Characterization and Anti-Inflammatory Effects of Akkermansia muciniphila-Derived Extracellular Vesicles
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of A. muciniphila
2.2. Isolation and Characterization of A. muciniphila-Derived Extracellular Vesicles
2.3. Protein Sequence Identification of A. muciniphila-Derived Extracellular Vesicles
2.4. Proteomic Analysis
2.5. Cell Culture
2.6. Cell Viability Assay
2.7. Cell Treatment
2.8. Determination of Nitric Oxide (NO) and Reactive Oxygen Species (ROS) Levels
2.9. Determination of Malondialdehyde (MDA) and Catalase (CAT) Levels
2.10. qRT-PCR Analysis
2.11. Transcriptome Analysis and Key Protein Interactions
2.12. Western Blot
2.13. Statistical Analysis
3. Results
3.1. The Preparation and Characterization of Am-EVs
3.2. Protein Identification of Am-EVs
3.3. Am-EVs Alleviated LPS-Induced Cytotoxicity in Caco-2 Cells
3.4. Am-EVs Ameliorated the LPS-Induced Oxidative Stress in Caco-2 Cells
3.5. Am-EVs Ameliorated the LPS-Induced Inflammation in Caco-2 Cells
3.6. Am-EVs Through the MAPK Signaling Pathway Regulate LPS-Induced Inflammation in Caco-2 Cells in RNA Sequencing Analysis
3.7. Am-EVs Modulate the Expression of MAPK Pathway-Related Genes to Inhibit LPS-Induced Inflammation in Caco-2 Cells in WB Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Derrien, M.; Van Baarlen, P.; Hooiveld, G.; Norin, E.; Müller, M.; de Vos, W.M. Modulation of mucosal immune response, tolerance, and proliferation in mice colonized by the mucin-degrader Akkermansia muciniphila. Front. Microbiol. 2011, 2, 166. [Google Scholar] [CrossRef] [PubMed]
- Belzer, C.; de Vos, W.M. Microbes inside-from diversity to function: The case of Akkermansia. ISME J. 2012, 6, 1449–1458. [Google Scholar] [CrossRef]
- Mo, C.Y.; Lou, X.R.; Xue, J.F.; Shi, Z.E.; Zhao, Y.F.; Wang, F.P.; Chen, G.B. The influence of Akkermansia muciniphila on intestinal barrier function. Gut Pathog. 2024, 16, 41. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 625–637. [Google Scholar] [CrossRef] [PubMed]
- Si, J.; Kang, H.; You, H.J.; Ko, G. Revisiting the role of Akkermansia muciniphila as a therapeutic bacterium. Gut Microbes 2022, 14, 2078619. [Google Scholar] [CrossRef]
- Xue, C.; Li, G.L.; Gu, X.Y.; Su, Y.S.; Zheng, Q.X.; Yuan, X.; Bao, Z.Y.; Lu, J.; Li, L.J. Health and Disease: Akkermansia muciniphila, the Shining Star of the Gut Flora. Research 2023, 6, 0107. [Google Scholar] [CrossRef]
- Zhao, Q.X.; Yu, J.D.; Hao, Y.; Zhou, H.; Hu, Y.W.; Zhang, C.; Zheng, H.P.; Wang, X.Y.; Zeng, F.L.; Hu, J.; et al. Akkermansia muciniphila plays critical roles in host health. Crit. Rev. Microbiol. 2023, 49, 82–100. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Lee, J.; Park, J.; Gho, Y.S. Gram-negative and Gram-positive bacterial extracellular vesicles. Semin. Cell Dev. Biol. 2015, 40, 97–104. [Google Scholar] [CrossRef]
- Herrmann, I.K.; Wood, M.J.A.; Fuhrmann, G. Extracellular vesicles as a next-generation drug delivery platform. Nat. Nanotechnol. 2021, 16, 748–759. [Google Scholar] [CrossRef] [PubMed]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, 640–656. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, C.-S.; Badia, J.; Bosch, M.; Giménez, R.; Baldomà, L. Outer Membrane Vesicles and Soluble Factors Released by Probiotic Escherichia coli Nissle 1917 and Commensal ECOR63 Enhance Barrier Function by Regulating Expression of Tight Junction Proteins in Intestinal Epithelial Cells. Front. Microbiol. 2016, 7, 1981. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.K.; Park, E.J.; Ko, S.Y.; Choi, E.W.; Kim, S. Therapeutic effects of kefir grain Lactobacillus-derived extracellular vesicles in mice with 2,4,6-trinitrobenzene sulfonic acid-induced inflammatory bowel disease. J. Dairy Sci. 2018, 101, 8662–8671. [Google Scholar] [CrossRef]
- Kang, C.S.; Ban, M.; Choi, E.J.; Moon, H.G.; Jeon, J.S.; Kim, D.K.; Park, S.K.; Jeon, S.G.; Roh, T.Y.; Myung, S.J.; et al. Extracellular Vesicles Derived from Gut Microbiota, Especially Akkermansia muciniphila, Protect the Progression of Dextran Sulfate Sodium-Induced Colitis. PLoS ONE 2013, 8, e76520. [Google Scholar] [CrossRef] [PubMed]
- Chelakkot, C.; Choi, Y.; Kim, D.-K.; Park, H.T.; Ghim, J.; Kwon, Y.; Jeon, J.; Kim, M.-S.; Jee, Y.-K.; Gho, Y.S.; et al. Akkermansia muciniphila-derived extracellular vesicles influence gut permeability through the regulation of tight junctions. Exp. Mol. Med. 2018, 50, e450. [Google Scholar] [CrossRef] [PubMed]
- Larregieu, C.A.; Benet, L.Z. Drug Discovery and Regulatory Considerations for Improving In Silico and In Vitro Predictions that Use Caco-2 as a Surrogate for Human Intestinal Permeability Measurements. AAPS J. 2013, 15, 483–497. [Google Scholar] [CrossRef] [PubMed]
- Yanan, G.; Songli, L.; Jiaqi, W.; Chaochao, L.; Shengguo, Z.; Nan, Z. Modulation of intestinal epithelial permeability in differentiated caco-2 cells exposed to aflatoxin M1 and ochratoxin A individually or collectively. Toxins 2018, 10, 13. [Google Scholar] [CrossRef]
- Yu, C.S.; Cheng, C.W.; Su, W.C.; Chang, K.C.; Huang, S.W.; Hwang, J.K.; Lu, C.H. CELLO2GO: A Web Server for Protein subCELlular LOcalization Prediction with Functional Gene Ontology Annotation. PLoS ONE 2014, 9, e99368. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic Acids Res. 2014, 42, D199–D205. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.C.; Wang, L.G.; Han, Y.Y.; He, Q.Y. clusterProfiler: An R Package for Comparing Biological Themes Among Gene Clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Ginestet, C. ggplot2: Elegant Graphics for Data Analysis. J. R. Stat. Soc. Ser. A Stat. Soc. 2011, 174, 245–246. [Google Scholar] [CrossRef]
- Yaghoubfar, R.; Behrouzi, A.; Banadkoki, E.Z.; Ashrafian, F.; Lari, A.; Vaziri, F.; Nojoumi, S.A.; Fateh, A.; Khatami, S.; Siadat, S.D. Effect of Akkermansia muciniphila, Faecalibacterium prausnitzii, and Their Extracellular Vesicles on the Serotonin System in Intestinal Epithelial Cells. Probiotics Antimicrob. Proteins 2021, 13, 1546–1556. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Doncheva, N.T.; Morris, J.H.; Gorodkin, J.; Jensen, L.J. Cytoscape StringApp: Network Analysis and Visualization of Proteomics Data. J. Proteome Res. 2019, 18, 623–632. [Google Scholar] [CrossRef] [PubMed]
- Rodovalho, V.D.; da Luz, B.S.R.; Nicolas, A.; do Carmo, F.L.R.; Jardin, J.; Briard-Bion, V.; Jan, G.; Le Loir, Y.; Azevedo, V.A.D.; Guedon, E. Environmental Conditions Modulate the Protein Content and Immunomodulatory Activity of Extracellular Vesicles Produced by the Probiotic Propionibacterium freudenreichii. Appl. Environ. Microbiol. 2021, 87, e02263-20. [Google Scholar] [CrossRef] [PubMed]
- Woo, J.H.; Kim, S.; Lee, T.; Lee, J.C.; Shin, J.H. Production of Membrane Vesicles in Listeria monocytogenes Cultured with or without Sub-Inhibitory Concentrations of Antibiotics and Their Innate Immune Responses In Vitro. Genes 2021, 12, 415. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.Y.; Choi, D.Y.; Kim, D.K.; Kim, J.W.; Park, J.O.; Kim, S.; Kim, S.H.; Desiderio, D.M.; Kim, Y.K.; Kim, K.P.; et al. Gram-positive bacteria produce membrane vesicles: Proteomics-based characterization of Staphylococcus aureus-derived membrane vesicles. Proteomics 2009, 9, 5425–5436. [Google Scholar] [CrossRef]
- Tartaglia, N.R.; Breyne, K.; Meyer, E.; Cauty, C.; Jardin, J.; Chrétien, D.; Dupont, A.; Demeyere, K.; Berkova, N.; Azevedo, V.; et al. Staphylococcus aureus Extracellular Vesicles Elicit an Immunostimulatory Response in vivo on the Murine Mammary Gland. Front. Cell. Infect. Microbiol. 2018, 8, 277. [Google Scholar] [CrossRef]
- Kaparakis-Liaskos, M.; Ferrero, R.L. Immune modulation by bacterial outer membrane vesicles. Nat. Rev. Immunol. 2015, 15, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Mehanny, M.; Kroniger, T.; Koch, M.; Hoppstädter, J.; Becher, D.; Kiemer, A.K.; Lehr, C.M.; Fuhrmann, G. Yields and immunomodulatory effects of pneumococcal membrane vesicles differ with the bacterial growth phase. Adv. Healthc. Mater. 2022, 11, 2101151. [Google Scholar] [CrossRef] [PubMed]
- Pisoschi, A.M.; Pop, A. The role of antioxidants in the chemistry of oxidative stress: A review. Eur. J. Med. Chem. 2015, 97, 55–74. [Google Scholar] [CrossRef] [PubMed]
- Shi, D.Y.; Xie, F.Z.; Zhai, C.; Stern, J.S.; Liu, Y.; Liu, S.L. The role of cellular oxidative stress in regulating glycolysis energy metabolism in hepatoma cells. Mol. Cancer 2009, 8, 32. [Google Scholar] [CrossRef]
- Jaswal, K.; Shrivastava, M.; Chaba, R. Revisiting long-chain fatty acid metabolism in Escherichia coli: Integration with stress responses. Curr. Genet. 2021, 67, 573–582. [Google Scholar] [CrossRef]
- Nikolova-Karakashian, M.N.; Reid, M.B. Sphingolipid Metabolism, Oxidant Signaling, and Contractile Function of Skeletal Muscle. Antioxid. Redox Signal. 2011, 15, 2501–2517. [Google Scholar] [CrossRef] [PubMed]
- Shin, J.H.; Choe, D.H.; Ransegnola, B.; Hong, H.R.; Onyekwere, I.; Cross, T.; Shi, Q.J.; Cho, B.K.; Westblade, L.F.; Brito, I.L.; et al. A multifaceted cellular damage repair and prevention pathway promotes high-level tolerance to β-lactam antibiotics. EMBO Rep. 2021, 22, e51790. [Google Scholar] [CrossRef]
- Haddad, J.J.; Harb, H.L. L-γ-glutamyl-L-cysteinyl-glycine (glutathione; GSH) and GSH-related enzymes in the regulation of pro- and anti-inflammatory cytokines:: A signaling transcriptional scenario for redox(y) immunologic sensor(s)? Mol. Immunol. 2005, 42, 987–1014. [Google Scholar] [CrossRef] [PubMed]
- Martínez, Y.; Li, X.; Liu, G.; Bin, P.; Yan, W.X.; Más, D.; Valdivié, M.; Hu, C.A.A.; Ren, W.K.; Yin, Y.L. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 2017, 49, 2091–2098. [Google Scholar] [CrossRef]
- Tan, Y.Q.; Wang, Y.N.; Feng, H.Y.; Guo, Z.Y.; Li, X.; Nie, X.L.; Zhao, Y.Y. Host/microbiota interactions-derived tryptophan metabolites modulate oxidative stress and inflammation via aryl hydrocarbon receptor signaling. Free Radic. Biol. Med. 2022, 184, 30–41. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Lou, L. The Central Role of the Citric Acid Cycle in Energy Metabolism: From Metabolic Intermediates to Regulatory Mechanisms. Biol. Evid. 2024, 14, 110–121. [Google Scholar] [CrossRef]
- Badi, S.A.; Khatami, S.; Irani, S.; Siadat, S.D. Induction effects of bacteroides fragilis derived outer membrane vesicles on toll like receptor 2, toll like receptor 4 genes expression and cytokines concentration in human intestinal epithelial cells. Cell J. (Yakhteh) 2019, 21, 57. [Google Scholar] [CrossRef]
- Shen, Y.; Torchia, M.L.G.; Lawson, G.W.; Karp, C.L.; Ashwell, J.D.; Mazmanian, S.K. Outer membrane vesicles of a human commensal mediate immune regulation and disease protection. Cell Host Microbe 2012, 12, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.H.; Moon, C.M.; Shin, T.S.; Kim, E.K.; McDowell, A.; Jo, M.K.; Joo, Y.H.; Kim, S.E.; Jung, H.K.; Shim, K.N.; et al. Lactobacillus paracasei-derived extracellular vesicles attenuate the intestinal inflammatory response by augmenting the endoplasmic reticulum stress pathway. Exp. Mol. Med. 2020, 52, 423–437. [Google Scholar] [CrossRef] [PubMed]
- Izadparast, F.; Riahi-Zajani, B.; Yarmohammadi, F.; Hayes, A.W.; Karimi, G. Protective effect of berberine against LPS-induced injury in the intestine: A review. Cell Cycle 2022, 21, 2365–2378. [Google Scholar] [CrossRef]
- Rawat, V.; Goux, W.; Piechaczyk, M.; D’Mello, S.R. c-Fos Protects Neurons Through a Noncanonical Mechanism Involving HDAC3 Interaction: Identification of a 21-Amino Acid Fragment with Neuroprotective Activity. Mol. Neurobiol. 2016, 53, 1165–1180. [Google Scholar] [CrossRef] [PubMed]
- Chia, Z.-J.; Cao, Y.-n.; Little, P.J.; Kamato, D. Transforming growth factor-β receptors: Versatile mechanisms of ligand activation. Acta Pharmacol. Sin. 2024, 45, 1337–1348. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.P.; Sun, W.; Zhu, P.P.; Ou, G.T.; Zhang, S.; Li, Y.Y.; Hu, J.J.; Qu, X.F.; Zhong, Y.; Yu, W.Y.; et al. Refined polysaccharide from Dendrobium devonianum resists H1N1 influenza viral infection in mice by activating immunity through the TLR4/MyD88/NF-κB pathway. Front. Immunol. 2022, 13, 999945. [Google Scholar] [CrossRef]
- Li, J.K.; Nie, L.; Zhao, Y.P.; Zhang, Y.Q.; Wang, X.Q.; Wang, S.S.; Liu, Y.; Zhao, H.; Cheng, L. IL-17 mediates inflammatory reactions via p38/c-Fos and JNK/c-Jun activation in an AP-1-dependent manner in human nucleus pulposus cells. J. Transl. Med. 2016, 14, 77. [Google Scholar] [CrossRef] [PubMed]
Time/min | Mobile Phase A | Mobile Phase B |
---|---|---|
0 | 92 | 8 |
5 | 88 | 12 |
35 | 70 | 30 |
44 | 60 | 40 |
45 | 5 | 95 |
60 | 5 | 95 |
Primer Name | Primer Sequence |
---|---|
IL-6-F | CACTGGTCTTTTGGAGTTTGAG |
IL-6-R | GGACTTTTGTACTCATCTGCAC |
TNF-α-F | TGGCGTGGAGCTGAGAGATAACC |
TNF-α-R | GACGGCGATGCGGCTGATG |
IL-1β-R | CAGTGGCAATGAGGATGACTTGTTC |
IL-1β-F | CTGTAGTGGTGGTCGGAGATTCG |
β-actin-F | CCTAGAAGCATTTGCGGTGCACGATG |
β-actin-R | TCATGAAGTGTGACGTTGACATCCGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, S.; Xiang, J.; Abedin, M.; Wang, J.; Zhang, Z.; Zhang, Z.; Wu, H.; Xiao, J. Characterization and Anti-Inflammatory Effects of Akkermansia muciniphila-Derived Extracellular Vesicles. Microorganisms 2025, 13, 464. https://doi.org/10.3390/microorganisms13020464
Zhao S, Xiang J, Abedin M, Wang J, Zhang Z, Zhang Z, Wu H, Xiao J. Characterization and Anti-Inflammatory Effects of Akkermansia muciniphila-Derived Extracellular Vesicles. Microorganisms. 2025; 13(2):464. https://doi.org/10.3390/microorganisms13020464
Chicago/Turabian StyleZhao, Sasa, Jie Xiang, Minhazul Abedin, Jingyi Wang, Zhiwen Zhang, Zhongwei Zhang, Hua Wu, and Junsong Xiao. 2025. "Characterization and Anti-Inflammatory Effects of Akkermansia muciniphila-Derived Extracellular Vesicles" Microorganisms 13, no. 2: 464. https://doi.org/10.3390/microorganisms13020464
APA StyleZhao, S., Xiang, J., Abedin, M., Wang, J., Zhang, Z., Zhang, Z., Wu, H., & Xiao, J. (2025). Characterization and Anti-Inflammatory Effects of Akkermansia muciniphila-Derived Extracellular Vesicles. Microorganisms, 13(2), 464. https://doi.org/10.3390/microorganisms13020464