Genome Sequencing and Assembly of Enterotoxigenic Escherichia coli E9034A: Role of LngA, CstH, and FliC in Intestinal Cell Colonization and the Release of the Proinflammatory Cytokine IL-8
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. DNA Extraction and Genomic Data Processing
2.3. Construction of an Isogenic ETEC Mutant
2.4. Antibody Production and Western Blotting
2.5. Adherence Assays
2.6. Quantification of Pro- and Anti-Inflammatory Cytokines via Flow Cytometry
2.7. Statistical Analysis
3. Results
3.1. Genomic Information of the ETEC E9034A Strain
3.2. Identification of the LngA, CstH, and FliC Proteins in ETEC E9034A and Its Derived Mutants
3.3. Inactivation of the lngA, cstH, and fliC Genes in ETEC E9034A Significantly Reduces Adherence to HT-29 Cells
3.4. Role of the LngA, CstH, and FliC Proteins in ETEC Strains During the Adherence of HuTu 80 Cells
3.5. The Protein FliC Induces the Release of the Cytokine IL-8 in HT-29 Intestinal Cells
4. Discussion
5. Conclusions
6. Limitations
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Anderson, J.D.; Bagamian, K.H.; Muhib, F.; Amaya, M.P.; Laytner, L.A.; Wierzba, T.; Rheingans, R. Burden of enterotoxigenic Escherichia coli and shigella non-fatal diarrhoeal infections in 79 low-income and lower middle-income countries: A modelling analysis. Lancet Glob. Health 2019, 7, e321–e330. [Google Scholar] [CrossRef] [PubMed]
- WHO Preferred Product Characteristics for Vaccines Against Enterotoxigenic Escherichia coli. Consultado: El 16 de Enero de 2023. [En Línea]. Available online: https://www.who.int/publications-detail-redirect/who-preferred-product-characteristics-for-vaccines-against-enterotoxigenic-escherichia-coli (accessed on 3 October 2024).
- Enterotoxigenic E. coli (ETEC)|E. coli|CDC. Available online: https://www.cdc.gov (accessed on 20 March 2024).
- Qadri, F.; Svennerholm, A.-M.; Faruque, A.S.G.; Sack, R.B. Enterotoxigenic Escherichia coli in Developing Countries: Epidemiology, Microbiology, Clinical Features, Treatment, and Prevention. Clin. Microbiol. Rev. 2005, 18, 465–483. [Google Scholar] [CrossRef]
- Rodríguez-Angeles, G. Principales características y diagnóstico de los grupos patógenos de Escherichia coli. Salud Pública México 2002, 44, 464–475. [Google Scholar] [CrossRef]
- Prudden, H.; Hasso-Agopsowicz, M.; Black, R.; Troeger, C.; Reiner, R.; Breiman, R.; Jit, M.; Kang, G.; Lamberti, L.; Lanata, C.; et al. Meeting Report: WHO Workshop on modelling global mortality and aetiology estimates of enteric pathogens in children under five. Cape Town, 28–29th November 2018. Vaccine 2020, 38, 4792–4800. [Google Scholar] [CrossRef] [PubMed]
- Ríos-Muñiz, D.; Cerna-Cortés, J.F.; Morán-García, N.; Meza-Segura, M.; Estrada-García, T. Escherichia coli enterotoxigénica y enteroagregativa: Prevalencia, patogénesis y modelos múridos. Gac. Méd. Méx. 2019, 155, 410–416. [Google Scholar] [CrossRef]
- Vidal, R.M.; Muhsen, K.; Tennant, S.M.; Svennerholm, A.-M.; Sow, S.O.; Sur, D.; Zaidi, A.K.M.; Faruque, A.S.G.; Saha, D.; Adegbola, R.; et al. Colonization factors among enterotoxigenic Escherichia coli isolates from children with moderate-to-severe diarrhea and from matched controls in the Global Enteric Multicenter Study (GEMS). PLoS Negl. Trop. Dis. 2019, 13, e0007037. [Google Scholar] [CrossRef] [PubMed]
- Kaper, J.B.; Nataro, J.P.; Mobley, H.L.T. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- Nataro, J.P.; Kaper, J.B. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 1998, 11, 142–201. [Google Scholar] [CrossRef] [PubMed]
- Taxt, A.; Aasland, R.; Sommerfelt, H.; Nataro, J.; Puntervoll, P. Heat-stable enterotoxin of enterotoxigenic Escherichia coli as a vaccine target. Infect. Immun. 2010, 78, 1824–1831. [Google Scholar] [CrossRef]
- Dubreuil, J.D. Pig vaccination strategies based on enterotoxigenic Escherichia coli toxins. Braz. J. Microbiol. 2021, 52, 2499–2509. [Google Scholar] [CrossRef]
- Huang, J.; Duan, Q.; Zhang, W. Significance of Enterotoxigenic Escherichia coli (ETEC) Heat-Labile Toxin (LT) Enzymatic Subunit Epitopes in LT Enterotoxicity and Immunogenicity. Appl. Environ. Microbiol. 2018, 84, e00849-18. [Google Scholar] [CrossRef] [PubMed]
- Fleckenstein, J.; Sheikh, A.; Qadri, F. Novel antigens for enterotoxigenic Escherichia coli vaccines. Expert Rev. Vaccines 2014, 13, 631–639. [Google Scholar] [CrossRef] [PubMed]
- Fleckenstein, J.M.; Kuhlmann, F.M. Enterotoxigenic Escherichia coli Infections. Curr. Infect. Dis. Rep. 2019, 21, 9. [Google Scholar] [CrossRef] [PubMed]
- Kharat, V.B.; Ahmed, M.; Jiang, Z.-D.; Riddle, M.S.; DuPont, H.L. Colonization Factors in Enterotoxigenic Escherichia coli Strains in Travelers to Mexico, Guatemala, and India Compared with Children in Houston, Texas. Am. J. Trop. Med. Hyg. 2017, 96, 83–87. [Google Scholar] [CrossRef]
- von Mentzer, A.; Svennerholm, A.-M. Colonization factors of human and animal-specific enterotoxigenic Escherichia coli (ETEC). Trends Microbiol. 2024, 32, 448–464. [Google Scholar] [CrossRef] [PubMed]
- Aves, K.-L.; Guerra, P.R.; Fresno, A.H.; Saraiva, M.M.S.; Cox, E.; Bækbo, P.J.; Nielsen, M.A.; Sander, A.F.; Olsen, J.E. A Virus-like Particle-Based F4 Enterotoxigenic Escherichia coli Vaccine Is Inhibited by Maternally Derived Antibodies in Piglets but Generates Robust Responses in Sows. Pathogens 2023, 12, 1388. [Google Scholar] [CrossRef]
- Smith, E.M.; Grassel, C.L.; Papadimas, A.; Foulke-Abel, J.; Barry, E.M. The role of CFA/I in adherence and toxin delivery by ETEC expressing multiple colonization factors in the human enteroid model. PLoS Negl. Trop. Dis. 2022, 16, e0010638. [Google Scholar] [CrossRef]
- von Mentzer, A.; Tobias, J.; Wiklund, G.; Nordqvist, S.; Aslett, M.; Dougan, G.; Sjöling, A.; Svennerholm, A.-M. Identification and characterization of the novel colonization factor CS30 based on whole genome sequencing in enterotoxigenic Escherichia coli (ETEC). Sci. Rep. 2017, 7, 12514. [Google Scholar] [CrossRef] [PubMed]
- Barry, E.; Cassels, F.; Riddle, M.; Walker, R.; Wierzba, T. Vaccines Against Shigella and Enterotoxigenic Escherichia coli: A summary of the 2018 VASE Conference. Vaccine 2019, 37, 4768–4774. [Google Scholar] [CrossRef] [PubMed]
- Saldaña-Ahuactzi, Z.; Rodea, G.E.; Cruz-Córdova, A.; Rodríguez-Ramírez, V.; Espinosa-Mazariego, K.; González-Montalvo, M.A.; Ochoa, S.A.; González-Pedrajo, B.; Eslava-Campos, C.A.; López-Villegas, E.O.; et al. Effects of lng Mutations on LngA Expression, Processing, and CS21 Assembly in Enterotoxigenic Escherichia coli E9034A. Front. Microbiol. 2016, 7, 1201. [Google Scholar] [CrossRef] [PubMed]
- Mazariego-Espinosa, K.; Cruz, A.; Ledesma, M.A.; Ochoa, S.A.; Xicohtencatl-Cortes, J. Longus, a Type IV Pilus of Enterotoxigenic Escherichia coli, Is Involved in Adherence to Intestinal Epithelial Cells. J. Bacteriol. 2010, 192, 2791–2800. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Córdova, A.; Espinosa-Mazariego, K.; Ochoa, S.A.; Saldaña, Z.; Rodea, G.E.; Cázares-Domínguez, V.; Rodríguez-Ramírez, V.; Eslava-Campos, C.A.; Navarro-Ocaña, A.; Arrellano-Galindo, J.; et al. CS21 positive multidrug-resistant ETEC clinical isolates from children with diarrhea are associated with self-aggregation, and adherence. Front. Microbiol. 2014, 5, 709. [Google Scholar] [CrossRef]
- Zhang, Y.; Tan, P.; Zhao, Y.; Ma, X. Enterotoxigenic Escherichia coli: Intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 2022, 14, 2055943. [Google Scholar] [CrossRef]
- Levine, M.M. Escherichia coli that cause diarrhea: Enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 1987, 155, 377–389. [Google Scholar] [CrossRef] [PubMed]
- Levine, M.M.; Ristaino, P.; Marley, G.; Smyth, C.; Knutton, S.; Boedeker, E.; Black, R.; Young, C.; Clements, M.L.; Cheney, C. Coli surface antigens 1 and 3 of colonization factor antigen II-positive enterotoxigenic Escherichia coli: Morphology, purification, and immune responses in humans. Infect. Immun. 1984, 44, 409–420. [Google Scholar] [CrossRef]
- Ares, M.A.; Abundes-Gallegos, J.; Rodríguez-Valverde, D.; Panunzi, L.G.; Jiménez-Galicia, C.; Jarillo-Quijada, M.D.; Cedillo, M.L.; Alcántar-Curiel, M.D.; Torres, J.; Girón, J.A.; et al. The Coli Surface Antigen CS3 of Enterotoxigenic Escherichia coli Is Differentially Regulated by H-NS, CRP, and CpxRA Global Regulators. Front. Microbiol. 2019, 10, 1685. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Yang, Y.; Chen, P.; Hu, H.; Hardwidge, P.R.; Zhu, G. More than a locomotive organelle: Flagella in Escherichia coli. Appl. Microbiol. Biotechnol. 2015, 99, 8883–8890. [Google Scholar] [CrossRef] [PubMed]
- Schwan, W.R. Flagella allow uropathogenic Escherichia coli ascension into murine kidneys. Int. J. Med. Microbiol. 2008, 298, 441–447. [Google Scholar] [CrossRef][Green Version]
- Roy, K.; Hilliard, G.M.; Hamilton, D.J.; Luo, J.; Ostmann, M.M.; Fleckenstein, J.M. Enterotoxigenic Escherichia coli EtpA mediates adhesion between flagella and host cells. Nature 2009, 457, 594–598. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.; Duan, Q.; Upadhyay, I.; Zhang, W. Evaluation of Multivalent Enterotoxigenic Escherichia coli Vaccine Candidate MecVax Antigen Dose-Dependent Effect in a Murine Model. Appl. Environ. Microbiol. 2022, 88, e0095922. [Google Scholar] [CrossRef] [PubMed]
- Wick, R.R.; Judd, L.M.; Holt, K.E. Assembling the perfect bacterial genome using Oxford Nanopore and Illumina sequencing. PLoS Comput. Biol. 2023, 19, e1010905. [Google Scholar] [CrossRef] [PubMed]
- Seemann, T. Prokka: Rapid Prokaryotic Genome Annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [PubMed]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.-Y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023, 51, W484–W492. [Google Scholar] [CrossRef] [PubMed]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 3 October 2024).
- Loman, N.J.; Quick, J.; Simpson, J.T. A complete bacterial genome assembled de novo using only nanopore sequencing data. Nat. Methods 2015, 12, 733–735. [Google Scholar] [CrossRef] [PubMed]
- Knutton, S.; Lloyd, D.R.; Candy, D.C.; McNeish, A.S. Adhesion of enterotoxigenic Escherichia coli to human small intestinal enterocytes. Infect. Immun. 1985, 48, 824–831. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Mazariego, K.; Saldaña-Ahuactzi, Z.; Ochoa, S.A.; González-Pedrajo, B.; Cevallos, M.A.; Rodríguez-Martínez, R.; Romo-Castillo, M.; Hernández-Castro, R.; Cruz-Córdova, A.; Xicohtencatl-Cortes, J. Recombinant Escherichia coli BL21 with LngA Variants from ETEC E9034A Promotes Adherence to HT-29 Cells. Pathogens 2023, 12, 337. [Google Scholar] [CrossRef] [PubMed]
- Levine, M.M.; Noriega, F. A review of the current status of enteric vaccines. Papua New Guin. Med. J. 1995, 38, 325–331. [Google Scholar]
- Cario, E.; Podolsky, D.K. Differential Alteration in Intestinal Epithelial Cell Expression of Toll-Like Receptor 3 (TLR3) and TLR4 in Inflammatory Bowel Disease. Infect. Immun. 2000, 68, 7010–7017. [Google Scholar] [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen Recognition and Innate Immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef]
- Read, L.T.; Hahn, R.W.; Thompson, C.C.; Bauer, D.L.; Norton, E.B.; Clements, J.D. Simultaneous exposure to Escherichia coli heat-labile and heat-stable enterotoxins increases fluid secretion and alters cyclic nucleotide and cytokine production by intestinal epithelial cells. Infect. Immun. 2014, 82, 5308–5316. [Google Scholar] [CrossRef] [PubMed]
- Beutler, B. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 2004, 430, 257–263. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Sato, S.; Horiuchi, T.; Hoshino, K.; Takeda, K.; Dong, Z.; Modlin, R.L.; Akira, S. Cutting edge: Role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins. J. Immunol. 2002, 169, 10–14. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Kawai, T.; Mühlradt, P.F.; Morr, M.; Radolf, J.D.; Zychlinsky, A.; Takeda, K.; Akira, S. Discrimination of bacterial lipoproteins by Toll-like receptor 6. Int. Immunol. 2001, 13, 933–940. [Google Scholar] [CrossRef]
- Alexopoulou, L.; Thomas, V.; Schnare, M.; Lobet, Y.; Anguita, J.; Schoen, R.T.; Medzhitov, R.; Fikrig, E.; Flavell, R.A. Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice. Nat. Med. 2002, 8, 878–884. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Iqbal, J.; Gómez-Duarte, O.G. Murine immunization with CS21 pili or LngA major subunit of enterotoxigenic Escherichia coli (ETEC) elicits systemic and mucosal immune responses and inhibits ETEC gut colonization. Vet. Microbiol. 2017, 202, 90–100. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gewirtz, A.T.; Navas, T.A.; Lyons, S.; Godowski, P.J.; Madara, J.L. Cutting edge: Bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J. Immunol. 2001, 167, 1882–1885. [Google Scholar] [CrossRef]
- Hayashi, F.; Smith, K.D.; Ozinsky, A.; Hawn, T.R.; Yi, E.C.; Goodlett, D.R.; Eng, J.K.; Akira, S.; Underhill, D.M.; Aderem, A. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 2001, 410, 1099–1103. [Google Scholar] [CrossRef]
ETEC Strain | Resistance | Serotype | LT | ST | CS21 | CS3 | CFA/I | CS1 | CS8 | Flagella | Origin |
---|---|---|---|---|---|---|---|---|---|---|---|
E9034A | -- | O8:H9 | + | + | + | + | + | + | + | + | Caribbean |
E9034AΔlngA | Km | O8:H9 | + | + | − | + | + | + | + | + | Collection |
E9034AΔfliC | Cm | O8:H9 | + | + | + | + | + | + | + | − | This study |
E9034AΔcstH | Cm | O8:H9 | + | + | + | − | + | + | + | + | This study |
E9034AΔlngAΔfliC | Km/Cm | O8:H9 | + | + | − | + | + | + | + | − | This study |
E9034AΔcstHΔlngA | Km/Cm | O8:H9 | + | + | − | − | + | + | + | + | This study |
E9034AΔcstHΔfliC | Km | O8:H9 | + | + | + | − | + | + | + | − | This study |
E9034AΔlngAΔcstHΔfliC | Km/Cm | O8:H9 | + | + | − | − | + | + | + | − | This study |
Type strains used in this study | |||||||||||
BL21 (D3) | E. coli K-12 fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdS λ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5 |
Gene | Primer | Sequence (5′–3′) | Size (bp) | References or Source | |
---|---|---|---|---|---|
Wild type | Mutant | ||||
cstH | F | CTTAAGCTACATGCACAGGAGTAGC | 710 | 1800 | This study |
cstH | R | GATACAGGAGCAGAATTACAAGCTTGACTATTT | |||
lngA | F | ATGAGCCTGCTGGAAGTTAGCATTGTTCTTGGCATTATCGGTACGATTGC | 760 | 1800 | 22 |
lngA | R | TTAACGGCTACCTAAAGTAATTGAGTTTACCTGAGCAGTACAGGTACTTA | |||
fliC | F | ATGGCACAAGTCATTAATACCAAC | 2010 | 1280 | This study |
fliC | R | TTAACCCTGCAGCAGAGACAGAA | |||
lngA | Rec R | GTGGTGGTGATGGTGATGGCCACGGCTACCTAAAGTAATTGAGTTTA | 745 | This study | |
lngA | Rec F | AGAAGGAGATATAACTATGCTGTATAACCGG | |||
cstH | Rec F | AGAAGGAGATATAACTATGTTAAAAATAAAATACTTATTAATAGGTCT TTCACTGTCAGCTAT | 510 | This study | |
cstH | Rec R | AGAAGGAGATATAACTATGTTAAAAATAAAATACTTATTAATAGGTCT TTCACTGTCAGCTAT | |||
fliC | Rec F | AGAAGGAGATATAACTATGGCACAAGTCATTAATACCAACAGCCTCTCG | 745 | This study | |
fliC | Rec R | GTGGTGGTGATGGTGATGGCCACCCTGCAGCAGAGACAGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez-Martínez, R.; Ochoa, S.A.; Valle-Rios, R.; Jaimes-Ortega, G.A.; Hernández-Castro, R.; Mancilla-Rojano, J.; Castro-Escarpulli, G.; López-Saucedo, C.; Estrada-García, T.; Cruz-Córdova, A.; et al. Genome Sequencing and Assembly of Enterotoxigenic Escherichia coli E9034A: Role of LngA, CstH, and FliC in Intestinal Cell Colonization and the Release of the Proinflammatory Cytokine IL-8. Microorganisms 2025, 13, 374. https://doi.org/10.3390/microorganisms13020374
Rodríguez-Martínez R, Ochoa SA, Valle-Rios R, Jaimes-Ortega GA, Hernández-Castro R, Mancilla-Rojano J, Castro-Escarpulli G, López-Saucedo C, Estrada-García T, Cruz-Córdova A, et al. Genome Sequencing and Assembly of Enterotoxigenic Escherichia coli E9034A: Role of LngA, CstH, and FliC in Intestinal Cell Colonization and the Release of the Proinflammatory Cytokine IL-8. Microorganisms. 2025; 13(2):374. https://doi.org/10.3390/microorganisms13020374
Chicago/Turabian StyleRodríguez-Martínez, Ricardo, Sara A. Ochoa, Ricardo Valle-Rios, Gustavo A. Jaimes-Ortega, Rigoberto Hernández-Castro, Jetsi Mancilla-Rojano, Graciela Castro-Escarpulli, Catalina López-Saucedo, Teresa Estrada-García, Ariadnna Cruz-Córdova, and et al. 2025. "Genome Sequencing and Assembly of Enterotoxigenic Escherichia coli E9034A: Role of LngA, CstH, and FliC in Intestinal Cell Colonization and the Release of the Proinflammatory Cytokine IL-8" Microorganisms 13, no. 2: 374. https://doi.org/10.3390/microorganisms13020374
APA StyleRodríguez-Martínez, R., Ochoa, S. A., Valle-Rios, R., Jaimes-Ortega, G. A., Hernández-Castro, R., Mancilla-Rojano, J., Castro-Escarpulli, G., López-Saucedo, C., Estrada-García, T., Cruz-Córdova, A., & Xicohtencatl-Cortes, J. (2025). Genome Sequencing and Assembly of Enterotoxigenic Escherichia coli E9034A: Role of LngA, CstH, and FliC in Intestinal Cell Colonization and the Release of the Proinflammatory Cytokine IL-8. Microorganisms, 13(2), 374. https://doi.org/10.3390/microorganisms13020374