The Mobile Colistin Resistance Gene, mcr-1.1, Is Carried on IncX4 Plasmids in Multidrug Resistant E. coli Isolated from Rainbow Trout Aquaculture
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and E. coli Isolation
2.2. E. coli Identity Confirmation and Detection of mcr and Other Relevant Genes Using Polymerase Chain Reaction (PCR)
2.3. Confirmation of mcr-1 Detection Using Commercial Sequencing
2.4. Assessment of Antimicrobial Susceptibility Using the Disk Diffusion Assay
2.5. Determination of the Colistin Minimum Inhibitory Concentration (MIC)
2.6. Assessment of the Transmissibility of mcr-1 Using Plasmid Transformation Assays
2.7. Determining the DNA Fingerprint Profiles of the E. coli Isolates Using BOX-PCR
2.8. Typing of the Plasmids in the mcr-1-Positive E. coli
2.9. Assessment of Persistence of the mcr-1-Positive Isolates in Biofilms
2.10. Whole Genome Sequencing (WGS) Analysis of mcr-1-Positive E. coli
2.11. Data Availability
3. Results and Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Aslam, B.; Wang, W.; Arshad, M.I.; Khurshid, M.; Muzammil, S.; Rasool, M.H.; Nisar, M.A.; Alvi, R.F.; Aslam, M.A.; Qamar, M.U.; et al. Antibiotic resistance: A rundown of a global crisis. Infect. Drug Resist. 2018, 11, 1645–1658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ventola, C.L. The antibiotic resistance crisis: Part 1: Causes and threats. Pharm. Ther. 2015, 40, 277. [Google Scholar]
- Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Wang, R.; Van Dorp, L.; Shaw, L.P.; Bradley, P.; Wang, Q.; Wang, X.; Jin, L.; Zhang, Q.; Liu, Y.; Rieux, A.; et al. The global distribution and spread of the mobilized colistin resistance gene mcr-1. Nat. Commun. 2018, 9, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- WHO. Critically Important Antimicrobials for Human Medicine: Ranking of Antimicrobial Agents for Risk Management of Antimicrobial Resistance Due to Non-Human Use; WHO: Geneva, Switzerland, 2017. [Google Scholar]
- Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eichenberger, E.M.; Thaden, J.T. Epidemiology and mechanisms of resistance of extensively drug resistant Gram-negative bacteria. Antibiotics 2019, 8, 37. [Google Scholar] [CrossRef] [Green Version]
- Van Duin, D.; Paterson, D.L. Multidrug-resistant bacteria in the community. Infect. Dis. Clin. N. Am. 2016, 30, 377–390. [Google Scholar] [CrossRef] [Green Version]
- Olaitan, A.O.; Morand, S.; Rolain, J.-M. Mechanisms of polymyxin resistance: Acquired and intrinsic resistance in bacteria. Front. Microbiol. 2014, 5, 643. [Google Scholar] [CrossRef] [Green Version]
- AbuOun, M.; Stubberfield, E.J.; Duggett, N.A.; Kirchner, M.; Dormer, L.; Nunez-Garcia, J.; Randall, L.P.; Lemma, F.; Crook, D.W.; Teale, C.; et al. mcr-1 and mcr-2 (mcr-6.1) variant genes identified in Moraxella species isolated from pigs in Great Britain from 2014 to 2015. J. Antimicrob. Chemother. 2017, 72, 2745–2749. [Google Scholar] [CrossRef] [Green Version]
- Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J. Antimicrob. Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef] [Green Version]
- Carattoli, A.; Villa, L.; Feudi, C.; Curcio, L.; Orsini, S.; Luppi, A.; Pezzotti, G.; Magistrali, C.F. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Eurosurveillance 2017, 22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible Salmonella enterica serotype Typhimurium isolate. mBio 2019, 10, e00853-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, Z.; Yin, W.; Li, H.; Zhang, Q.; Wang, X.; Wang, Z.; Ke, Y.; Wang, Y.; Shen, J. Chromosome-mediated mcr-3 variants in Aeromonas veronii from chicken meat. Antimicrob. Agents Chemother. 2017, 61, e01272-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Eurosurveillance 2016, 21, 30280. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.-Q.; Li, Y.-X.; Lei, C.-W.; Zhang, A.-Y.; Wang, H.-N. Novel plasmid-mediated colistin resistance gene mcr-7.1 in Klebsiella pneumoniae. J. Antimicrob. Chemother. 2018, 73, 1791–1795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg. Microbes Infect. 2020, 9, 508–516. [Google Scholar] [CrossRef] [Green Version]
- Hassan, J.; El-Gemayel, L.; Bashour, I.; Kassem, I.I. On the edge of a precipice: The global emergence and dissemination of plasmid-borne mcr genes that confer resistance to colistin, a last-resort antibiotic. In Antibiotics and Antimicrobial Resistance Genes in the Environment; Elsevier BV: Amsterdam, The Netherlands, 2020; Volume 1, pp. 155–182. [Google Scholar]
- Kempf, I.; Jouy, E.; Chauvin, C. Colistin use and colistin resistance in bacteria from animals. Int. J. Antimicrob. Agents 2016, 48, 598–606. [Google Scholar] [CrossRef]
- Cabello, F.C.; Tomova, A.; Ivanova, L.; Godfrey, H.P. Aquaculture and mcr colistin resistance determinants. mBio 2017, 8, e01229-17. [Google Scholar] [CrossRef] [Green Version]
- Cabello, F.C.; Godfrey, H.P. Aquaculture, exaptation, and the origin of mcr-positive colistin resistance. Antimicrob. Agents Chemother. 2018, 62, e01903-18. [Google Scholar] [CrossRef] [Green Version]
- Cabello, F.C.; Godfrey, H.P. Comment on: Transferable resistance to colistin: A new but old threat. J. Antimicrob. Chemother. 2016, 72, 636–637. [Google Scholar] [CrossRef] [Green Version]
- Lv, L.; Cao, Y.; Yu, P.; Huang, R.; Wang, J.; Wen, Q.; Zhi, C.; Zhang, Q.; Liu, J.-H. Detection of mcr-1 gene among Escherichia coli isolates from farmed fish and characterization of mcr-1 -bearing IncP plasmids. Antimicrob. Agents Chemother. 2018, 62, e02378-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, Y.; Lv, Z.; Yang, L.; Liu, D.; Ou, Y.; Xu, C.; Liu, W.; Yuan, D.; Hao, Y.; He, J.; et al. Integrated aquaculture contributes to the transfer of mcr-1 between animals and humans via the aquaculture supply chain. Environ. Int. 2019, 130, 104708. [Google Scholar] [CrossRef]
- Hoa, T.; Nakayama, T.; Huyen, H.M.; Harada, K.; Hinenoya, A.; Phuong, N.T.; Yamamoto, Y.; Tran, H.T.T. Extended-spectrum beta-lactamase-producing Escherichia coli harbouring sul and mcr-1 genes isolates from fish gut contents in the Mekong Delta, Vietnam. Lett. Appl. Microbiol. 2019, 71, 75–85. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Kawahara, R.; Harada, K.; Teruya, S.; Nakayama, T.; Motooka, D.; Nakamura, S.; Nguyen, P.D.; Kumeda, Y.; Van Dang, C.; et al. The presence of colistin resistance gene mcr-1 and -3 in ESBL producing Escherichia coli isolated from food in Ho Chi Minh City, Vietnam. FEMS Microbiol. Lett. 2018, 365. [Google Scholar] [CrossRef] [PubMed]
- Lozano-Leon, A.; Garcia-Omil, C.; Dalama, J.; Rodriguez-Souto, R.; Martinez-Urtaza, J.; Gonzalez-Escalona, N. Detection of colistin resistance mcr-1 gene in Salmonella enterica serovar Rissen isolated from mussels, Spain, 2012 to 2016. Eurosurveillance 2019, 24, 1900200. [Google Scholar] [CrossRef] [PubMed]
- Kassem, I.I.; Hijazi, M.A.; Saab, R. On a collision course: The availability and use of colistin-containing drugs in human therapeutics and food-animal farming in Lebanon. J. Glob. Antimicrob. Resist. 2019, 16, 162–164. [Google Scholar] [CrossRef]
- Hmede, Z.; Kassem, I.I. The colistin resistance gene, mcr-1, is prevalent in commensal E. coli isolated from Lebanese pre-harvest poultry. Antimicrob. Agents Chemother. 2018, 62, e01304-18. [Google Scholar] [CrossRef] [Green Version]
- Dandachi, I.; Leangapichart, T.; Daoud, Z.; Rolain, J.-M. First detection of mcr-1 plasmid-mediated colistin-resistant Escherichia coli in Lebanese poultry. J. Glob. Antimicrob. Resist. 2018, 12, 137–138. [Google Scholar] [CrossRef]
- Dandachi, I.; Fayad, E.; Sleiman, A.; Daoud, Z.; Rolain, J.-M. Dissemination of multidrug-resistant and mcr-1 gram-negative bacilli in broilers, farm workers, and the surrounding environment in Lebanon. Microb. Drug Resist. 2020, 26, 368–377. [Google Scholar] [CrossRef]
- Al-Mir, H.; Osman, M.; Azar, N.; Madec, J.-Y.; Hamze, M.; Haenni, M. Emergence of clinical mcr-1-positive Escherichia coli in Lebanon. J. Glob. Antimicrob. Resist. 2019, 19, 83–84. [Google Scholar] [CrossRef]
- Hmede, Z.; Kassem, I.I. First report of the plasmid-borne colistin resistance gene (mcr-1) in Proteus mirabilis isolated from a toddler in non-clinical settings. IDCases 2019, 18, e00651. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, A.A.A.; Kassem, I.I. First report of the plasmid-borne colistin resistance gene (mcr-1) in Proteus mirabilis isolated from domestic and sewer waters in Syrian refugee camps. Travel Med. Infect. Dis. 2020, 33, 101482. [Google Scholar] [CrossRef] [PubMed]
- Sulaiman, A.A.A.; Kassem, I.I. First report on the detection of the plasmid-borne colistin resistance gene mcr-1 in multi-drug resistant E. coli isolated from domestic and sewer waters in Syrian refugee camps in Lebanon. Travel Med. Infect. Dis. 2019, 30, 117–120. [Google Scholar] [CrossRef]
- Hmede, Z.; Sulaiman, A.A.A.; Jaafar, H.; Kassem, I.I. Emergence of plasmid-borne colistin resistance gene mcr-1 in multidrug-resistant Escherichia coli isolated from irrigation water in Lebanon. Int. J. Antimicrob. Agents 2019, 54, 102–104. [Google Scholar] [CrossRef] [PubMed]
- Sourenian, T.; Mann, D.; Li, S.; Deng, X.; Jaafar, H.; Kassem, I.I. Dissemination of multidrug-resistant Escherichia coli harboring the mobile colistin resistance gene mcr-1.1 on transmissible plasmids in the Mediterranean Sea. J. Glob. Antimicrob. Resist. 2020, 22, 84–86. [Google Scholar] [CrossRef]
- Sabat, G.; Rose, P.; Hickey, W.J.; Harkin, J.M. Selective and sensitive method for PCR amplification of Escherichia coli 16S rRNA genes in soil. Appl. Environ. Microbiol. 2000, 66, 844–849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, F.; Shen, C.; Zheng, X.; Liu, Y.; Ahmed, M.A.E.-G.E.-S.; Zhao, Z.; Liao, K.; Shi, Y.; Guo, X.; Zhong, R.; et al. Plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China. Infect. Drug Resist. 2019, 12, 385–389. [Google Scholar] [CrossRef] [Green Version]
- Olesen, I.; Hasman, H.; Aarestrup, F.M. Prevalence of β-lactamases among ampicillin-resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb. Drug Resist. 2004, 10, 334–340. [Google Scholar] [CrossRef]
- Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [Green Version]
- Pitout, J.D.D.; Thomson, K.S.; Hanson, N.D.; Ehrhardt, A.F.; Moland, E.S.; Sanders, C.C. β-Lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa. Antimicrob. Agents Chemother. 1998, 42, 1350–1354. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef] [PubMed]
- Mushi, M.F.; Mshana, S.E.; Imirzalioglu, C.; Bwanga, F. Carbapenemase genes among multidrug resistant Gram negative clinical isolates from a tertiary hospital in Mwanza, Tanzania. BioMed Res. Int. 2014, 2014, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zafer, M.M.; Al-Agamy, M.H.; El-Mahallawy, H.A.; Amin, M.A.; Ashour, M.S.E.-D. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. BioMed Res. Int. 2014, 2014, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goldstein, C.; Lee, M.D.; Sanchez, S.; Hudson, C.; Phillips, B.; Register, B.; Grady, M.; Liebert, C.; Summers, A.O.; White, D.G.; et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother. 2001, 45, 723–726. [Google Scholar] [CrossRef] [Green Version]
- Zhao, S.; Fedorka-Cray, P.J.; Friedman, S.; McDermott, P.F.; Walker, R.; Qaiyumi, S.; Foley, S.; Hubert, S.; Ayers, S.; English, L.; et al. Characterization of Salmonella typhimurium of animal origin obtained from the National Antimicrobial Resistance Monitoring System. Foodborne Pathog. Dis. 2005, 2, 169–181. [Google Scholar] [CrossRef] [Green Version]
- Kiiru, J.; Butaye, P.; Goddeeris, B.M.; Kariuki, S. Analysis for prevalence and physical linkages amongst integrons, ISE cp 1, IS CR 1, Tn 21 and Tn 7 encountered in Escherichia coli strains from hospitalized and non-hospitalized patients in Kenya during a 19-year period (1992–2011). BMC Microbiol. 2013, 13, 109. [Google Scholar] [CrossRef] [Green Version]
- Rahmani, M.; Peighambari, S.M.; Svendsen, C.A.; Cavaco, L.M.; Agersø, Y.; Hendriksen, R.S. Molecular clonality and antimicrobial resistance in Salmonella enterica serovars Enteritidis and Infantis from broilers in three Northern regions of Iran. BMC Vet. Res. 2013, 9, 66. [Google Scholar] [CrossRef] [Green Version]
- Wilkerson, C.; Samadpour, M.; van Kirk, N.; Roberts, M.C. Antibiotic resistance and distribution of tetracycline resistance genes in Escherichia coli O157: H7 isolates from humans and bovines. Antimicrob. Agents Chemother. 2004, 48, 1066–1067. [Google Scholar] [CrossRef] [Green Version]
- Faldynova, M.; Pravcova, M.; Šišák, F.; Havlíčková, H.; Kolackova, I.; Cizek, A.; Karpíšková, R.; Rychlik, I. Evolution of antibiotic resistance in Salmonella enterica Serovar Typhimurium strains isolated in the Czech Republic between 1984 and 2002. Antimicrob. Agents Chemother. 2003, 47, 2002–2005. [Google Scholar] [CrossRef] [Green Version]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; CLSI: Wayne, PA, USA, 2016. [Google Scholar]
- Nguyen, M.C.P.; Woerther, P.-L.; Bouvet, M.; Andremont, A.; Leclercq, R.; Canu, A. Escherichia coli as reservoir for macrolide resistance genes. Emerg. Infect. Dis. 2009, 15, 1648. [Google Scholar] [CrossRef]
- European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. EUCAST, Version 8.1. 2018. Available online: http://www.eucast.org (accessed on 20 September 2020).
- European Committee on Antimicrobial Susceptibility Testing. Recommendations for MIC Determination of Colistin (Polymyxin E) as Recommended by the Joint CLSI-EUCAST Polymyxin Breakpoints Working Group; EUCAST: Växjö, Sweden, 2016; Available online: http://www.eucast.org (accessed on 20 September 2020).
- Carloni, E.; Andreoni, F.; Omiccioli, E.; Villa, L.; Magnani, M.; Carattoli, A. Comparative analysis of the standard PCR-Based Replicon Typing (PBRT) with the commercial PBRT-KIT. Plasmid 2017, 90, 10–14. [Google Scholar] [CrossRef] [PubMed]
- Hyeon, J.-Y.; Li, S.; Mann, D.A.; Zhang, S.; Li, Z.; Chen, Y.; Deng, X. Quasimetagenomics-based and real-time-sequencing-aided detection and subtyping of Salmonella enterica from food samples. Appl. Environ. Microbiol. 2018, 84, 84. [Google Scholar] [CrossRef] [Green Version]
- Ondov, B.D.; Treangen, T.J.; Melsted, P.; Mallonee, A.B.; Bergman, N.H.; Koren, S.; Phillippy, A.M. Mash: Fast genome and metagenome distance estimation using MinHash. Genome Biol. 2016, 17, 132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Green Version]
- Zankari, E.; Hasman, H.; Cosentino, S.; Vestergaard, M.; Rasmussen, S.; Lund, O.; Aarestrup, F.M.; Larsen, M.V. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 2012, 67, 2640–2644. [Google Scholar] [CrossRef]
- Carattoli, A.; Zankari, E.; García-Fernández, A.; Larsen, M.V.; Lund, O.; Villa, L.; Aarestrup, F.M.; Hasman, H. In Silico Detection and typing of plasmids using PlasmidFinder and Plasmid Multilocus sequence typing. Antimicrob. Agents Chemother. 2014, 58, 3895–3903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larsen, M.V.; Cosentino, S.; Rasmussen, S.; Friis, C.; Hasman, H.; Marvig, R.L.; Jelsbak, L.; Sicheritz-Pontén, T.; Ussery, D.W.; Aarestrup, F.M.; et al. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 2012, 50, 1355–1361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gillings, M.R.; Boucher, Y.; Labbate, M.; Holmes, A.; Krishnan, S.; Holley, M.; Stokes, H.W. The evolution of class 1 integrons and the rise of antibiotic resistance. J. Bacteriol. 2008, 190, 5095–5100. [Google Scholar] [CrossRef] [Green Version]
- Zurfluh, K.; Nüesch-Inderbinen, M.; Klumpp, J.; Poirel, L.; Nordmann, P.; Stephan, R. Key features of mcr-1-bearing plasmids from Escherichia coli isolated from humans and food. Antimicrob. Resist. Infect. Control. 2017, 6, 91. [Google Scholar] [CrossRef]
- Fernandes, M.R.; McCulloch, J.A.; Vianello, M.A.; Moura, Q.; Pérez-Chaparro, P.J.; Esposito, F.; Sartori, L.; Dropa, M.; Matté, M.H.; Lira, D.P. First report of the globally disseminated IncX4 plasmid carrying the mcr-1 gene in a colistin-resistant Escherichia coli sequence type 101 isolate from a human infection in Brazil. Antimicrob. Agents Chemother. 2016, 60, 6415–6417. [Google Scholar] [CrossRef] [Green Version]
- Zhuge, X.; Ji, Y.; Tang, F.; Sun, Y.; Jiang, M.; Hu, W.; Wu, Y.; Xue, F.; Ren, J.; Zhu, W.; et al. Population structure and antimicrobial resistance traits of avian-origin mcr-1 -positive Escherichia coli in Eastern China, 2015 to 2017. Transbound. Emerg. Dis. 2019, 66, 1920–1929. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Fang, L.-X.; Wu, Z.; Deng, H.; Yang, R.-S.; Li, X.-P.; Li, S.-M.; Liao, X.-P.; Feng, Y.; Liu, Y.-H. Genetic analysis of the IncX4 plasmids: Implications for a unique pattern in the mcr-1 acquisition. Sci. Rep. 2017, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Hassan, J.; Kassem, I.I. Audacious Hitchhikers: The Role of Travel and the International Food Trade in the Global Dissemination of Mobile Colistin-Resistance (mcr) Genes. Antibiotics 2020, 9, 370. [Google Scholar] [CrossRef] [PubMed]
Targeted Gene/Fragment | Primers | Primer Sequences (5′-3′) | Amplicon Size (bp) | Reference |
---|---|---|---|---|
E. coli specific 16S r-RNA gene | 16S r-RNA-F | AAGAAGCTTGCTTCTTTGCTGAC | 544 | [38] |
16S r-RNA-R | AGCCCGGGGATTTCACATCTGACTTA | |||
mcr-1 | CLR5-F | CGGTCAGTCCGTTTGTTC | 309 | [3] |
CLR5-R | CTTGGTCGGTCTGTA GGG | |||
mcr-2 | mcr-2F | GCGATGGCGGTCTATCCTGTAT | 378 | [39] |
mcr-2R | TGCGATGACATGGGGTGTCAGC | |||
mcr-3 | mcr-3F | TATGGGTTACTATTGCTGG | 814 | |
mcr-3R | CTACCCTGATGCTCATCG | |||
mcr-4 | mcr-4F | GTCATAGTGGTATAAAAGTACAG | 664 | |
mcr-4R | CCACCGTCTATCAGAGCCAAC | |||
mcr-5 | mcr-5F | GCGGTTGTCTGCATTTATCAC | 1042 | |
mcr-5R | CTTTGAAAACCTGTCTTCGGCA | |||
mcr-6 | mcr-6F | GTCCGGTCAATCCCTATCTGT | 556 | |
mcr-6R | ATCACGGGATTGACATAGCTAC | |||
mcr-7 | mcr-7F | TGCTCAAGCCCTTCTTTTCGT | 892 | |
mcr-7R | TTCATCTGCGCCACCTCGT | |||
mcr-8 | mcr-8F | AACCGCCAGAGCACAGAATT | 667 | |
mcr-8R | TTCCCCCAGCGATTCTCCAT | |||
blaTEM-1 | blaTEM-1-F | ACCAATGCTTAATCAGTGAG | 963 | [40] |
blaTEM-1-R | GCGGAACCCCTATTTG | |||
blaCTX-M | blaCTX-M-F | ATGTGCAGYACCAGTAARGTKATGGC | 593 | [41] |
blaCTX-M-R | TGGGTRAARTARGTSACCAGAAYCAGCGG | |||
blaSHV | blaSHV-1-F | CACTCAAGGATGTATTGTG | 822 | [42] |
blaSHV-1-R | TTAGCGTTGCCAGTGCTCG | |||
blaNDM-1 | blaNDM-1-F | GGTTTGGCGATCTGGTTTTC | 621 | [43] |
blaNDM-1-R | CGGAATGGCTCATCACGATC | |||
blaOXA-48 | blaOXA-48-F | GCTTGATCGCCCTCGATT | 238 | [44] |
blaOXA-48-R | GATTTGCTCCGTGGCCGAAA | |||
blaIMP | blaIMP-F | TGAGCAAGTTATCTGTATTC | 740 | [45] |
blaIMP-R | TTAGTTGCTTGGTTTTGATG | |||
blaKPC | blaKPC-F | CATTCAAGGGCTTTCTTGCTGC | 498 | [44] |
blaKPC-R | ACGACGGCATAGTCATTTGC | |||
int1 | int1-F | CCTCCCGCACGATGATC | 270 | [46] |
int1-R | TCCACGCATCGTCAGGC | |||
Class 1 Integron gene | Class 1 Integron gene-F | GGCATCCAAGCACAAGC | Variable | [47] |
Class 1 Integron gene-R | AAGCAGACTTGACTGAT | |||
Class 2 Integron gene | Class 2 Integron gene-F | GGGATCCCGGACGGCATGCACGATTTGTA | Variable | [48] |
Class 2 Integron gene-R | GATGCCATCGCAAGTACGA | |||
tetA | tetA-F | GTAATTCTGAGCACTGTCGC | 950 | [49] |
tetA-R | CTGCCTGGACAACATTGCTT | |||
tetB | tetB-F | CTCAGTATTCCAAGCCTTTG | 430 | |
tetB-F | ACTCCCCTGAGCTTGAGGGG | |||
tetC | tetC-F | GGTTGAAGGCTCTCAAGGGC | 505 | |
tetC-R | CCTCTTGCGGGATATCGTCC | |||
tetD | tetD-F | CATCCATCCGGAAGTGATAGC | 435 | |
tetD-R | CATCCATCCGGAAGTGATAGC | |||
tetE | tetE-F | TGATGATGGCACTGGTCA | 262 | [50] |
tetE-R | GCTGGCTGTTGCCATTA | |||
tetG | tetG-F | GCAGCGAAAGCGTATTTGCG | 680 | [49] |
tetG-R | TCCGAAAGCTGTCCAAGCAT | |||
strA | strA-F | CCT ATC GGT TGA TCA ATG TC | 250 | [51] |
strA-R | GAAGAGTTTTAGGGTCCACC |
Location | Fish Species | E. coli ID Codes | Antibiotic Resistance Profiles of Colistin Resistant E. coli | Colistin MIC (μg/mL) | AMR Genes Detected by WGS and PCR Analysis 1 | Sequence Types |
---|---|---|---|---|---|---|
Beqaa Valley (Hermel) | Rainbow Trout (Oncorhynchus mykiss) | F1I1 | PEN-AMP-AMC-LEX-GEN-KAN-STR-TET-SXT-CHL | 16 | mcr-1.1, aac(3)-IId, aadA2, ant(3″)-Ia, aph(3′)-Ia, blaTEM-1B, dfrA12, erm42, floR, mdf(A), mph(A), sul1, sul2, tetA, | ST48 |
F1I2 | PEN-AMP-AMC-LEX-GEN-KAN-STR-TET-SXT-CHL | 16 | ||||
F2I1 | PEN-AMP-AMC-LEX-KAN-STR-TET-CIP-NOR-SXT-CHL | 32 | mcr-1.1, aph(3″)-Ib, aph(3′)-Ia, aph(6)-Id, blaTEM-1, dfrA14, floR, fosA3, mdf(A), mph(A), qnrS1, strA, sul2, tetA, tetM, | ST101 | ||
F2I2 | PEN-AMP-AMC-LEX-KAN-STR-TET-CIP-NOR-SXT-CHL | 32 | ||||
F2I3 | PEN-AMP-AMC-LEX-KAN-STR-TET-CIP-NOR-SXT-CHL | 32 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hassan, J.; Eddine, R.Z.; Mann, D.; Li, S.; Deng, X.; Saoud, I.P.; Kassem, I.I. The Mobile Colistin Resistance Gene, mcr-1.1, Is Carried on IncX4 Plasmids in Multidrug Resistant E. coli Isolated from Rainbow Trout Aquaculture. Microorganisms 2020, 8, 1636. https://doi.org/10.3390/microorganisms8111636
Hassan J, Eddine RZ, Mann D, Li S, Deng X, Saoud IP, Kassem II. The Mobile Colistin Resistance Gene, mcr-1.1, Is Carried on IncX4 Plasmids in Multidrug Resistant E. coli Isolated from Rainbow Trout Aquaculture. Microorganisms. 2020; 8(11):1636. https://doi.org/10.3390/microorganisms8111636
Chicago/Turabian StyleHassan, Jouman, Razan Zein Eddine, David Mann, Shaoting Li, Xiangyu Deng, Imad P. Saoud, and Issmat I. Kassem. 2020. "The Mobile Colistin Resistance Gene, mcr-1.1, Is Carried on IncX4 Plasmids in Multidrug Resistant E. coli Isolated from Rainbow Trout Aquaculture" Microorganisms 8, no. 11: 1636. https://doi.org/10.3390/microorganisms8111636