Next Article in Journal
Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms
Previous Article in Journal
Construction and Effect Analysis of a Mixed Actinomycete Flora for Straw Returning to Albic Soil in Northeast China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 2
10.3390/microorganisms13020386
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus

by
Jinyuan Che
1,
Binghong Liu
2,
Qitong Fang
2,
Shaojie Hu
2,
Lei Wang
1,* and
Baolong Bao
2,*
1
Key Laboratory of Yangtze River Water Environment, Ministry of Education, College of Environmental Science and Engineering, Tongji University, Shanghai 200092, China
2
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
*
Authors to whom correspondence should be addressed.
Microorganisms 2025, 13(2), 386; https://doi.org/10.3390/microorganisms13020386
Submission received: 20 January 2025 / Revised: 7 February 2025 / Accepted: 8 February 2025 / Published: 10 February 2025
(This article belongs to the Section Molecular Microbiology and Immunology)
Browse Figures
Versions Notes

Abstract

:
The msbB gene, encoding a lipid A phosphatease, is crucial for lipopolysaccharide (LPS) synthesis in Gram-negative bacteria and plays a critical role in their virulence. This study investigated the role of msbB in Vibrio parahaemolyticus, a significant marine pathogen causing gastroenteritis in humans and infections in aquatic animals. We constructed an msbB deletion mutant (ΔmsbB) and a complementary strain (CΔmsbB) using homologous recombination. The growth, outer membrane permeability, stress and antibiotic sensitivity, biofilm formation, swarming motility, and virulence of the wild-type (WT), ΔmsbB, and CΔmsbB strains were assessed. Additionally, the pathogenicity of ΔmsbB was evaluated using L. vannamei shrimp models. The results showed that the msbB gene was successfully deleted and complemented, and its deletion did not impair bacterial growth. However, the ΔmsbB strain exhibited an increased outer membrane permeability, reduced resistance to stresses and antibiotics, defective biofilm formation, and a reduced swarming motility. In a Tetrahymena co-culture, the ΔmsbB strain showed attenuated virulence. In shrimp infected with the ΔmsbB strain, the cumulative mortality rate was 22%, significantly lower than the 62% observed in the WT strain. Moreover, the expression levels of immune-related genes in the shrimp hepatopancreas were significantly lower in the ΔmsbB group, indicating a significant reduction in infection capability and pathogenicity. These findings indicate that the msbB gene is critical for the virulence of V. parahaemolyticus and suggest that msbB is a potential target for therapeutic interventions and vaccine development against V. parahaemolyticus infections.

1. Introduction

Vibrio parahaemolyticus is a Gram-negative, halophilic bacteria that is extensively found in aquatic environments [1,2,3,4]. It is a leading cause of seafood-borne gastroenteritis in humans, causing symptoms such as diarrhea, vomiting, and abdominal pain [5,6]. The bacteria is also a significant pathogen in aquaculture, particularly in shrimp farming, where it can lead to mass mortality and substantial economic losses.
Currently, V. parahaemolyticus has been extensively studied to elucidate the molecular mechanisms underlying its pathogenesis and interactions with host animals. It can produce various virulence factors to establish infection, evade host defenses, and cause disease [7,8,9,10]. Among these factors, toxins, in particular, are one of the most pivotal virulence factors in the pathogenicity of many bacterial species [8,11,12,13]. They have been the focus of extensive research due to their direct impact on host physiology. They can be broadly classified into two main categories, exotoxins and endotoxins, each with distinct characteristics and modes of action [14]. Exotoxins are heat-labile proteins that bacteria actively secrete into their surrounding environment. These proteins, such as thermostable direct hemolysin gene (tdh) and tdh-related hemolysin gene (trh), have been extensively studied in V. parahaemolyticus. Studies have been confirmed that the deletion of the tdh and trh genes results in a decreased hemolytic ability and attenuated pathogenicity [15]. In contrast, research on the virulence and endotoxins of V. parahaemolyticus is relatively limited. Endotoxins, which are heat-stable complexes composed of lipopolysaccharides and proteins, are essential components of the outer membrane in Gram-negative bacteria [16,17]. Lipopolysaccharide (LPS), a major constituent of this outer membrane, is well-known for its ability to trigger immune responses and induce inflammation in the host organism [11,18,19,20]. Attenuated vaccines developed through genetic modification or heat inactivation have shown some safety and protective efficacy against bacterial infections. Nevertheless, endotoxins exhibit a remarkable stability, allowing them to withstand extreme temperatures and pH levels [21,22]. Reducing endotoxin levels is a key determinant in ensuring the safety of attenuated live vaccines.
The active site of endotoxins is lipid A, which mediates almost all of the biological responses of endotoxins [23]. Lipid A is a crucial component of lipopolysaccharide (LPS), a major virulence factor in Gram-negative bacteria. Mutations in lipid A biosynthesis pathways often result in significant alterations to bacterial physiology and pathogenicity. Most mutations in lipid A biosynthesis result in a conditionally lethal phenotype [24]. In V. parahaemolyticus, the structure of lipid A is synthesized through the four following secondary acyltransferases: VP_RS00880, VP_RS08405, VP_RS12170, and VP_RS01045 (msbB) [25,26]. The simultaneous knockout of these four genes severely inhibits bacterial growth, highlighting the essential role of lipid A in bacterial viability. However, the deletion of any one of them only alters the structure of LPS without affecting bacterial growth [25], suggesting that each enzyme may have a specific role in fine-tuning the structure and function of LPS. Among these genes, the msbB gene, encoding a lipid A phosphatase, is particularly noteworthy. It is crucial for LPS synthesis in many Gram-negative bacteria. In E. coli and N. meningitidis, msbB deletion impairs lipid A synthesis, thereby affecting outer membrane integrity [27,28]. This highlights the central role of msbB in maintaining the structural integrity and functionality of LPS. Additionally, strains of S. typhimurium with the msbB gene deleted have been engineered to serve as potential anti-cancer therapies, demonstrating significant tumor-suppressing capabilities in mouse models [29]. This innovative application underscores the potential of manipulating msbB to alter bacterial properties for therapeutic purposes. Furthermore, msbB deletion affects host–immune interactions in a species-specific manner. LPS from msbB-deleted bacteria shows a reduced activation of Toll-like receptor 4 (TLR4), leading to a weakened inflammatory response and higher survival rates in infected mice [30]. Conversely, in E. coli, msbB deletion elicits a stronger adaptive immune response, aiding infection clearance [27]. Given its role in pathogenicity and immune modulation, msbB is a potential therapeutic target. Additionally, msbB-deleted bacteria or their LPS show promise as vaccine candidates [31]. Moreover, the msbB mutant of Salmonella exhibits reduced inflammatory risks, making it a safer option for vaccine development.
Despite these findings in other bacteria, the role of the msbB gene in V. parahaemolyticus, a significant marine pathogen causing gastroenteritis in humans and infections in aquatic animals such as shrimp, remains largely unexplored. In this study, we constructed an msbB deletion mutant strain to investigate its impact on the virulence of V. parahaemolyticus and the changes in pathogenicity following infection in shrimp.

2. Materials and Methods

2.1. Strains, Media, and Experimental Animals

The bacterial strains and plasmids used in this research are detailed in Table 1. The V. parahaemolyticus strain (ATCC® 17802™, Guangdong Culture Collection Centre of Microbiology, Guangzhou, China) was specifically selected for the generation of deletion mutants and subsequent functional studies. Both V. parahaemolyticus and its derived mutants were cultivated in Luria–Bertani (LB) broth at a temperature of 30 °C, with continuous shaking at 150 rpm. The Tetrahymena thermophila strain was kindly provided by Prof. Shan Gao from the Ocean University of China. T. thermophila was maintained axenically in SPP medium, which comprised 2% proteose peptone, 0.1% yeast extract, 0.2% glucose, and 0.003% sequestrene, also at 30 °C. Healthy specimens of the white shrimp L. vannamei were sourced from Rufu Farm, located in Nantong, Jiangsu Province, China.

2.2. Construction of the msbB Deletion Mutant and Its Complementary Strain

The msbB deletion mutant (∆msbB) and its complementary strain were constructed via homologous recombination [32]. The primers used are listed in Table 2. The upstream (635 bp) and downstream (759 bp) flanking regions of msbB were amplified using the primers msbB-P1/P2 and msbB-P3/P4, respectively. These fragments were then ligated into the linearized suicide plasmid pSR47S, which had been digested with BamH I and Sal I, using the ClonExpress II One Step Cloning Kit (C112-01, Vazyme, Nanjing, China). The resulting pSR47S-∆msbB plasmid was transformed into CC118 λpir, then conjugated into the wild-type (WT) strain. Mutants were selected on LB agar with kanamycin (Kan) and ampicillin (Amp), and screened on LB agar with 10% sucrose. Mutation was confirmed by PCR and sequencing using the primers ∆msbB T1/T2. The complementary strain was constructed as previously reported [33]. A 2313 bp msbB fragment was amplified from the WT using the primers msbB-H1/H2, ligated into pSR47S, and transformed into ∆msbB via conjugation [33]. Successful complementation was verified by PCR using the primers C∆msbB T1/T2. Growth characteristics were evaluated by incubating cultures at 30 °C with shaking at 150 rpm until OD600 reached 1.0. The cultures were then diluted 1:100 and grown in a temperature-controlled incubator, with samples collected hourly.

2.3. Biofilm Formation

Biofilm formation was assessed using a modified method. Briefly, 20 µL of overnight cultures of the WT and ΔmsbB strains were diluted 1:100 in fresh LB medium in a 96-well plate and incubated for 24 h at 30 °C. Biofilms were washed, stained with 0.1% crystal violet for 30 min, rinsed, and air dried. Then, 100 µL of 95% ethanol was added to solubilize the stain, and absorbance was measured at 595 nm. Each experiment was performed in triplicate.

2.4. Morphological Observation and Swarming Motility Analysis

For transmission electron microscopy (TEM) analysis, bacterial cultures were grown on 1% agar plates for 12 h at 30 °C. Subsequently, samples were negatively stained with 1% uranyl acetate and examined using a Tecnai G2F30 TEM (TEM, Tecnai G2F30, FEI Co., Hillsboro, OR, USA). For swarming motility assays, 2 µL of bacterial suspension (OD600 = 0.2) was spotted onto LB agar plates with 0.3% agar, following the protocol by Che et al. [32]. The plates were incubated at 30 °C for 12 h, and swarming motility was evaluated by measuring the diameter of the swarming zone. Each strain was tested in triplicate.

2.5. Outer Membrane Permeabilization Assay and Sensitivity Analysis for Stress and Antibiotics

For stress and antibiotic sensitivity analyses, the following stress factors were used: 2.5 mM M NaCl, 4 mM KH2PO4, and 0.04 mM H2O2. MIC assay was tested using antibiotics including β-lactams (cefotaxime and ampicillin), aminoglycosides (spectinomycin, gentamicin, streptomycin, tobramycin, and kanamycin), quinolone antibiotics (nalidixic aicd), macrolide antibiotics (clarithromycin), furanomycin, rifampicin, tetracycline, and chloramphenicol. The bacterial suspensions were inoculated into the stress factors and diluted antibiotic solutions (1:1 ratio) and incubated at 180 rpm and 30 °C for 24 h. Survival rate assays were performed on antibiotics that exhibited alterations in the stress factor and minimum inhibitory concentration (MIC), specifically ampicillin, nalidixic acid, clarithromycin, spectinomycin, and tobramycin. Overnight cultures were subcultured at a dilution of 1:100 in LB and incubated until the optical density at 600 nm (OD600 nm) reached 0.5. The cells were subsequently washed twice and resuspended in fresh LB. The cultures were then resuspended in either LB alone or LB supplemented with 4 mM KH2PO4, 2.5 M NaCl, 0.4 mM H2O2, 8 µg/mL ampicillin, 0.05 µg/mL nalidixic acid, 25 µg/mL clarithromycin, 6.25 µg/mL spectinomycin, and 1.25 µg/mL tobramycin. The cultures were incubated for 12 h at 30 °C in a rotary shaker. Following incubation, the OD600 of the cultures was measured using a BioTek Synergy HTX microplate reader (Agilent, Cheadle, UK).

2.6. Assessment of Strains’ Virulence Using Tetrahymena Model

To evaluate the virulence of the ∆msbB mutant, the Tetrahymena infection model was employed. This model assesses the relative survival rates of bacteria and Tetrahymena after co-culture, as previously reported [34]. Tetrahymena was adjusted to 1 × 105 cells/mL using saline. The WT and ∆msbB mutants were adjusted to 3 × 109 CFU/mL. Then, the Tetrahymena and bacterial strains were mixed at a 1:5000 ratio and co-cultured at 30 °C for 6 h. Bacterial growth was monitored hourly by measuring absorbance at 600 nm. Controls included bacterial strains mixed with saline and sterile saline as the blank. The relative survival rate of bacteria was calculated based on the number of bacteria remaining in co-culture compared to those grown alone.
For the virulence test of bacterial lysates on Tetrahymena, overnight bacterial cultures were adjusted to an OD600 of 1.0. Five milliliters of each culture was centrifuged at 10,000× g for 10 min to collect the cell pellets. The pellets were resuspended in 1 mL of saline and sonicated to prepare lysates. The lysates were mixed with Tetrahymena at a 1:1 volume ratio and incubated. After 6 h, CCK8 reagent was added to assess Tetrahymena viability (40203ES60, Yeasen, Shanghai, China).

2.7. Pathogenicity Assay

Shrimps were divided into three groups and were either infected with the WT strain or the ∆msbB mutant at a concentration of 4 × 107 CFU/mL, or left uninfected as a control. The survival of the shrimp was tracked for 7 days after challenge, with mortality recorded. Relative percent survival (RPS, %) was calculated using the following formula: (1 − mortality in control group/mortality in experimental group) × 100. At the end of the infection period, the shrimp hepatopancreas was collected for an RT-qPCR analysis of immune-related genes and histopathological examination. The primers used for the RT-qPCR analysis are listed in Table 3.

2.8. Statistical Analysis

The statistical data were analyzed by Graphpad Prism 9 (Graph Pad Software, Inc., San Diego, CA, USA), and significance was analyzed using one-way ANOVA or two-way ANOVA followed by the Duncan’s multiple range test. Each experiment was repeated independently at least three times, and the results are expressed as mean ± SD. Differences were considered to be significant if p < 0.05 (* p < 0.05, ** p < 0.01, and *** p < 0.001).

3. Results

3.1. Construction of the msbB Deletion Mutant and Growth Assessment

To clarify the role of the msbB gene, we inactivated the msbB gene by introducing an in-frame deletion. Firstly, the upstream fragment A and downstream fragment B of the msbB gene, measuring 632 bp and 757 bp, respectively, were obtained (Figure 1A). Subsequently, the A and B fragments were ligated into the suicide plasmid pSR47S and generated the recombinant plasmid pSR47S-msbB. Using suicide-plasmid-mediated homologous recombination, an msbB deletion mutation (ΔmsbB) was constructed. The complementation of ΔmsbB was achieved using forward screening methods, resulting in the successful construction of CΔmsbB (Figure 1B). The deletion of the msbB gene in the ΔmsbB strain and its successful complementation in the CΔmsbB strain were confirmed. To assess the necessity of the msbB gene for V. parahaemolyticus, growth curves were generated for the WT, ΔmsbB, and CΔmsbB strains. As depicted in Figure 1C, all three strains exhibited comparable growth patterns, suggesting that msbB is a non-essential gene. Its deletion does not compromise bacterial viability or growth, thus eliminating potential growth discrepancies that could confound subsequent experiments.

3.2. Loss of msbB Increased the Sensitivity to Stress and Antibiotics

The outer membrane permeabilization of the wild-type (WT) and mutant strains was assessed using the N-phenyl-1-napthylamine (NPN) uptake assay. The fluorescence intensity of the ΔmsbB mutant was significantly higher than that of the WT and complementary strain CΔmsbB (Figure 2A), indicating that the deletion of the msbB gene increased the outer membrane permeability. Furthermore, the minimal inhibitory concentrations (MICs) of β-lactam antibiotics (cefotaxime 1 µg/mL and ampicillin 8 µg/mL), quinolone antibiotics (nalidixic acid 0.05 µg/mL), macrolide antibiotics (clarithromycin 25 µg/mL), and aminoglycosides (streptomycin 6.25 µg/mL and tobramycin 1.25 µg/mL) for the ΔmsbB mutant were two-fold lower than those for the WT and CΔmsbB strains (Figure 2B). In contrast, the MICs of rifampicin, tetracycline, and chloramphenicol for the ΔmsbB mutant were similar to those of the WT and CΔmsbB strains (Figure 2B). Under stress conditions involving KH2PO4, NaCl, and H2O2, the ΔmsbB strain exhibited the lowest optical density at 600 nm (OD600) compared to the WT and CΔmsbB strains (Figure 2C). Similarly, when exposed to various antimicrobial compounds, the ΔmsbB strain showed a significantly inhibited growth compared to WT and CΔmsbB (Figure 2C). These results indicate that the ΔmsbB strain had a lower resistance to these stress factors and antibiotics. Biofilm formation was also evaluated via crystal violet staining, revealing impaired biofilm production in the ∆msbB mutant (Figure 2D). These results indicate that the deletion of msbB increased the outer membrane permeability, diminished biofilm formation, and led to a reduction in resistance to some ions and antibiotics.

3.3. Loss of msbB Reduced the Swarming Motility of V. parahaemolyticus

First, we visualized the flagella of the WT, ΔmsbB, and CΔmsbB strains using negative-staining electron microscopy. While WT and CΔmsbB cells exhibited multiple flagella, the ΔmsbB strain produced fewer flagella (Figure 3A). To assess motility, we compared the swimming abilities of these strains. The WT and CΔmsbB strains spread asymmetrically across the plate, indicative of swimming motility (Figure 3B,C). In contrast, the ΔmsbB strain showed minimal movement beyond the initial inoculum, suggesting a defect in its swimming motility (Figure 3B,C). We further evaluated the mRNA expression levels of flagellar-related genes via qRT-PCR. Notably, all polar flagellar genes (flgB, flgK, flgM, and fliC) and lateral flagellar genes (fliK, fliR, flgB, lafA, and motY) were significantly downregulated in the ΔmsbB strain compared to the WT strain. However, the polar flagellar cluster II gene fliE showed no significant difference between the WT and ΔmsbB strains (Figure 3D). These findings confirm that the ΔmsbB strain had an impaired motility.

3.4. The Virulence of ∆msbB Was Attenuated to Tetrahymena

To assess the virulence of the ∆msbB strain, a co-culture experiment was performed with Tetrahymena. In co-culture experiments with Tetrahymena, the ΔmsbB strain was phagocytosed at a significantly faster rate compared to the wild-type (WT) and complementary ΔmsbB (CΔmsbB) strains. After 6 h of co-culture, OD600 of the ΔmsbB strain was the lowest among the three strains, with values of 0.1 for ΔmsbB, 0.21 for WT, and 0.23 for CΔmsbB (Figure 4A–D). This indicates that the ΔmsbB strain had a reduced ability to resist phagocytosis by Tetrahymena. Furthermore, to assess the impact of msbB deletion on cellular viability, lysates from the three strains were used to treat Tetrahymena, and cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay. The results showed that the Tetrahymena treated with ΔmsbB lysate had a higher viability compared to those treated with WT and CΔmsbB lysates (Figure 4E). This suggests that the deletion of msbB not only affected the bacteria’s resistance to phagocytosis, but also reduced its cytotoxicity towards Tetrahymena. These findings collectively indicate that the deletion of the msbB gene significantly reduced the virulence of the bacteria.

3.5. Attenuated Pathogenicity of ΔmsbB Strain Against Shrimp

Infection experiments were conducted to assess the lethality and pathogenicity of ΔmsbB in L. vannamei shrimp. The relative percent survival (RPS) of shrimp infected with ∆msbB was 78%, while the relative percent survival (RPS) of shrimp infected with the WT was 38% (Figure 5A). As depicted in Figure 5B, the shrimp infected with the WT showed reddening of the uropod, an enlarged stomach, and yellow discoloration of the hepatopancreas, whereas the group infected with the ∆msbB strain displayed a slightly yellow discoloration of the hepatopancreas at the late stage of infection. Histopathological sections were prepared to evaluate the impact of ΔmsbB infections on the shrimp hepatopancreas. The histopathology of the shrimp hepatopancreas revealed that uninfected shrimps exhibited a normal hepatopancreas structure with a high number of B cells, R cells, and F cells (Figure 5C). In contrast, the H&E staining of infected shrimp showed histopathological changes in hepatopancreatic tissues due to bacterial infection. Shrimp infected with the WT strain exhibited sloughing of the epithelial cells (Slo), structural atrophy, and necrosis (Nec) (Figure 5C). In contrast, the ∆msbB group exhibited a normal structure and a reduction in hepatopancreas injury, but sloughing of the epithelial cells (Slo) and karyomegaly were evident. The relative expression levels of immune-related genes, such as ACP, SOD, CAT, PO1, PO2, and inflammatory cytokine interleukin-1β (IL-1β), were tested in shrimp hepatopancreas infected with the WT and ΔmsbB. The expressions of all immune genes and the inflammatory cytokine interleukin-1β (IL-1β) gene were significantly lower in the groups treated with ΔmsbB than in the WT group (Figure 5D). Taken together, these results demonstrate a significantly attenuated pathogenicity of ∆msbB in vivo.

4. Discussion

This study investigated the role of the msbB gene in V. parahaemolyticus by constructing a deletion mutant (ΔmsbB) and a complementary strain (CΔmsbB). Our results demonstrated that the deletion of msbB increased outer membrane permeability, reduced biofilm formation, and diminished swarming motility. Furthermore, the ΔmsbB strain exhibited attenuated virulence in both Tetrahymena and shrimp infection models, indicating a reduced ability to resist phagocytosis and a decreased cytotoxicity.
The msbB gene has been extensively investigated in various Gram-negative bacteria, including E. coli, N. meningitidis, and S. enterica [27,28,29,30,31]. In E. coli, the deletion of the msbB gene impairs lipid A synthesis, thereby compromising the integrity of the outer membrane [27].
In our study, the deletion of the msbB gene resulted in a significant enhancement of NPN fluorescence signals, indicating that NPN could more readily penetrate the cell interior. This suggests an increase in outer membrane permeability. Gram-negative bacteria are characterized by their outer membrane (OM), which functions as an asymmetric barrier. The inner leaflet of the OM is predominantly composed of glycerophospholipids, whereas the outer leaflet is made up of lipopolysaccharide (LPS) [35]. Lipid A, the lipid anchor of LPS, constitutes the outer leaflet of the OM and is essential for maintaining its structural integrity. The msbB gene encodes a myristoyltransferase that catalyzes the final step of lipid A biosynthesis [36,37]. In Klebsiella pneumoniae, the deletion of the msbB gene, which is involved in a similar pathway, results in an increased outer membrane permeability [38]. Consistent with this, our results demonstrated that the deletion of the msbB gene significantly enhanced outer membrane permeability. This evidence suggests that the msbB gene may influence the structural integrity of the outer membrane, primarily through its role in lipid A biosynthesis.
Antibiotic resistance has become a major global health challenge, with multidrug-resistant bacteria posing significant threats to the effective treatment of infections [39,40]. In recent years, the problem of antibiotic resistance in V. parahaemolyticus has become increasingly severe due to the overuse and misuse of antibiotics [1,41]. Research has demonstrated that the resistance mechanisms of V. parahaemolyticus are multifaceted, involving horizontal gene transfer, alterations in cell membrane structure, efflux pump systems, and the formation of biofilms, among other factors [1,42,43].
To date, most antibiotics are designed to target intracellular processes and must penetrate the bacterial cell envelope to exert their effects [44]. For Gram-negative bacteria, including Vibrio parahaemolyticus, the outer membrane acts as a primary barrier against antibiotic entry. This membrane is composed of lipopolysaccharide (LPS) and glycerophospholipids, and the synchronized synthesis of these components is essential for maintaining the unique permeability barrier of the outer membrane [45]. Impaired outer membrane integrity increases bacterial sensitivity to environmental stress and antibiotics [44,46]. In our study, the ΔmsbB mutant exhibited an increased outer membrane permeability and sensitivity to stress factors and antibiotics. This finding is consistent with observations in other Gram-negative bacteria, such as K. pneumoniae, where deletions in lipid A biosynthesis pathways similarly lead to an increased outer membrane permeability and heightened antibiotic sensitivity [38]. Our results indicate that an increased sensitivity to certain antibiotics in the msbB mutant is associated with an altered outer membrane permeability.
Moreover, our study showed that the ΔmsbB mutant exhibited a reduced capacity for biofilm formation. To date, no reports have elucidated the molecular mechanisms by which the msbB gene impacts biofilm formation. Flagella and motility are key factors in the initiation and maturation of biofilms [47]. Our results corroborate this theory, as msbB mutants exhibited a reduced motility and biofilm formation. We speculate that the impaired biofilm formation in ΔmsbB mutants may primarily be associated with defective flagella synthesis. Moreover, biofilm formation and stability are influenced by a multitude of factors, including environmental stress, nutritional conditions, and host immune responses [48]. We hypothesize that changes in biofilm characteristics may also be related to the compromised outer membrane integrity caused by msbB deletion, leading to imbalances in material transport capabilities. Further investigation is required to elucidate the detailed molecular mechanisms by which the msbB gene affects biofilm formation. Some bacteria form biofilms to reduce antibiotic penetration; biofilms are complex bacterial communities with high levels of drug resistance and environmental adaptability [48,49]. The enhanced antibiotic sensitivity of our ΔmsbB mutant may be attributed not only to a compromised biofilm integrity, but also to its impaired biofilm formation capability. In summary, these phenomena suggest that the role of the msbB gene in maintaining both outer membrane stability and biofilm formation is conserved across different Gram-negative bacterial species.
We found that the deletion of msbB significantly inhibited bacterial motility. Transmission electron microscopy (TEM) revealed that flagella synthesis was affected in the ΔmsbB mutant. Compared to the WT, the mutant exhibited a significant reduction in both the number and morphology of lateral and polar flagella. Since flagella are the primary organelles responsible for bacterial motility, these findings indicate that msbB influences bacterial motility by affecting flagella synthesis. Quantitative PCR (qPCR) analysis showed that the expression levels of genes controlling both polar and lateral flagella were significantly downregulated in the ΔmsbB mutant. This suggests that msbB deletion affects the expression of genes related to flagella synthesis, thereby inhibiting flagella formation. Although few studies have reported on the impact of msbB on bacterial motility, it has been demonstrated that flagella assembly in E. coli depends on the length of lipopolysaccharide (LPS) [50]. Given that msbB is involved in LPS synthesis, the influence of msbB on motility may also be related to LPS length. However, the specific regulatory molecular mechanisms of this require further investigation.
The attenuation of bacterial endotoxins is a critical factor in reducing the pathogenicity of bacteria towards hosts. In a murine model, msbB-deleted S.typhimurium exhibited significant attenuation and was capable of eliciting a robust immune response, including the production of IgG and IgA, as well as the secretion of cytokines [30]. Previous studies have shown that LPS produced by msbB-deleted E. coli has a significantly reduced ability to activate an inflammatory response in the host [51]. Similarly, msbB-deleted S.typhimurium elicits a reduced inflammatory response [30,31].
Our study demonstrated that the deletion of the msbB gene in V. parahaemolyticus significantly reduced the mortality rate in shrimp, alleviated hepatopancreatic lesion symptoms, and notably decreased the expression of the inflammatory cytokine interleukin-1β (IL-1β) gene. The IL-1β gene can enhance the phagocytic function of immune cells and stimulates the production of more inflammatory mediators, creating a cascade effect [52,53]. This suggests that the ΔmsbB strain causes a decreased inflammatory response to shrimp. Vaccine development based on the msbB gene has shown promising results. Researchers have utilized msbB-deleted bacteria or their LPS as vaccine antigens to induce immune protection in hosts [31]. In animal experiments, vaccines made from msbB-deleted bacteria effectively protected animals from infection by wild-type bacteria, demonstrating a good immunogenicity and protective efficacy [31,54]. This indicates that msbB-deleted bacteria can also serve as effective vaccine candidates in V. parahaemolyticus, providing a novel approach to combat bacterial infections.
The msbB gene of V. parahaemolyticus is involved in the synthesis of endotoxins, and its deletion leads to a significant reduction in endotoxin activity. Endotoxins are an essential component of the bacterial cell wall and can be recognized by the host immune system to trigger an immune response [24,27,29]. Therefore, the reduced endotoxin activity of the ΔmsbB strain may diminish the activation of the shrimp immune system.
In our study, although the immune response in shrimp infected with msbB-deleted V. parahaemolyticus was lower than that in shrimp infected with the wild-type (WT) strain, an immune response was still observed. Among the immune-related genes, the expression level of the acid phosphatase (ACP) gene decreased the least, with a reduction of less than 20%. Vibrio species infection typically activates the expression of various immune-related genes in shrimp, such as ACP, SOD, CAT, PO1, and PO2. ACP functions by hydrolyzing components of the pathogen cell wall, while SOD and CAT work by scavenging reactive oxygen species to reduce the damage caused by pathogens to the cells. PO1 and PO2, on the other hand, synthesize melanin to encapsulate pathogens, thereby preventing their spread [55,56]. These immune-related genes work together through multiple mechanisms to enhance the immune defense capabilities of shrimp. Overall, ΔmsbB still elicited a high level of immune response to V. parahaemolyticus, while significantly reducing its pathogenicity in shrimp. This suggests that msbB gene deletion can modulate the host’s immune response, reducing the severity of infection without completely abolishing the immune reaction.

5. Conclusions

This study investigated the role of the msbB gene in V. parahaemolyticus using a deletion mutant (ΔmsbB). The results showed that msbB deletion increased outer membrane permeability, reduced biofilm formation, and diminished swarming motility. The ΔmsbB strain exhibited attenuated virulence in shrimp, with a reduced mortality and fewer hepatopancreatic lesion symptoms. These findings align with studies in other Gram-negative bacteria, highlighting msbB’s role in maintaining outer membrane stability and biofilm formation. The study also suggests that msbB deletion can modulate the host’s immune response, reducing pathogenicity while still eliciting an immune reaction. This indicates the potential of msbB-deleted bacteria as vaccine candidates. However, the study was limited by the lack of long-term infection models to assess the durability of the attenuated phenotype and the immune response. Future studies should address these limitations to fully realize the vaccine potential of msbB-deleted strains.

Author Contributions

Data curation, B.L.; funding acquisition, B.B.; investigation, J.C., B.L., Q.F. and S.H.; methodology, J.C., B.L. and Q.F.; validation, J.C.; visualization, Q.F.; writing—original draft, J.C.; writing—review and editing, L.W. and B.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Key R&D Program of China (2022YFD2400103), and the Fisheries High Quality Development Project of Fujian (FJHYF-L-2023-16).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the FigShare at 10.6084/m9.figshare.28241171 or the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bai, Y.; Yang, Q.; Sun, Y.; Li, F.; Sun, J.; Yang, S.; Yang, D.; Peng, Z.; Yang, B.; Xu, J.; et al. Antimicrobial susceptibility and genomic characterization of Vibrio parahaemolyticus isolated from aquatic foods in 15 provinces, China, 2020. Int. J. Food Microbiol. 2024, 418, 110737. [Google Scholar] [CrossRef]
  2. Brumfield, K.D.; Chen, A.J.; Gangwar, M.; Usmani, M.; Hasan, N.A.; Jutla, A.S.; Huq, A.; Colwell, R.R. Environmental Factors Influencing Occurrence of Vibrio parahaemolyticus and Vibrio vulnificus. Appl. Environ. Microbiol. 2023, 89, e0030723. [Google Scholar] [CrossRef] [PubMed]
  3. Chen, L.; Wang, J.; Chen, J.; Zhang, R.; Zhang, H.; Qi, X.; He, Y. Epidemiological characteristics of Vibrio parahaemolyticus outbreaks, Zhejiang, China, 2010–2022. Front. Microbiol. 2023, 14, 1171350. [Google Scholar] [CrossRef] [PubMed]
  4. Dubey, S.; Singh, A.; Kumar, B.T.N.; Singh, N.K.; Tyagi, A. Isolation and Characterization of Bacteriophages from Inland Saline Aquaculture Environments to Control Vibrio parahaemolyticus Contamination in Shrimp. Indian J. Microbiol. 2021, 61, 212–217. [Google Scholar] [CrossRef]
  5. Rezny, B.R.; Evans, D.S. Vibrio parahaemolyticus Infection. In StatPearls; StatPearls Publishing LLC.: St. Petersburg, FL, USA, 2025. [Google Scholar]
  6. Stratev, D.; Stoyanchev, T.; Bangieva, D. Occurrence of Vibrio parahaemolyticus and Staphylococcus aureus in seafood. Ital. J. Food Saf. 2021, 10, 10027. [Google Scholar] [CrossRef]
  7. Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol. Res. 2019, 222, 43–51. [Google Scholar] [CrossRef]
  8. Ghenem, L.; Elhadi, N.; Alzahrani, F.; Nishibuchi, M. Vibrio Parahaemolyticus: A Review on Distribution, Pathogenesis, Virulence Determinants and Epidemiology. Saudi J. Med. Med. Sci. 2017, 5, 93–103. [Google Scholar] [CrossRef]
  9. Pazhani, G.P.; Chowdhury, G.; Ramamurthy, T. Adaptations of Vibrio parahaemolyticus to Stress During Environmental Survival, Host Colonization, and Infection. Front. Microbiol. 2021, 12, 737299. [Google Scholar] [CrossRef]
  10. Plaza, N.; Perez-Reytor, D.; Corsini, G.; Garcia, K.; Urrutia, I.M. Contribution of the Type III Secretion System (T3SS2) of Vibrio parahaemolyticus in Mitochondrial Stress in Human Intestinal Cells. Microorganisms 2024, 12, 813. [Google Scholar] [CrossRef]
  11. Burrell, R. Immunomodulation by bacterial endotoxin. Crit. Rev. Microbiol. 1990, 17, 189–208. [Google Scholar] [CrossRef]
  12. Brandenburg, K.; Schromm, A.B.; Weindl, G.; Heinbockel, L.; Correa, W.; Mauss, K.; Martinez de Tejada, G.; Garidel, P. An update on endotoxin neutralization strategies in Gram-negative bacterial infections. Expert. Rev. Anti Infect. Ther. 2021, 19, 495–517. [Google Scholar] [CrossRef] [PubMed]
  13. Osei-Adjei, G.; Huang, X.; Zhang, Y. The extracellular proteases produced by Vibrio parahaemolyticus. World J. Microbiol. Biotechnol. 2018, 34, 68. [Google Scholar] [CrossRef] [PubMed]
  14. Sheehan, J.R.; Sadlier, C.; O’Brien, B. Bacterial endotoxins and exotoxins in intensive care medicine. BJA Educ. 2022, 22, 224–230. [Google Scholar] [CrossRef]
  15. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front. Microbiol. 2014, 5, 805. [Google Scholar] [CrossRef]
  16. Raetz, C.R.; Whitfield, C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef]
  17. Swain, P.; Nayak, S.K.; Nanda, P.K.; Dash, S. Biological effects of bacterial lipopolysaccharide (endotoxin) in fish: A review. Fish Shellfish Immunol. 2008, 25, 191–201. [Google Scholar] [CrossRef]
  18. Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef]
  19. Whitfield, C.; Trent, M.S. Biosynthesis and export of bacterial lipopolysaccharides. Annu. Rev. Biochem. 2014, 83, 99–128. [Google Scholar] [CrossRef]
  20. Gryaznova, M.; Burakova, I.; Smirnova, Y.; Morozova, P.; Chirkin, E.; Gureev, A.; Mikhaylov, E.; Korneeva, O.; Syromyatnikov, M. Effect of Probiotic Bacteria on the Gut Microbiome of Mice with Lipopolysaccharide-Induced Inflammation. Microorganisms 2024, 12, 1341. [Google Scholar] [CrossRef]
  21. Bamba, T.; Matsui, R.; Watabe, K. Effect of steam-heat treatment with/without divalent cations on the inactivation of lipopolysaccharides from several bacterial species. PDA J. Pharm. Sci. Technol. 1996, 50, 129–135. [Google Scholar]
  22. Fujii, S.; Takai, M.; Maki, T. Wet heat inactivation of lipopolysaccharide from E. coli serotype 055:B5. PDA J. Pharm. Sci. Technol. 2002, 56, 220–227. [Google Scholar] [PubMed]
  23. Gutsmann, T.; Schromm, A.B.; Brandenburg, K. The physicochemistry of endotoxins in relation to bioactivity. Int. J. Med. Microbiol. 2007, 297, 341–352. [Google Scholar] [CrossRef] [PubMed]
  24. Raetz, C.R. Bacterial endotoxins: Extraordinary lipids that activate eucaryotic signal transduction. J. Bacteriol. 1993, 175, 5745–5753. [Google Scholar] [CrossRef] [PubMed]
  25. Ji, F.; Huang, D.; Tan, X.; Guo, Y.; Wang, Z.; Zhou, Q.; Wang, X. Structure analysis of lipid A species in Vibrio parahaemolyticus by constructing mutants lacking multiple secondary acyltransferases of lipid A. Biotechnol. Appl. Biochem. 2023, 70, 716–729. [Google Scholar] [CrossRef]
  26. Zhou, Q.; Tan, X.; Meng, X.; Wang, J.; Ji, F.; Wang, X. Identification of four secondary acyltransferases for lipid A biosynthesis in Vibrio parahaemolyticus. Biotechnol. Appl. Biochem. 2021, 68, 1486–1500. [Google Scholar] [CrossRef]
  27. Somerville, J.E., Jr.; Cassiano, L.; Darveau, R.P. Escherichia coli msbB gene as a virulence factor and a therapeutic target. Infect. Immun. 1999, 67, 6583–6590. [Google Scholar] [CrossRef]
  28. Post, D.M.; Ketterer, M.R.; Phillips, N.J.; Gibson, B.W.; Apicella, M.A. The msbB mutant of Neisseria meningitidis strain NMB has a defect in lipooligosaccharide assembly and transport to the outer membrane. Infect. Immun. 2003, 71, 647–655. [Google Scholar] [CrossRef]
  29. Low, K.B.; Ittensohn, M.; Le, T.; Platt, J.; Sodi, S.; Amoss, M.; Ash, O.; Carmichael, E.; Chakraborty, A.; Fischer, J.; et al. Lipid A mutant Salmonella with suppressed virulence and TNFalpha induction retain tumor-targeting in vivo. Nat. Biotechnol. 1999, 17, 37–41. [Google Scholar] [CrossRef]
  30. Claes, A.K.; Steck, N.; Schultz, D.; Zahringer, U.; Lipinski, S.; Rosenstiel, P.; Geddes, K.; Philpott, D.J.; Heine, H.; Grassl, G.A. Salmonella enterica serovar Typhimurium DeltamsbB triggers exacerbated inflammation in Nod2 deficient mice. PLoS ONE 2014, 9, e113645. [Google Scholar] [CrossRef]
  31. Cobb, J.; Rawson, J.; Gonzalez, N.; Hensel, M.; Kandeel, F.; Husseiny, M.I. Oral Salmonella msbB Mutant as a Carrier for a Salmonella-Based Vaccine for Prevention and Reversal of Type 1 Diabetes. Front. Immunol. 2021, 12, 667897. [Google Scholar] [CrossRef]
  32. Che, J.; Fang, Q.; Hu, S.; Liu, B.; Wang, L.; Fang, X.; Li, L.; Luo, T.; Bao, B. The Impact of Vp-Porin, an Outer Membrane Protein, on the Biological Characteristics and Virulence of Vibrio Parahaemolyticus. Biology 2024, 13, 485. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, M.; Chen, S. A novel adhesive factor contributing to the virulence of Vibrio parahaemolyticus. Sci. Rep. 2015, 5, 14449. [Google Scholar] [CrossRef]
  34. Pang, M.D.; Lin, X.Q.; Hu, M.; Li, J.; Lu, C.P.; Liu, Y.J. Tetrahymena: An alternative model host for evaluating virulence of Aeromonas strains. PLoS ONE 2012, 7, e48922. [Google Scholar] [CrossRef] [PubMed]
  35. Douglass, M.V.; Cleon, F.; Trent, M.S. Cardiolipin aids in lipopolysaccharide transport to the gram-negative outer membrane. Proc. Natl. Acad. Sci. USA 2021, 118, e2018329118. [Google Scholar] [CrossRef]
  36. Murray, S.R.; Bermudes, D.; de Felipe, K.S.; Low, K.B. Extragenic suppressors of growth defects in msbB Salmonella. J. Bacteriol. 2001, 183, 5554–5561. [Google Scholar] [CrossRef] [PubMed]
  37. Dovala, D.; Rath, C.M.; Hu, Q.; Sawyer, W.S.; Shia, S.; Elling, R.A.; Knapp, M.S.; Metzger, L.E., IV. Structure-guided enzymology of the lipid A acyltransferase LpxM reveals a dual activity mechanism. Proc. Natl. Acad. Sci. USA 2016, 113, E6064–E6071. [Google Scholar] [CrossRef]
  38. Clements, A.; Tull, D.; Jenney, A.W.; Farn, J.L.; Kim, S.H.; Bishop, R.E.; McPhee, J.B.; Hancock, R.E.; Hartland, E.L.; Pearse, M.J.; et al. Secondary acylation of Klebsiella pneumoniae lipopolysaccharide contributes to sensitivity to antibacterial peptides. J. Biol. Chem. 2007, 282, 15569–15577. [Google Scholar] [CrossRef]
  39. Larsson, D.G.J.; Flach, C.F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef]
  40. Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4, 24. [Google Scholar] [CrossRef]
  41. Zaafrane, S.; Maatouk, K.; Alibi, S.; Ben Mansour, H. Occurrence and antibiotic resistance of Vibrio parahaemolyticus isolated from the Tunisian coastal seawater. J. Water Health 2022, 20, 369–384. [Google Scholar] [CrossRef]
  42. Wang, T.; Yao, L.; Qu, M.; Wang, L.; Li, F.; Tan, Z.; Wang, P.; Jiang, Y. Whole genome sequencing and antimicrobial resistance analysis of Vibrio parahaemolyticus Vp2015094 carrying an antimicrobial-resistant plasmid. J. Glob. Antimicrob. Resist. 2022, 30, 47–49. [Google Scholar] [CrossRef] [PubMed]
  43. Elmahdi, S.; DaSilva, L.V.; Parveen, S. Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiol. 2016, 57, 128–134. [Google Scholar] [CrossRef] [PubMed]
  44. Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim. Biophys. Acta 2009, 1794, 808–816. [Google Scholar] [CrossRef] [PubMed]
  45. Sun, J.; Rutherford, S.T.; Silhavy, T.J.; Huang, K.C. Physical properties of the bacterial outer membrane. Nat. Rev. Microbiol. 2022, 20, 236–248. [Google Scholar] [CrossRef]
  46. Konovalova, A.; Mitchell, A.M.; Silhavy, T.J. A lipoprotein/beta-barrel complex monitors lipopolysaccharide integrity transducing information across the outer membrane. eLife 2016, 5, e15276. [Google Scholar] [CrossRef]
  47. Wang, F.; Deng, L.; Huang, F.; Wang, Z.; Lu, Q.; Xu, C. Flagellar Motility Is Critical for Salmonella enterica Serovar Typhimurium Biofilm Development. Front. Microbiol. 2020, 11, 1695. [Google Scholar] [CrossRef]
  48. Liu, H.Y.; Prentice, E.L.; Webber, M.A. Mechanisms of antimicrobial resistance in biofilms. npj Antimicrob. Resist. 2024, 2, 27. [Google Scholar] [CrossRef]
  49. Secor, H.V.; DeBardeleben, J.F. Syntheses and screening of some trifluoromethyl pyrazoles. J. Med. Chem. 1971, 14, 997–998. [Google Scholar] [CrossRef]
  50. Wang, Z.; Wang, J.; Ren, G.; Li, Y.; Wang, X. Deletion of the genes waaC, waaF, or waaG in Escherichia coli W3110 disables the flagella biosynthesis. J. Basic. Microbiol. 2016, 56, 1021–1035. [Google Scholar] [CrossRef]
  51. Shen, X.; Yang, Y.B.; Gao, Y.; Wang, S.; Wang, H.; Sun, M.; Meng, F.; Tang, Y.D.; Tu, Y.; Kong, Q.; et al. Lipid A-modified Escherichia coli can produce porcine parvovirus virus-like particles with high immunogenicity and minimal endotoxin activity. Microb. Cell Fact. 2024, 23, 222. [Google Scholar] [CrossRef]
  52. Zheng, D.; Liwinski, T.; Elinav, E. Inflammasome activation and regulation: Toward a better understanding of complex mechanisms. Cell Discov. 2020, 6, 36. [Google Scholar] [CrossRef] [PubMed]
  53. Lin, M.C.; Pan, C.Y.; Hui, C.F.; Chen, J.Y.; Wu, J.L. Shrimp anti-lipopolysaccharide factor (SALF), an antimicrobial peptide, inhibits proinflammatory cytokine expressions through the MAPK and NF-kappaB pathways in LPS-induced HeLa cells. Peptides 2013, 40, 42–48. [Google Scholar] [CrossRef] [PubMed]
  54. Erova, T.E.; Kirtley, M.L.; Fitts, E.C.; Ponnusamy, D.; Baze, W.B.; Andersson, J.A.; Cong, Y.; Tiner, B.L.; Sha, J.; Chopra, A.K. Protective Immunity Elicited by Oral Immunization of Mice with Salmonella enterica Serovar Typhimurium Braun Lipoprotein (Lpp) and Acetyltransferase (MsbB) Mutants. Front. Cell Infect. Microbiol. 2016, 6, 148. [Google Scholar] [CrossRef] [PubMed]
  55. Yin, X.; Zhuang, X.; Luo, W.; Liao, M.; Huang, L.; Cui, Q.; Huang, J.; Yan, C.; Jiang, Z.; Liu, Y.; et al. Andrographolide promote the growth and immunity of Litopenaeus vannamei, and protects shrimps against Vibrio alginolyticus by regulating inflammation and apoptosis via a ROS-JNK dependent pathway. Front. Immunol. 2022, 13, 990297. [Google Scholar] [CrossRef]
  56. Zhang, X.; Shi, J.; Sun, Y.; Wang, Y.; Zhang, Z. The potential role of eyestalk in the immunity of Litopenaeus vannamei to Vibrio infection. Fish ShellFish Immunol. 2022, 121, 62–73. [Google Scholar] [CrossRef]
Microorganisms 13 00386 g001
Figure 1. (A) The strategy of msbB gene was knocked out and complemented by allele exchange in V. parahaemolyticus; (B) agarose gel electrophoresis of PCR products amplified by ΔmsbB T1/T2 and CΔmsbB T1/T2 separately. Left: WT (1160 bp) and ΔmsbB mutant (200 bp); right: ΔmsbB mutant (1352 bp) and its complementary strain CΔmsbB (2313 bp); and (C) the growth curves of WT, ΔmsbB, and CΔmsbB strains. n = 3.
Figure 1. (A) The strategy of msbB gene was knocked out and complemented by allele exchange in V. parahaemolyticus; (B) agarose gel electrophoresis of PCR products amplified by ΔmsbB T1/T2 and CΔmsbB T1/T2 separately. Left: WT (1160 bp) and ΔmsbB mutant (200 bp); right: ΔmsbB mutant (1352 bp) and its complementary strain CΔmsbB (2313 bp); and (C) the growth curves of WT, ΔmsbB, and CΔmsbB strains. n = 3.
Microorganisms 13 00386 g001
Microorganisms 13 00386 g002
Figure 2. (A) Comparison of outer membrane permeability of WT, ∆msbB and C∆msbB. The fluorescence intensity was determined with excitation at 360 nm and emission at 428 nm. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test; each bar represents as the mean  ±  SD. n = 6; (B) comparison of resistance to 13 antibiotics among WT, ∆msbB and C∆msbB. The fold change is calculated by log2 (the MIC of mutants/MIC of WT); (C) survival of V. parahaemolyticus and ΔmsbB in the presence of varying different ions and antibiotics. Error bars represent the standard deviation of the mean from at least three (n = 3) independent replicates. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; and (D) analysis of biofilm formation ability of WT, ∆msbB and C∆msbB strains. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test. The data are presented as the mean ± SD (n = 3). Columns have been marked with an asterisk (* p < 0.05; *** p < 0.001). ns: not significant.
Figure 2. (A) Comparison of outer membrane permeability of WT, ∆msbB and C∆msbB. The fluorescence intensity was determined with excitation at 360 nm and emission at 428 nm. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test; each bar represents as the mean  ±  SD. n = 6; (B) comparison of resistance to 13 antibiotics among WT, ∆msbB and C∆msbB. The fold change is calculated by log2 (the MIC of mutants/MIC of WT); (C) survival of V. parahaemolyticus and ΔmsbB in the presence of varying different ions and antibiotics. Error bars represent the standard deviation of the mean from at least three (n = 3) independent replicates. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; and (D) analysis of biofilm formation ability of WT, ∆msbB and C∆msbB strains. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test. The data are presented as the mean ± SD (n = 3). Columns have been marked with an asterisk (* p < 0.05; *** p < 0.001). ns: not significant.
Microorganisms 13 00386 g002
Microorganisms 13 00386 g003
Figure 3. (A) Visualization of bacterial flagellar with negative-staining electron microscopy. Scale bar = 1 μm; (B) swimming motility assay of WT, ∆msbB, and C∆msbB on LB plates with 0.3% agar cultured for 6 h and 12 h at 37 °C; (C) analysis of motility ability of WT, ∆msbB, and C∆msbB strains. The diameters of swimming zone reflect bacterial migration on the 0.3% agar. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; (D) qRT-PCR analysis of the transcription levels of polar flagellar genes (flgB, flgK, flgM, fliC, and fliE) in ∆msbB compared to WT. *** p < 0.001; and (E) qRT-PCR analysis of the transcription levels of lateral flagellar genes (fliK, fliR, flgB, lafA, and motY) in ∆msbB compared to WT. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; The data are presented as the mean  ±  SD (n  =  3). * p < 0.05; ** p < 0.01; and *** p < 0.001. ns: not significant.
Figure 3. (A) Visualization of bacterial flagellar with negative-staining electron microscopy. Scale bar = 1 μm; (B) swimming motility assay of WT, ∆msbB, and C∆msbB on LB plates with 0.3% agar cultured for 6 h and 12 h at 37 °C; (C) analysis of motility ability of WT, ∆msbB, and C∆msbB strains. The diameters of swimming zone reflect bacterial migration on the 0.3% agar. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; (D) qRT-PCR analysis of the transcription levels of polar flagellar genes (flgB, flgK, flgM, fliC, and fliE) in ∆msbB compared to WT. *** p < 0.001; and (E) qRT-PCR analysis of the transcription levels of lateral flagellar genes (fliK, fliR, flgB, lafA, and motY) in ∆msbB compared to WT. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; The data are presented as the mean  ±  SD (n  =  3). * p < 0.05; ** p < 0.01; and *** p < 0.001. ns: not significant.
Microorganisms 13 00386 g003
Microorganisms 13 00386 g004
Figure 4. Virulence assessment of WT, ∆msbB, and C∆msbB using the Tetrahymena model. (A–C) Growth dynamics of ∆msbB, C∆msbB, and WT strains co-cultured with or without Tetrahymena. Tetra represents Tetrahymena. (D) Relative survival of ∆msbB, C∆msbB, and WT strains co-cultured with Tetrahymena. Relative survival was calculated as the OD600 of strains co-cultured with Tetrahymena divided by the OD600 of bacteria grown alone at the end of the experiment. Data are presented as mean ± SD from three independent measurements. *** p < 0.001. ns: not significant. (E) Viability of Tetrahymena cells treated with lysates from the three strains after 6 h, assessed using CCK8 reagents. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test; Data are presented as the mean ± SD (n = 3). The significant difference in the results was analyzed. ** p < 0.01. ns: not significant.
Figure 4. Virulence assessment of WT, ∆msbB, and C∆msbB using the Tetrahymena model. (A–C) Growth dynamics of ∆msbB, C∆msbB, and WT strains co-cultured with or without Tetrahymena. Tetra represents Tetrahymena. (D) Relative survival of ∆msbB, C∆msbB, and WT strains co-cultured with Tetrahymena. Relative survival was calculated as the OD600 of strains co-cultured with Tetrahymena divided by the OD600 of bacteria grown alone at the end of the experiment. Data are presented as mean ± SD from three independent measurements. *** p < 0.001. ns: not significant. (E) Viability of Tetrahymena cells treated with lysates from the three strains after 6 h, assessed using CCK8 reagents. Statistical comparisons were performed using one-way ANOVA analyses followed by a Dunnett’s multiple comparison test; Data are presented as the mean ± SD (n = 3). The significant difference in the results was analyzed. ** p < 0.01. ns: not significant.
Microorganisms 13 00386 g004
Microorganisms 13 00386 g005
Figure 5. Assessment of ∆msbB and WT strains’ pathogenicity against shrimp. (A) Relative survival curve of shrimp infected by ∆msbB and WT strains with immersion in concentration 4 × 107 CFU/mL; (B) clinical sign of diseased shrimps during infection at 10 d. The arrows indicate hepatopancreas, foregut, and uropod. Scale bar: 1 cm; (C) hepatopancreas of shrimp challenged with ∆msbB and WT strains at 7 d stained with H&E. HpB, B cells; HpF, F cell; HpE, E cell; HpR, R cell; karyomegaly, enlargement of nucleus; Nec, necrosis; Atr, atrophy; Slo, sloughing of epithelial cells. Scale bar: 100 μm; and (D) comparative analysis of the expression of immune-related genes and inflammatory cytokine interleukin-1β (IL-1β) gene in hepatopancreas of shrimp infected with ∆msbB strain vs. WT group. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; Columns have been marked with an asterisk (* p < 0.05; *** p < 0.001).
Figure 5. Assessment of ∆msbB and WT strains’ pathogenicity against shrimp. (A) Relative survival curve of shrimp infected by ∆msbB and WT strains with immersion in concentration 4 × 107 CFU/mL; (B) clinical sign of diseased shrimps during infection at 10 d. The arrows indicate hepatopancreas, foregut, and uropod. Scale bar: 1 cm; (C) hepatopancreas of shrimp challenged with ∆msbB and WT strains at 7 d stained with H&E. HpB, B cells; HpF, F cell; HpE, E cell; HpR, R cell; karyomegaly, enlargement of nucleus; Nec, necrosis; Atr, atrophy; Slo, sloughing of epithelial cells. Scale bar: 100 μm; and (D) comparative analysis of the expression of immune-related genes and inflammatory cytokine interleukin-1β (IL-1β) gene in hepatopancreas of shrimp infected with ∆msbB strain vs. WT group. Statistical comparisons were performed using two-way ANOVA analyses followed by a Dunnett’s multiple comparison test; Columns have been marked with an asterisk (* p < 0.05; *** p < 0.001).
Microorganisms 13 00386 g005
Table 1. Strains and plasmids.
Table 1. Strains and plasmids.
StrainsGenotype and CharacteristicsSource
V. Parahaemolyticus 17802Cms, Kms, Ampr, Wild-type strainATCC
∆msbBV. parahaemolyticus strain in-frame deletion in msbBThis study
C∆msbBThe complement of ∆msbBThis study
Escherichia coli
CC118λpir lysogen of CC118 (Δ(ara-leu) araD ΔlacX74galEgalKphoA20 thi-1rpsE rpoB argE (Am) recA1Our lab
CC118/pHelperCC118 λpir harboring plasmid pHelperOur lab
Plasmids
pSR47SBacterial allelic exchange vector with sacB, KanROur lab
pSR47S-∆msbBA 1394 bp fragment encompassing the upstream and downstream regions of the msbB gene in pSR47S, KanRThis study
pSR47S-C∆msbBA 2313 bp fragment harboring the msbB sequences in pSR47S, KanRThis study
Table 2. Sequences of PCR oligonucleotide primers.
Table 2. Sequences of PCR oligonucleotide primers.
Primer NamePrimer Sequence (5′ to 3′)Purpose
UP-FGCCGCTCTAGAACTAGTGGATCTAACTACGT
TCGTCGTCTATGGC		Creation of ∆msbB deletion fusion fragment
UP-RCAACTTGCCAGTCAGTGTTGTAGCGTGTCTAT
TACCTATCCGTC
DOWN-FGACGGATAGGTAACTAGACACGCTACAACACTGACTGGCAAGTTG
DOWN-RGGATCGATCCTCTAGATCGATGTGTTCA TGGAACTGTGTTGG
msbB-H1CTCTAGAACTAGTGGATCCGTTGAAGAACGCGAATACGAAGCreation of C∆msbB fragment
msbB-H2TCGATCCTCTAGAGTCGAGTGCAGCAACTT
CGGCATAGTG
∆msbB-T1GTAGCATCACTTGTTGCCACCConfirmation of deletion strain
∆msbB-T2GGACATCACCATATCACCAACC
C∆msbB-T1CGTTGAAGAACGCGAATACGAAGConfirmation of complementary strain
C∆msbB-T2GTGCAGCAACTTCGGCATAGTG
Note: Complementary sites are underlined.
Table 3. Primers used for qRT-PCR.
Table 3. Primers used for qRT-PCR.
Primer NamePrimer Sequence (5′ to 3′)
Liva proPOI-FACGTCACTTCCGGCAAGCGA
Liva proPOI-RCCTCCTTGTGAGCGTTGTCAGG
Liva proPO II-FACCACTGGCACTGGCACCTCGTCTA
Liva proPO II-RTCGCCAGTTCTCGAGCTTCTGCAC
Liva cytMnSOD-FTGACGAGAGCTTTGGATCATTCC
Liva cytMnSOD-RTGATTTGCAAGGGATCCTGGTT
CAT-FATCCATTCGACCTTACCA
CAT-RACGCAATCTGCTCCACCT
ACP-FGTAGCATCACTTGTTGCCACC
ACP-RGGACATCACCATATCACCAACC
IL-1β-FCATCCCATTTGTGGTTCTG
IL-1β-RTCGTGCTTCACTATGCCTC
β-actin-FAGTAGCCGCCCTGGTTGT
β-actin-RAGGATACCTCGCTTGCTCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Che, J.; Liu, B.; Fang, Q.; Hu, S.; Wang, L.; Bao, B. Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms 2025, 13, 386. https://doi.org/10.3390/microorganisms13020386

AMA Style

Che J, Liu B, Fang Q, Hu S, Wang L, Bao B. Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms. 2025; 13(2):386. https://doi.org/10.3390/microorganisms13020386

Chicago/Turabian Style

Che, Jinyuan, Binghong Liu, Qitong Fang, Shaojie Hu, Lei Wang, and Baolong Bao. 2025. "Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus" Microorganisms 13, no. 2: 386. https://doi.org/10.3390/microorganisms13020386

APA Style

Che, J., Liu, B., Fang, Q., Hu, S., Wang, L., & Bao, B. (2025). Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms, 13(2), 386. https://doi.org/10.3390/microorganisms13020386

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop