Mandinga Coastal Lagoon allowed us to describe shifts in land and water use, helping to pinpoint areas with the highest anthropogenic activity. The prevalence of the zinc metalloproteinase (HA) gene specific for Vibrio sp., and the cholera toxin gene (ctx) specific for Vibrio cholerae are independent of the presence of the diffuse and point sources of contamination identified in the area. However, factors such as negative environmental impact can increase the tendency of the presence of the genes of these bacteria in highly impacted environments. The presence of the HA gene Vibrio sp. is independent of the season of the year since positive results were obtained in the three seasons sampled, while the absence of the ctx gene Vibrio cholerae in the northern season is associated with the variability of the physicochemical parameters typical of the season. The spatial distribution of both bacteria is related to activities such as oyster farming, shrimp farming, pineapple farming, discharge of wastewater from restaurants, direct discharge of wastewater from residential/commercial homes, and cattle grazing areas.

Author Contributions

Conceptualization, M.d.R.C.-C., M.G.S.-G. and R.E.A.-M.; methodology, C.R.-V., M.d.R.C.-C. and R.E.A.-M.; validation, M.d.R.C.-C., C.R.-V., F.L.-R. and R.E.Z.-A.; investigation, M.d.R.C.-C., C.R.-V., R.E.Z.-A., F.L.-R., M.G.S.-G. and R.E.A.-M.; resources, M.d.R.C.-C., C.R.-V., F.L.-R. and M.G.S.-G.; writing—original draft preparation, M.d.R.C.-C., R.E.A.-M. and M.G.S.-G.; writing—review and editing, M.d.R.C.-C. and M.G.S.-G.; visualization, M.d.R.C.-C., C.R.-V., F.L.-R. and R.E.Z.-A.; supervision, M.d.R.C.-C., C.R.-V. and M.G.S.-G.; project administration, M.d.R.C.-C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

This research was carried out with the financial support of the Instituto Tecnológico Nacional de México/Instituto Tecnológico de Boca del Río (TecNM/ITBOCA) and of the Consejo Nacional de Ciencia y Tecnología (CONAHCYT).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Aldeco, J.; Avalos, G.C.; Molina, J.J. Adaptaciones culturales y económicas a cambios provocados por tala de mangle y deterioro pesquero en Mandinga, Veracruz. Soc. Rural. Prod. Y Medio Ambiente 2015, 29, 137–158. [Google Scholar]
  2. Arceo-Carranza, D.; Chávez-López, R. Cambio Climático, Estuarios e Hipersalinidad. In Tópicos de Agenda Para la Sostenibilidad de Costa y Mares Méxicanos, 1st ed.; Rivera-Ariaga, E., Sánchez-Gil, P., Gutiérrez, J., Eds.; Universidad Autónoma de Campeche: San Francisco de Campeche, Mexico, 2019; pp. 275–290. ISBN 978-607-8444-57-1. [Google Scholar] [CrossRef]
  3. Salcedo-Garduño, M.G.; Castañeda-Chávez, M.R.; Lango-Reynoso, F.; Sosa-Villalobos, C.A.; Landeros-Sánchez, C.; Galaviz-Villa, I. Influence of physicochemical parameters on phytoplankton distribution in the lagoon system of Mandinga, Mexico. Rev. Bio Cien. 2019, 6, e427. [Google Scholar] [CrossRef]
  4. Lango-Reynoso, V.; González-Figueroa, K.T.; Lango-Reynoso, F.; Castañeda-Chávez, M.R.; Montoya-Mendoza, J. Assessment of land-use change in coastal areas through geographical information systems. Agro Product. 2020, 13, 97–111. [Google Scholar] [CrossRef]
  5. MEA. Ecosystems and Human Well-Being: Synthesis; Island Press: Washington, DC, USA, 2005; Available online: https://vtechworks.lib.vt.edu/items/05f6e5e0-3cac-4418-bc7d-9a4edc5fbab0 (accessed on 20 August 2024).
  6. Lara-Domínguez, A.L.; Contreras-Espinosa, F.; Castañeda-López, O.; Barba-Macías, E.; Pérez-Hernández, M.A. Lagunas costeras y estuarios. In La biodiversidad en Veracruz: Estudio de Estado. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad; Conabio, Gobierno del Estado de Veracruz, Universidad Veracruzana, Instituto de Ecología: Xalapa, Veracruz, Mexico, 2011; pp. 297–313. [Google Scholar]
  7. Castañeda-Chávez, M.R.; Lango-Reynoso, F. Impact of the Jamapa River Basin on the Gulf of Mexico. In River Deltas Research—Recent Advances; Manning, A.J., Ed.; IntechOpen: London, UK, 2022. [Google Scholar] [CrossRef]
  8. Castañeda-Chávez, M.R.; Sedas, V.P.; Orrantia Borunda, E.; Reynoso, F.L. Influence of Water Temperature and Salinity on Seasonal Occurrences of Vibrio Cholerae and Enteric Bacteria in Oyster-Producing Areas of Veracruz, México. Mar. Pollut. Bull. 2005, 50, 1641–1648. [Google Scholar] [CrossRef]
  9. Escobar, L.E.; Ryan, S.J.; Stewart-Ibarra, A.M.; Finkelstein, J.L.; King, C.A.; Qiao, H.; Polhemus, M.E. A Global Map of Suitability for Coastal Vibrio Cholerae under Current and Future Climate Conditions. Acta Trop. 2015, 149, 202–211. [Google Scholar] [CrossRef] [PubMed]
  10. Rajpara, N.; Vinothkumar, K.; Mohanty, P.; Singh, A.K.; Singh, R.; Sinha, R.; Nag, D.; Koley, H.; Kushwaha Bhardwaj, A. Synergistic effect of various virulence factors leading to high toxicity of environmental V. cholerae non-O1/ non-O139 isolates lacking ctx gene: Comparative study with clinical strains. PLoS ONE 2013, 8, e76200. [Google Scholar] [CrossRef]
  11. Córdoba Meza, T.; Espinosa Díaz, L.F.; Vivas Aguas, L.J. Ocurrencia y distribución de Vibrio cholerae cultivable en la Ciénega Grande de Santa Marta, Caribe Colombiano. Acta Biolo. Colomb. 2021, 27, 199–207. [Google Scholar] [CrossRef]
  12. Bravo, L.; Ramírez, M.; Maestre, J.L.; Llop, A.; Cabrera, R.; García, B.; Férnandez, A.; Castañeda, N. Vibrio cholerae No-01 toxigénico. Rev. Cubana Med. Trop. 2000, 52, 106–109. Available online: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S0375-07602000000200005&lng=es&tlng=es (accessed on 28 September 2024). [PubMed]
  13. Olivares, F.; Domínguez, I.; Dabanch, J.; Porte, L.; Teresa Ulloa, M.; Osorio, Y.G. Bacteremia caused by Vibrio cholerae non-O1/non-O139 carrying a region homologous to pathogenicity island VpaI-7 Rev. Chilena Infectol. 2019, 36, 392–395. Available online: https://www.scielo.cl/pdf/rci/v36n3/0716-1018-rci-36-03-0392.pdf (accessed on 25 September 2024). [CrossRef] [PubMed]
  14. Singh, D.V.; Matte, M.H.; Matte, G.R.; Jiang, S.; Sabeena, F.; Shukla, B.N.; Sanyal, S.C.; Huq, A.; Colwell, R.R. Molecular analysis of Vibrio cholerae O1, O139, non-O1, and non-O139 strains: Clonal relationships between clinical and environmental isolates. Appl. Environ. Microbiol. 2001, 67, 910–921. [Google Scholar] [CrossRef]
  15. Lara-Domínguez, A.L.; López-Portillo, J.; Ávila-Ángeles, A.; Vázquez-Lule, A.D. Caracterización del sitio de manglar Tuxpan, en Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO). Sitios de Manglar con Relevancia Biológica y con Necesidades de Rehabilitación Ecológica; CONABIO: México city, Mexico, 2009; Available online: http://www.conabio.gob.mx/conocimiento/manglares/doctos/caracterizacion/GM56_Tuxpan_caracterizacion.pdf (accessed on 20 August 2024).
  16. Contreras-Espinosa, F. Lagunas costeras de Veracruz. In Estrategias Para el Manejo Integral de la Zona Costera: Un Enfoque Municipal, 1st ed.; Moreno-Casasola, P., Peresbarbosa, E.R., Travieso-Bello, A.C., Eds.; Instituto de Ecología A. C., Comisión Nacional de Áreas Naturales Protegidas (SEMARNAT), Gobierno del Estado de Veracruz: Xalapa, Mexico, 2006; Volume 1, pp. 206–225. [Google Scholar]
  17. CONAGUA. Comisión Nacional del Agua. Desarrollo. Resúmenes Mensuales de Temperaturas y Lluvia. Gob.mx. Available online: https://smn.conagua.gob.mx/es/climatologia/temperaturas-y-lluvias/resumenes-mensuales-de-temperaturas-y-lluvias (accessed on 20 August 2024).
  18. García, E. Modificaciones al Sistema de Clasificación Climática de Köppen. (Para Adaptarlo a las Condiciones de la República Mexicana), 1st ed.; Instituto de Geografía, UNAM: Mexico City, Mexico, 2004; p. 90. Available online: http://www.publicaciones.igg.unam.mx/index.php/ig/catalog/book/83 (accessed on 20 August 2024).
  19. Rodríguez-Varela, A.C.; Barreto-Segura, O.A.; Vázquez-López, H. Diversidad de invertebrados bentónicos del sistema lagunar de Mandinga, Veracruz, México. Novit. Caribaea 2019, 14, 128–146. [Google Scholar] [CrossRef]
  20. Norma Mexicana NMX-AA-042-SCFI-2015. Análisis de Agua, Enumeración de Organismos Coliformes Totales, Organismos Coliformes Fecales (Termotolerantes) y Escherichia coli—Método del Número Más Probable en Tubos Múltiples. Available online: https://www.gob.mx/cms/uploads/attachment/file/166147/nmx-aa-042-scfi-2015.pdf (accessed on 10 January 2025).
  21. Panicker, G.; Myers, M.L.; Bej, A.K. Rapid detection of Vibrio vulnificus in shellfish and Gulf of Mexico water by real-time PCR. Appl. Environ. Microbiol. 2004, 70, 498–507. [Google Scholar] [CrossRef] [PubMed]
  22. Galaviz-Villa, I.; Castañeda-Chavez, M.R.; Lango-Reynoso, F.; Amaro-Espejo, I.A.; Romero-González, L.; Salcedo-Garduño, M.G.; Sánchez-Chavez, A. Detection of Vibrio parahaemolyticus (tlh) and virulence factors in Oyster Crassostrea virginica in the Gulf of Mexico. Bio Cienc. 2017, 4, 1–15. [Google Scholar] [CrossRef]
  23. Sussman, M.; Willis, B.L.; Victor, S.; Bourne, D.G. Coral Pathogens Identified for White Syndrome (WS) Epizootics in the Indo-Pacific. PLoS ONE 2008, 3, e2393. [Google Scholar] [CrossRef]
  24. U.S. Food and Drug Administration, FDA. BAM Chapter 9: Vibrio. (18 Diciembre 2024). Available online: https://www.fda.gov/food/laboratory-methods-food/bam-chapter-9-vibrio (accessed on 10 January 2025).
  25. Herrera-Silveira, J.A. Coastal Lagoon of Yucatan (Se, Mexico): Research, diagnostic and management. Ecorópicos 2006, 19, 94–108. [Google Scholar]
  26. Amaral, V.; Santos-Echeandía, J.; Ortega, T.; Álvarez-Salgado, X.A.; Forja, J. Dissolved Organic Matter Distribution in the Water Column and Sediment Pore Water in a Highly Anthropized Coastal Lagoon (Mar Menor, Spain): Characteristics, Sources, and Benthic Fluxes. Sci. Total Environ. 2023, 896, 165264. [Google Scholar] [CrossRef]
  27. González-Figueroa, K.T.; Lango-Reynoso, F.; Lango-Reynoso, V.; Castañeda-Chávez, M.R.; Montoya-Mendoza, J. Cambio de uso de suelo en el sistema lagunar de Mandinga. In Avances en Investigación Agrícola, Pecuaria, Forestal, Acuícola, Pesquería, Desarrollo Rural, Transferencia de Tecnología, Biotecnología, Ambiente, Recursos Naturales y Cambio Climático, 1st ed.; Vinay, V.J.C., Esqueda, E.V.A., Tosquy, V.O.H., Zetina, L.R., Ríos, A.U., Vázquez, H.M.V., Del Angel, P.A.L., Perdomo, C.M., Eds.; INIFAP, CP, UACH, INAPESCA, UV, TecNM: Medellín, Veracruz, Mexico, 2019; pp. 1687–1696. [Google Scholar]
  28. Pérez Jiménez, J.C. Dispersión e Influencia de Fuentes Puntuales de Contaminación de la Zona Costera Adyacente al Parque Nacional Sistema Arrecifal Veracruzano. Ph.D. Thesis, Tecnológico Nacional de México/Instituto Tecnológico de Boca del Río, Maestría en Ciencias en Ingeniería Ambiental, Boca del Río, Veracruz, Mexico, 2023. [Google Scholar]
  29. Pérez Jiménez, J.C.; Jiménez, C.M.; Reynoso, F.L.; Chávez, M.D. Fuentes de contaminación terrestres con impactos en arrecifes coralinos de la zona centro del golfo de México. BIOCYT Biol. Cienc. YTecnol. 2023, 16, 1146–1152. [Google Scholar] [CrossRef]
  30. Espinoza-Tenorio, E.; Barba-MacÌas, E. Las Lagunas Costeras tropicales ante el cambio climático. Ecofronteras 2013, 49, 1–4. Available online: https://ecosur.repositorioinstitucional.mx/jspui/bitstream/1017/2387/1/52866_Documento.pdf (accessed on 28 September 2024).
  31. Menció, A.; Casamitjana, X.; Mas-Pla, J.; Coll, N.; Compte, J.; Martinoy, M.; Pascual, J.; Quintana, X.D. Groundwater Dependence of Coastal Lagoons: The Case of La Pletera Salt Marshes (NE Catalonia). J. Hydrol. 2017, 552, 793–806. [Google Scholar] [CrossRef]
  32. Reyes-Velázquez, C.; Castañeda-Chávez, M.; Landeros-Sánchez, C.; Galaviz-Villa, I.; Lango-Reynoso, F.; Minguez-Rodriguez, M.M.; Nikolskii-Gavrilov, I. Pathogenic vibrios in the oyster Crassostrea virginica in the lagoon system of Mandinga, Veracruz, Mexico. Hidrobiologica 2010, 20, 238–245. Available online: https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S0188-88972010000300006&lng=es&nrm=iso&tlng=en (accessed on 15 January 2025).
  33. López-Hernández, K.M.; Pardío-Sedas, V.; Lizárraga-Partida, L.; de Williams, J.J.; Martínez-Herrera, D.; Flores-Primo, A.; Uscanga-Serrano, R. Seasonal abundance of Vibrio cholerae non O1/non O139 chxA+ in oysters harvested in a coastal lagoon of Mexico’s Gulf coast: A seafood safety risk concern. Food Control 2015, 53, 46–54. [Google Scholar] [CrossRef]
  34. Rehm, C.; Lippert, K.; Indra, A.; Kolarević, S.; Kračun-Kolarević, M.; Leopold, M.; Steinbacher, S.; Schachner, I.; Campostrini, L.; Risslegger, A.; et al. First report on the occurrence of Vibrio cholerae nonO1/nonO139 in natural and artificial lakes and ponds in Serbia: Evidence for a long-distance transfer of strains and the presence of Vibrio paracholerae. Environ. Microbiol. Rep. 2023, 15, 142–152. [Google Scholar] [CrossRef]
  35. Anas, A.; Krishna, K.; Vijayakumar, S.; George, G.; Menon, N.; Kulk, G.; Chekidhenkuzhiyil, J.; Ciambelli, A.; Kuttiyilmemuriyil Vikraman, H.; Tharakan, B.; et al. Dynamics of Vibrio cholerae in a typical tropical lake and estuarine system: Potential of remote sensing for risk mapping. Remote Sens. 2021, 13, 1034. [Google Scholar] [CrossRef]
  36. Machado, A.; Bordalo, A.A. Detection and Quantification of Vibrio Cholerae, Vibrio Parahaemolyticus, and Vibrio Vulnificus in Coastal Waters of Guinea-Bissau (West Africa). Ecohealth 2016, 13, 339–349. [Google Scholar] [CrossRef] [PubMed]
  37. Hernández-Mendoza, D.M.; San Martín-del Ángel, P.; Jiménez-Torres, C.; Hernández-Herrera, R.I. Monitoring of Vibrio spp. in oysters Crassostrea virginica from Tamiahua and Tampamachoco lagoons, Veracruz, Mexico. Rev. Biológico Agropecu. Tuxpan 2021, 9, 122–141. [Google Scholar] [CrossRef]
  38. Barraza-Guardado, R.H.; Arreola-Lizárraga, J.A.; López-Torres, M.A.; Casillas-Hernández, R.; Miranda-Baeza, A.; Magallón-Barrajas, F.; Ibarra-Gámez, C. Effluents of Shrimp Farms and Its Influence on the Coastal Ecosystems of Bahía de Kino, Mexico. Sci. World J. 2013, 2013, 306370. [Google Scholar] [CrossRef]
  39. Hernández, H.D.M. Monitoreo de Bacterias Vibrio sp. en Ostiones Crassostrea virginica de las Lagunas de Tamiahua y Tampamachoco, Veracruz, México. Ph.D. Thesis, Universidad Veracruzana, Facultad de Ciencias Biológicas y Agropecuarias, Maestría en Ciencias del Ambiente, Tuxpan, Veracruz, Mexico, 2018. [Google Scholar]
  40. Barrantes, E.B. Efectos de la bacteria patógena Vibrio parahaemolyticus en camarones (Litopenaeus vannamei) de cultivo y en la salud del consumidor. Pensam. Actual 2023, 23, 39–50. [Google Scholar] [CrossRef]
  41. Salazar, M.E.; Calleja, J.; Cisneros, L. La influencia de la modernización en el paisaje turístico de una región costera. In Retos de las Ciencias Administrativas Desde las Economías Emergentes: Evolución de Sociedades; Universidad Veracruzana: Xalapa, Mexico, 2012; pp. 1–16. [Google Scholar]
  42. Koh, E.G.; Huyn, J.H.; LaRock, P.A. Pertinence of Indicator Organisms and Sampling Variables to Vibrio Concentrations. Appl. Environ. Microbiol. 1994, 60, 3897–3900. [Google Scholar] [CrossRef]
  43. Navarrete, R.G. El ostión Crassostrea virginica Como Bioindicador de la Presencia de Endosulfán en el Sistema Lagunar Mandinga, Veracruz, y Riesgo a la Salud Pública por el Consumo de este Molusco. Ph.D. Thesis, Colegio de Postgraduados, Campus Veracruz, Veracruz, Mexico, 2016. [Google Scholar]
  44. Fries, J.S.; Characklis, G.W.; Noble, R.T. Sediment-Water Exchange of Vibrio sp. and Fecal Indicator Bacteria: Implications for Persistence and Transport in the Neuse River Estuary, North Carolina, USA. Water Res. 2007, 42, 941–950. [Google Scholar] [CrossRef] [PubMed]
  45. Chandran, A.; Varghese, S.; Kandeler, E.; Thomas, A.; Hatha, M.; Mazumder, A. An Assessment of Potential Public Health Risk Associated with the Extended Survival of Indicator and Pathogenic Bacteria in Freshwater Lake Sediments. Int. J. Hyg. Environ. Health 2011, 214, 258–264. [Google Scholar] [CrossRef]
  46. Cavallo, R.A.; Stabili, L. Presence of Vibrios in Seawater and Mytilus Galloprovincialis (Lam.) from the Mar Piccolo of Taranto (Ionian Sea). Water Res. 2002, 36, 3719–3726. [Google Scholar] [CrossRef]
  47. Siboni, N.; Balaraju, V.; Carney, R.; Labbate, M.; Seymour, J.R. Spatiotemporal Dynamics of Vibrio spp. within the Sydney Harbour Estuary. Front. Microbiol. 2016, 7, 460. [Google Scholar] [CrossRef]
  48. Leyton, Y.; Riquelme, C. Vibrios in the marine coastal systems. Rev. Biol. Mar. Oceanogr. 2008, 43, 441–456. [Google Scholar] [CrossRef]
  49. Tamrakar, A.K.; Goel, A.K.; Kamboj, D.V.; Singh, L. Surveillance Methodology for Vibrio Cholerae in Environmental Samples. Int. J. Environ. Health Res. 2006, 16, 305–312. [Google Scholar] [CrossRef]
  50. Lee, J.-H.; Park, S.-K.; Khan, F.; Jo, D.-M.; Lee, D.-H.; Kang, M.-G.; Kim, Y.-M. Simultaneous Isolation and Enumeration of Virulent Vibrio Cholerae and Vibrio Vulnificus Using an Advanced MPN-PCR Method. Arch. Microbiol. 2021, 204, 5. [Google Scholar] [CrossRef]
  51. García Montero, G.; Smith Rodríguez, K. Estrategia de Educación y Popularización Ambiental: Una visión desde el Acuario Nacional de Cuba. Cub Medio Ambiente Y Desarro 2024, 24. Available online: https://cmad.ama.cu/index.php/cmad/article/view/364 (accessed on 15 October 2024).
  52. Sampaio, A.; Silva, V.; Poeta, P.; Aonofriesei, F. Vibrio spp.: Life Strategies, Ecology, and Risks in a Changing Environment. Diversity 2022, 14, 97. [Google Scholar] [CrossRef]
  53. Galaviz-Villa, I.; Lango-Reynoso, F.; Castañeda-Chávez, M.R. Estudio de la Calidad Sanitaria del Ostión del Golfo de México; Editorial Académica Española: Saarbrücken, Germany, 2013. [Google Scholar]
Microorganisms 13 00352 g001
Figure 1. Study area and sampling site locations in the Mandinga Coastal Lagoon, Alvarado, Veracruz, Mexico.
Figure 1. Study area and sampling site locations in the Mandinga Coastal Lagoon, Alvarado, Veracruz, Mexico.
Microorganisms 13 00352 g001
Microorganisms 13 00352 g002
Figure 2. Comparison of satellite images of the Mandinga Coastal Lagoon, Alvarado, Veracruz, Mexico.
Figure 2. Comparison of satellite images of the Mandinga Coastal Lagoon, Alvarado, Veracruz, Mexico.
Microorganisms 13 00352 g002
Microorganisms 13 00352 g003
Figure 3. Presents the PCR results: (a) shows the identification of the genes for zinc metalloproteinase (HA) Vibrio sp., while (b) confirms the presence of the choleric toxin (ctx) in V. cholerae. In the Mandinga Coastal Lagoon water samples.
Figure 3. Presents the PCR results: (a) shows the identification of the genes for zinc metalloproteinase (HA) Vibrio sp., while (b) confirms the presence of the choleric toxin (ctx) in V. cholerae. In the Mandinga Coastal Lagoon water samples.
Microorganisms 13 00352 g003
Table 1. Geographic coordinates of selected sampling sites.
Table 1. Geographic coordinates of selected sampling sites.
SiteLatitudeLongitudeDescription
119.0474−96.0736Mangrove area
219.0378−96.0709Aquaculture area
319.0481−96.0749Oyster purification plant
419.0498−96.0776Restaurant area
519.0577−96.0899Mangrove area
619.0460−96.0981Boca de Matosa
719.0578−96.1088Punta Tiburón residential area
819.0828−96.1119Villa Rica Golf Club
919.0828−96.1057El Conchal residential area
1019.0925−96.1044El Dorado shopping center
Table 2. Reagent concentrations used for PCR.
Table 2. Reagent concentrations used for PCR.
ReagentConcentration
Buffer1X
MgCl21.5 mM
dNTPs200 mM
Forward Primer (F)0.5 μM
Reverse Primer (R)0.5 μM
DNA40 ng
GoTaq2.5 U
Table 3. Oligonucleotide sequences used in PCR reactions conditions for the detection of HA and ctx gene.
Table 3. Oligonucleotide sequences used in PCR reactions conditions for the detection of HA and ctx gene.
PrimerSequence 5′-3′bpReference
HA-FCATGAGGTCAGCCACGGTTTTACTGAGCAG225Sussman, M., Willis, B.L, et al., 2008 [23]
HA-RCGCGCGGTTAAACACGCCACTCGAATGGTGAAC Sussman, M., Willis, B.L, et al., 2008 [23]
CTaTGA AAT AAA GCA GTC AGG TG777FDA-BAM [24]
CTbGGT ATT CTG CAC ACA AAT CAG FDA-BAM [24]
Table 4. Amplification conditions for the detection of HA gene of Vibrio sp.
Table 4. Amplification conditions for the detection of HA gene of Vibrio sp.
PhaseNo. of CyclesTimeTemperature
Denaturation15 min94 °C
20 s94 °C
Amplification3020 s55 °C
1 min72 °C
Extension15 min72 °C
Table 5. Amplification conditions for the detection of the ctx gene of Vibrio cholerae.
Table 5. Amplification conditions for the detection of the ctx gene of Vibrio cholerae.
PhaseNo. of CyclesTimeTemperature
Denaturation13 min94 °C
1 min94 °C
Amplification351 min55 °C
1 min72 °C
Extension13 min72 °C
Table 6. Identification of anthropogenic activities in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
Table 6. Identification of anthropogenic activities in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
ZoneWater UseLand Use
1Rural fishing activitiesEnvironmental protection
Aquaculture enclosuresResidential
2Tourism activitiesHousing
Oyster andCommercial
Shrimp farmingAgricultural
3ResidentialResidential
Tourism andCommercial
Recreational useLivestock grazing
Table 7. Pollution sources in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
Table 7. Pollution sources in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
LagoonSiteDescriptionPollution Source
1Grande1Mangrove areaDiffuse
2Redonda2Aquaculture areaPoint and Diffuse
3Oyster purification plant
4Restaurant area
5Mangrove area
6Boca de Matosa
3Larga7Punta Tiburón Residential areaPoint and Diffuse
8Villa Rica Golf Club
9El Conchal Residential area
10El Dorado Shopping Center
Table 8. Monthly means for the water physicochemical parameters in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
Table 8. Monthly means for the water physicochemical parameters in the Mandinga Coastal Lagoon, Alvarado, Veracruz.
T (°C)pHSalinity (UPS)
Dry season
Mean28.13 ± 0.357.93 ± 0.20525.03 ± 1.13
Maximum28.45 ± 0.218.15 ± 0.0726.70 ± 0.007
Minimum27.35 ± 0.077.45 ± 0.0723.46 ± 0.014
Rainy season
Mean28.23 ± 0.757.64 ± 0.2215.99 ± 1.59
Maximum29.05 ± 0.077.950 ± 0.0718.54 ± 0.148
Minimum26.950 ± 0.077.25 ± 0.0712.80 ± 0.056
Windy season
Mean25.20 ± 0.4067.96 ± 0.05125.35 ± 0.92
Maximum26 ± 0.008.02 ± 0.00522.32 ± 0.01
Minimum25 ± 0.007.84 ± 0.03620.05 ± 0.05
T °C: Temperature; pH: Hydrogen potential; PSU: Practical Salinity Unit.
Table 9. Annual results showing presence (+) or absence (−) of HA gene of Vibrio sp. and of the ctx gene of Vibrio cholerae in sampling sites by zone.
Table 9. Annual results showing presence (+) or absence (−) of HA gene of Vibrio sp. and of the ctx gene of Vibrio cholerae in sampling sites by zone.
ZoneSiteDry SeasonRainy SeasonWindy Season
Vibrio sp.V. choleraeVibrio sp.V. choleraeVibrio sp.V. cholerae
11−−−−−−
22−−−−−−
3−-−−−−
4+−+−−−
5++++−−
6+−−−+−
37+-−−+−
8−−+−+−
9−−−−−−
10−−−−−−
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Castañeda-Chávez, M.d.R.; Aguilar-Muslera, R.E.; Reyes-Velázquez, C.; Lango-Reynoso, F.; Zamudio-Alemán, R.E.; Salcedo-Garduño, M.G. Vibrio sp. and Identification of the ctx Gene of Cholera Toxin in the Mandinga Coastal Lagoon, Veracruz, Mexico. Microorganisms 2025, 13, 352. https://doi.org/10.3390/microorganisms13020352

AMA Style

Castañeda-Chávez MdR, Aguilar-Muslera RE, Reyes-Velázquez C, Lango-Reynoso F, Zamudio-Alemán RE, Salcedo-Garduño MG. Vibrio sp. and Identification of the ctx Gene of Cholera Toxin in the Mandinga Coastal Lagoon, Veracruz, Mexico. Microorganisms. 2025; 13(2):352. https://doi.org/10.3390/microorganisms13020352

Chicago/Turabian Style

Castañeda-Chávez, María del Refugio, Rosa Elena Aguilar-Muslera, Christian Reyes-Velázquez, Fabiola Lango-Reynoso, Rosa Elena Zamudio-Alemán, and Magnolia Gricel Salcedo-Garduño. 2025. "Vibrio sp. and Identification of the ctx Gene of Cholera Toxin in the Mandinga Coastal Lagoon, Veracruz, Mexico" Microorganisms 13, no. 2: 352. https://doi.org/10.3390/microorganisms13020352

APA Style

Castañeda-Chávez, M. d. R., Aguilar-Muslera, R. E., Reyes-Velázquez, C., Lango-Reynoso, F., Zamudio-Alemán, R. E., & Salcedo-Garduño, M. G. (2025). Vibrio sp. and Identification of the ctx Gene of Cholera Toxin in the Mandinga Coastal Lagoon, Veracruz, Mexico. Microorganisms, 13(2), 352. https://doi.org/10.3390/microorganisms13020352

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop