Mitochondria-Mediated Programmed Cell Death in Saccharomyces Cerevisiae Induced by Betulinic Acid is Accelerated by the Deletion of PEP4 Gene
Abstract
:1. Introduction
2. Materials and Methods
2.1. Yeast Strains and Growth Conditions
2.2. Growth and Survival Tests
2.3. 4,6-Diamidino-2-phenylndole (DAPI) Staining and Microscopy
2.4. ROS Detection
2.5. Mitochondrial Transmembrane Potential (ΔΨmt) Assay
2.6. Annexin V/PI Staining
2.7. Terminal Deoxynucleotidyl Transferased UTP Nick-End Labeling (TUNEL)
2.8. Transmission Electron Microscopy
2.9. Real Time Quantitative PCR (qPCR)
3. Results
3.1. Vacuolar Pep4p Provides the Protective Effect on BetA-induced Cell Death of S. Cerevisiae
3.2. Pep4p Reduces the Hallmarks of PCD Process Induced by BetA
3.3. Pep4p Shows Significant Protective Effect on Cell Ultrastructure Upon BetA Treatment
3.4. PCD Induced by BetA was Accompanied by Perturbation of Mitochondria in the Presence of Pep4p
3.5. Significance of BetA on the Expression of Mitochondria Related Genes
4. Discussions
Author Contributions
Funding
Conflicts of Interest
Appendix A
Gene | Forward/Reverse | Sequence (5′–3′) | Product Size (bp) |
---|---|---|---|
Actin | F | ACTTTCAACGTTCCAGCCTTC | 124 |
R | CGTAAATTGGAACGACGACGTGAGTA | ||
Ycal | F | GTACTGGGCGTAGAAAGGCT | 178 |
R | GGAACCCTGACCAAATCGT | ||
AIF1 | F | CTTGGTTCTTGCAACTGGCT | 204 |
R | TTGCCAGACCTGATCTCCTC | ||
Cyc1 | F | GGTTCTGCTAAGAAAGGTGCTA | 134 |
R | CCTTCAGCTTGACCAGAGTG | ||
Cyc7 | F | ACGAGGTGTCAGCAGTGTCA | 145 |
R | CCCATTTGACGTTCTTGTTG | ||
Ndi1 | F | ATCATTATCTGCCGTTAGCCA | 125 |
R | CAAATGTGTTAGGTTCCGCA | ||
Fis1 | F | AGTCCCGTAGACGAGAATGC | 123 |
R | CCACCTGCTTGTTATTACGCT | ||
Dnm1 | F | AAGGAACTCTGTGGTGGTGC | 172 |
R | GGTCAAAAGCCAACTCAGGTA |
References
- Chen, Y.; Sit, S.-Y.; Chen, J.; Swidorski, J.J.; Liu, Z.; Sin, N.; Venables, B.L.; Parker, D.D.; Nowicka-Sans, B.; Lin, Z.; et al. The design, synthesis and structure-activity relationships associated with C28 amine-based betulinic acid derivatives as inhibitors of HIV-1 maturation. Bioorg. Med. Chem. Lett. 2018, 28, 1550–1557. [Google Scholar] [CrossRef] [PubMed]
- Oloyede, H.O.B.; Ajiboye, H.O.; Salawu, M.O.; Ajiboye, T.O. Influence of oxidative stress on the antibacterial activity of betulin, betulinic acid and ursolic acid. Microb. Pathog. 2017, 111, 338–344. [Google Scholar] [CrossRef] [PubMed]
- Karagöz Çapcı, A.; Leidenberger, M.; Hahn, F.; Hampel, F.; Friedrich, O.; Marschall, M.; Kappes, B.; Tsogoeva, S.B. Synthesis of new betulinic acid/betulin-derived dimers and hybrids with potent antimalarial and antiviral activities. Bioorg. Med. Chem. 2019, 27, 110–115. [Google Scholar] [CrossRef] [PubMed]
- Ou, Z.; Zhao, J.; Zhu, L.; Huang, L.; Ma, Y.; Ma, C.; Luo, C.; Zhu, Z.; Yuan, Z.; Wu, J.; et al. Anti-inflammatory effect and potential mechanism of betulinic acid on λ-carrageenan-induced paw edema in mice. Biomed. Pharmacother. 2019, 118, 109347. [Google Scholar] [CrossRef]
- Lasisi, A.; Idowu, O. In vitro anthelmintic and cytotoxic activities of extracts from the stem barks of Berlinia confusa (C. Hoyle) and identification of its active constituents. J. Saudi Chem. Soc. 2014, 18, 939–944. [Google Scholar] [CrossRef] [Green Version]
- Zuco, V.; Supino, R.; Righetti, S.C.; Cleris, L.; Marchesi, E.; Gambacorti-Passerini, C.; Formelli, F. Selective cytotoxicity of betulinic acid on tumor cell lines, but not on normal cells. Cancer Lett. 2002, 175, 17–25. [Google Scholar] [CrossRef]
- Fulda, S.; Friesen, C.; Los, M.; Scaffidi, C.; Mier, W.; Benedict, M.; Nuñez, G.; Krammer, P.H.; Peter, E.M.; Debatin, K.M. Betulinic acid triggers CD95 (APO-1/Fas)- and p53-independent apoptosis via activation of caspases in neuroectodermal tumors. Cancer Res. 1997, 57, 4956–4964. [Google Scholar]
- Zeng, A.; Hua, H.; Liu, L.; Zhao, J. Betulinic acid induces apoptosis and inhibits metastasis of human colorectal cancer cells in vitro and in vivo. Bioorg. Med. Chem. 2019, 27, 2546–2552. [Google Scholar] [CrossRef]
- Fulda, S.; Kroemer, G. Targeting mitochondrial apoptosis by betulinic acid in human cancers. Drug Discov. Today 2009, 14, 885–890. [Google Scholar] [CrossRef]
- Yin, Z.; Qi, H.; Liu, L.; Jin, Z. The optimal regulation mode of Bcl-2 apoptotic switch revealed by bistability analysis. Biosystems 2017, 162, 44–52. [Google Scholar] [CrossRef]
- Mullauer, F.B.; Kessler, J.H.; Medema, J.P. Betulinic acid induces cytochrome c release and apoptosis in a Bax/Bak-independent, permeability transition pore dependent fashion. Apoptosis Int. J. Program. Cell Death 2009, 14, 191–202. [Google Scholar] [CrossRef] [PubMed]
- Goswami, P.; Paul, S.; Banerjee, R.; Kundu, R.; Mukherjee, A. Betulinic acid induces DNA damage and apoptosis in SiHa cells. Mutat. Res. Genet. Toxicol. Environ. Mutagen 2018, 828, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Ludovico, P.; Rodrigues, F.; Almeida, A.; Silva, M.T.; Barrientos, A.; Corte-Real, M. Cytochrome c release and mitochondria involvement in programmed cell death induced by acetic acid in Saccharomyces cerevisiae. Mol. Biol. Cell. 2002, 13, 2598–2606. [Google Scholar] [CrossRef] [PubMed]
- Wissing, S.; Ludovico, P.; Herker, E.; Büttner, S.; Engelhardt, S.M.; Decker, T.; Link, A.; Proksch, A.; Rodrigues, F.; Côrte-Real, M.; et al. An AIF orthologue regulates apoptosis in yeast. J. Cell Biol. 2004, 166, 969–974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Büttner, S.; Eisenberg, T.; Carmona-Gutierrez, D.; Ruli, D.; Knauer, H.; Ruckenstuhl, C.; Sigrist, C.; Wissing, S.; Kollroser, M.; Fröhlich, K.-U.; et al. Endonuclease g regulates budding yeast life and death. Mol. Cell 2007, 25, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Korshunov, S.S.; Skulachev, V.P.; Starkov, A.A. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett. 1997, 416, 15–18. [Google Scholar] [CrossRef] [Green Version]
- Finkel, T. Signal transduction by reactive oxygen species in non-phagocytic cells. J. Leukoc. Biol. 1999, 65, 337–340. [Google Scholar] [CrossRef] [PubMed]
- Finkel, T. Redox-dependent signal transduction. FEBS Lett. 2000, 476, 52–54. [Google Scholar] [CrossRef] [Green Version]
- Parr, C.L.; Keates, R.A.B.; Bryksa, B.C.; Ogawa, M.; Yada, R.Y. The structure and function of Saccharomyces cerevisiae proteinase A. Yeast 2007, 24, 467–480. [Google Scholar] [CrossRef]
- Wolf, D.H. Ubiquitin-proteasome system-From lysosome to proteasome: The power of yeast in the dissection of proteinase function in cellular regulation and waste disposal. Cell. Mol. Life Sci. 2004, 61, 1601–1614. [Google Scholar] [CrossRef]
- Hu, J.J.; Yu, L.X.; Shu, Q.; Chen, Q.H. Identification of Down-Regulated Proteome in Saccharomyces cerevisiae with the Deletion of Yeast Cathepsin D in Response to Nitrogen Stress. Microorganisms 2019, 7, 214. [Google Scholar] [CrossRef] [PubMed]
- Ammerer, G.; Hunter, C.P.; Rothman, J.H.; Saari, G.C.; Valls, L.A.; Stevens, T.H. Pep4 Gene Of Saccharomyces cerevisiae Encodes Proteinase-a, a Vacuolar Enzyme Required for Processing Of Vacuolar Precursors. Mol. Cell. Biol. 1986, 6, 2490–2499. [Google Scholar] [CrossRef] [PubMed]
- Sagulenko, V.; Muth, D.; Sagulenko, E.; Paffhausen, T.; Schwab, M.; Westermann, F. Cathepsin D protects human neuroblastoma cells from doxorubicin-induced cell death. Carcinogenesis 2008, 29, 1869–1877. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johansson, A.C.; Steen, H.; Ollinger, K.; Roberg, K. Cathepsin D mediates cytochrome c release and caspase activation in human fibroblast apoptosis induced by staurosporine. Cell Death Differ. 2003, 10, 1253–1259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carmona-Gutierrez, D.; Bauer, A.M.; Ring, J.; Knauer, H.; Eisenberg, T.; Büttner, S.; Ruckenstuhl, C.; Reisenbichler, A.; Magnes, C.; Rechberger, G.N.; et al. The propeptide of yeast cathepsin D inhibits programmed necrosis. Cell Death Dis. 2011, 2. [Google Scholar] [CrossRef]
- Marques, M.; Mojzita, D.; Amorim, M.A.; Almeida, T.; Hohmann, S.; Moradas-Ferreira, P.; Costa, V. The Pep4p vacuolar proteinase contributes to the turnover of oxidized proteins but PEP4 overexpression is not sufficient to increase chronological lifespan in Saccharomyces cerevisiae. Microbiology 2006, 152, 3595–3605. [Google Scholar] [CrossRef]
- Mason, D.A.; Shulga, N.; Undavai, S.; Ferrando-May, E.; Rexach, M.F.; Goldfarb, D.S. Increased nuclear envelope permeability and Pep4p-dependent degradation of nucleoporins during hydrogen peroxide-induced cell death. FEMS Yeast Res. 2005, 5, 1237–1251. [Google Scholar] [CrossRef] [Green Version]
- Pereira, C.; Chaves, S.; Alves, S.; Salin, B.; Camougrand, N.; Manon, S.; Sousa, M.J.; Côrte-Real, M.; Côrte-Real, M. Mitochondrial degradation in acetic acid-induced yeast apoptosis: The role of Pep4 and the ADP/ATP carrier. Mol. Microbiol. 2010, 76, 1398–1410. [Google Scholar] [CrossRef]
- Pereira, H.; Azevedo, F.; Rego, A.; Sousa, M.J.; Chaves, S.R.; Corte-Real, M. The protective role of yeast Cathepsin D in acetic acid-induced apoptosis depends on ANT (Aac2p) but not on the voltage-dependent channel (Por1p). FEBS Lett. 2013, 587, 200–205. [Google Scholar] [CrossRef]
- Nociari, M.M.; Shalev, A.; Benias, P.; Russo, C. A novel one-step, highly sensitive fluorometric assay to evaluate cell-mediated cytotoxicity. J. Immunol. Methods 1998, 213, 157–167. [Google Scholar] [CrossRef]
- Madeo, F.; Frohlich, E.; Frohlich, K.U. A yeast mutant showing diagnostic markers of early and late apoptosis. J. Cell Biol. 1997, 139, 729–734. [Google Scholar] [CrossRef] [PubMed]
- Markkanen, A.; Penttinen, P.; Naarala, J.; Pelkonen, J.; Sihvonen, A.P.; Juutilainen, J. Apoptosis induced by ultraviolet radiation is enhanced by amplitude modulated radiofrequency radiation in mutant yeast cells. Bioelectromagnetics 2004, 25, 127–133. [Google Scholar] [CrossRef] [PubMed]
- Wright, R. Transmission electron microscopy of yeast. Microsc. Res. Tech. 2000, 51, 496–510. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Clifford, J.; Chiba, H.; Sobieszczuk, D.; Metzger, D.; Chambon, P. RXR alpha-null F9 embryonal carcinoma cells are resistant to the differentiation, anti-proliferative and apoptotic effects of retinoids. EMBO J. 1996, 15, 4142–4155. [Google Scholar] [CrossRef]
- Madeo, F.; Fröhlich, E.; Ligr, M.; Grey, M.; Sigrist, S.J.; Wolf, D.H.; Fröhlich, K.-U. Oxygen stress: A regulator of apoptosis in yeast. J. Cell Biol. 1999, 145, 757–767. [Google Scholar] [CrossRef]
- Perrone, G.G.; Tan, S.X.; Dawes, I.W. Reactive oxygen species and yeast apoptosis. Biochim. Biophys. Acta-Mol. Cell Res. 2008, 1783, 1354–1368. [Google Scholar] [CrossRef] [Green Version]
- Eisenberg, T.; Buttner, S.; Kroemer, G.; Madeo, F. The mitochondrial pathway in yeast apoptosis. Apoptosis Int. J. Program. Cell Death 2007, 12, 1011–1023. [Google Scholar] [CrossRef]
- Fulda, S.; Debatin, K.M. Sensitization for anticancer drug-induced apoptosis by betulinic acid. Neoplasia 2005, 7, 162–170. [Google Scholar] [CrossRef]
- Fulda, S.; Debatin, K.M. Betulinic acid induces apoptosis through a direct effect on mitochondria in neuroectodermal tumors. Med. Pediatric Oncol. 2000, 35, 616–618. [Google Scholar] [CrossRef]
- Jordan, M.A.; Wendell, K.; Gardiner, S.; Derry, W.B.; Copp, H.; Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer Res. 1996, 56, 816–825. [Google Scholar] [PubMed]
- Foland, T.B.; Dentler, W.L.; Suprenant, K.A.; Gupta, M.L.; Himes, R.H. Paclitaxel-induced microtubule stabilization causes mitotic block and apoptotic-like cell death in a paclitaxel-sensitive strain of Saccharomyces cerevisiae. Yeast 2005, 22, 971–978. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Alcazar, J.A.; Ault, J.G.; Khodjakov, A.; Schneider, E. Increased mitochondrial cytochrome c levels and mitochondrial hyperpolarization precede camptothecin-induced apoptosis in Jurkat cells. Cell Death Differ. 2000, 7, 1090–1100. [Google Scholar] [CrossRef] [PubMed]
- Piacentini, M.; Farrace, M.G.; Piredda, L.; Matarrese, P.; Ciccosanti, F.; Falasca, L.; Rodolfo, C.; Giammarioli, A.M.; Verderio, E.; Griffin, M.; et al. Transglutaminase overexpression sensitizes neuronal cell lines to apoptosis by increasing mitochondrial membrane potential and cellular oxidative stress. J. Neurochem. 2002, 81, 1061–1072. [Google Scholar] [CrossRef]
- Nagy, G.; Koncz, A.; Perl, A. T cell activation-induced mitochondrial hyperpolarization is mediated by Ca2+- and redox-dependent production of nitric oxide. J. Immunol. 2003, 171, 5188–5197. [Google Scholar] [CrossRef]
- Pozniakovsky, A.I.; Knorre, D.A.; Markova, O.V.; Hyman, A.A.; Skulachev, V.P.; Severin, F.F. Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast. J. Cell Biol. 2005, 168, 257–269. [Google Scholar] [CrossRef] [Green Version]
- Farrugia, G.; Balzan, R. Oxidative stress and programmed cell death in yeast. Front. Oncol. 2012, 2, 64. [Google Scholar] [CrossRef]
- Chandra, J.; Samali, A.; Orrenius, S. Triggering and modulation of apoptosis by oxidative stress. Free Radic. Biol. Med. 2000, 29, 323–333. [Google Scholar] [CrossRef]
- Avery, S.V. Molecular targets of oxidative stress. Biochem. J. 2011, 434, 201–210. [Google Scholar] [CrossRef] [Green Version]
- Bakker, B.M.; Bro, C.; Kotter, P.; Luttik, M.A.H.; van Dijken, J.P.; Pronk, J.T. The mitochondrial alcohol dehydrogenase adh3p is involved in a redox shuttle in Saccharomyces cerevisiae. J. Bacteriol. 2000, 182, 4730–4737. [Google Scholar] [CrossRef]
- Li, W.; Sun, L.B.; Liang, Q.L.; Wang, J.; Mo, W.K.; Zhou, B. Yeast AMID homologue Ndi1p displays respiration-restricted apoptotic activity and is involved in chronological aging. Mol. Biol. Cell 2006, 17, 1802–1811. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.X.; Zhao, S.K.; Wu, Z.H.; Dai, P.H.; Zhou, B. Mitochondrial release of the NADH dehydrogenase Ndi1 induces apoptosis in yeast. Mol. Biol. Cell 2012, 23, 4373–4382. [Google Scholar] [CrossRef] [PubMed]
- Laz, T.M.; Pietras, D.F.; Sherman, F. Differential Regulation of the Duplicated Isocytochrome-C Genes in Yeast. Proc. Natl. Acad. Sci. USA 1984, 81, 4475–4479. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.N.; Wu, C.L.; Lin, J.K. Propolin C from propolis induces apoptosis through activating caspases, Bid and cytochrome C release in human melanoma cells. Biochem. Pharmacol. 2004, 67, 53–66. [Google Scholar] [CrossRef] [PubMed]
- Pereira, C.; Camougrand, N.; Manon, S.; Sousa, M.J.; Corte-Real, M. ADP/ATP carrier is required for mitochondrial permeabilization and cytochrome c release in yeast apoptosis. Mol. Microbiol. 2007, 66, 571–582. [Google Scholar] [CrossRef]
- Manon, S.; Chaudhuri, B.; Guerin, M. Release of cytochrome c and decrease of cytochrome c oxidase in Bax-expressing yeast cells, and prevention of these effects by coexpression of Bcl-x(L). FEBS Lett. 1997, 415, 29–32. [Google Scholar] [CrossRef]
- Zou, H.; Henzel, W.J.; Liu, X.S.; Lutschg, A.; Wang, X.D. Apaf-1, a human protein homologous to C-elegans CED-4, participates in cytochrome c-dependent activation of caspase-3. Cell 1997, 90, 405–413. [Google Scholar] [CrossRef]
- Guaragnella, N.; Bobba, A.; Passarella, S.; Marra, E.; Giannattasio, S. Yeast acetic acid-induced programmed cell death can occur without cytochrome c release which requires metacaspase YCA1. FEBS Lett. 2010, 584, 224–228. [Google Scholar] [CrossRef]
- Fannjiang, Y.; Cheng, W.-C.; Lee, S.J.; Qi, B.; Pevsner, J.; McCaffery, J.M.; Hill, R.B.; Basáñez, G.; Hardwick, J.M. Mitochondrial fission proteins regulate programmed cell death in yeast. Genes Dev. 2004, 18, 2785–2797. [Google Scholar] [CrossRef] [Green Version]
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, H.; Shu, Q.; Lou, H.; Chen, Q. Mitochondria-Mediated Programmed Cell Death in Saccharomyces Cerevisiae Induced by Betulinic Acid is Accelerated by the Deletion of PEP4 Gene. Microorganisms 2019, 7, 538. https://doi.org/10.3390/microorganisms7110538
Lu H, Shu Q, Lou H, Chen Q. Mitochondria-Mediated Programmed Cell Death in Saccharomyces Cerevisiae Induced by Betulinic Acid is Accelerated by the Deletion of PEP4 Gene. Microorganisms. 2019; 7(11):538. https://doi.org/10.3390/microorganisms7110538
Chicago/Turabian StyleLu, Hongyun, Qin Shu, Hanghang Lou, and Qihe Chen. 2019. "Mitochondria-Mediated Programmed Cell Death in Saccharomyces Cerevisiae Induced by Betulinic Acid is Accelerated by the Deletion of PEP4 Gene" Microorganisms 7, no. 11: 538. https://doi.org/10.3390/microorganisms7110538