Development of Real-Time and Colorimetric Loop Mediated Isothermal Amplification Assay for Detection of Xanthomonas gardneri
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culturing
2.2. DNA Isolation
2.3. Primer Design
2.4. Real-Time LAMP
2.5. Electrophoresis of LAMP
2.6. Colorimetric LAMP
2.7. Sensitivity and Specificity (Real-Time and Colorimetric LAMP)
2.8. LAMP Assay on Plant Tissues
3. Results
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Šutic, D.D. Bakterioze crvenog patlidžana = Bacteriosis of tomatoes; Institut za zaštitu bilja: Belgrade, Serbia, 1957; pp. 1–65. [Google Scholar]
- Dye, D.W. Cultural and biochemical reactions of additional Xanthomonas spp. N. Z. J. Sci. 1966, 9, 913. [Google Scholar]
- De Ley, J.; Segers, P.; Gillis, M. Intra- and Intergeneric Similarities of Chromobacterium and Janthinobacterium Ribosomal Ribonucleic Acid Cistrons. Int. J. Syst. Bacteriol. 1987, 28, 154–168. [Google Scholar] [CrossRef] [Green Version]
- Jones, J.B.; Bouzar, H.; Stall, R.E.; Almira, E.C.; Roberts, P.D.; Bowen, B.W.; Sudberry, J.; Strickler, P.M.; Chun, J. Systematic analysis of xanthomonads (Xanthomonas spp.) associated with pepper and tomato lesions. Int. J. Syst. Evol. Microbiol. 2000, 50, 1211–1219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, J.B.; Lacy, G.H.; Bouzar, H.; Stall, R.E.; Schaad, N.W. Reclassification of the Xanthomonads Associated with Bacterial Spot Disease of Tomato and Pepper. Syst. Appl. Microbiol. 2004, 27, 755–762. [Google Scholar] [CrossRef] [Green Version]
- Hamza, A.A.; Robène-Soustrade, I.; Jouen, E.; Gagnevin, L.; Lefeuvre, P.; Chiroleu, F.; Pruvost, O. Genetic and Pathological Diversity Among Xanthomonas Strains Responsible for Bacterial Spot on Tomato and Pepper in the Southwest Indian Ocean Region. Plant Dis. 2010, 94, 993–999. [Google Scholar] [CrossRef] [Green Version]
- Barak, J.D.; Vancheva, T.; Lefeuvre, P.; Jones, J.B.; Timilsina, S.; Minsavage, G.V.; Koebnik, R. Whole-genome sequences of Xanthomonas euvesicatoria strains clarify taxonomy and reveal a stepwise erosion of type 3 effectors. Front. Plant Sci. 2016, 7, 1805. [Google Scholar] [CrossRef] [Green Version]
- Constantin, E.C.; Cleenwerck, I.; Maes, M.; Baeyen, S.; Van Malderghem, C.; De Vos, P.; Cottyn, B. Genetic characterization of strains named as Xanthomonas axonopodis pv. dieffenbachiae leads to a taxonomic revision of the X. axonopodis species complex. Plant Pathol. 2016, 65, 792–806. [Google Scholar] [CrossRef]
- Parkinson, N.; Aritua, V.; Heeney, J.; Cowie, C.; Bew, J.; Stead, D. Phylogenetic analysis of Xanthomonas species by comparison of partial gyrase B gene sequences. Int. J. Syst. Evol. Microbiol. 2007, 57, 2881–2887. [Google Scholar] [CrossRef]
- Young, J.M.; Park, D.C.; Shearman, H.M.; Fargier, E. A multilocus sequence analysis of the genus Xanthomonas. Syst. Appl. Microbiol. 2008, 31, 366–377. [Google Scholar] [CrossRef]
- Araújo, E.R.; Costa, J.R.; Ferreira, M.A.S.V.; Quezado-Duval, A.M. Widespread distribution of Xanthomonas perforans and limited presence of X. gardneri in Brazil. Plant Pathol. 2017, 66, 159–168. [Google Scholar] [CrossRef]
- Koenraadt, H.; Van Betteray, B.; Germain, R.; Hiddink, G.; Jones, J.B.; Oosterhof, J. Development of specific primers for the molecular detection of bacterial spot of pepper and tomato. Acta Hortic. 2009, 808, 99–102. [Google Scholar] [CrossRef]
- Strayer, A.L.; Jeyaprakash, A.; Minsavage, G.V.; Timilsina, S.; Vallad, G.E.; Jones, J.B.; Paret, M.L. A Multiplex Real-Time PCR Assay Differentiates Four Xanthomonas Species Associated with Bacterial Spot of Tomato. Plant Dis. 2016, 100, 1660–1668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuppels, D.A.; Louws, F.J.; Ainsworth, T. Development and Evaluation of PCR-Based Diagnostic Assays for the Bacterial Speck and Bacterial Spot Pathogens of Tomato. Plant Dis. 2006, 90, 451–458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, X.; Li, J.; Chen, Q. One new method of nucleic acid amplification—Loop-mediated isothermal amplification of DNA. Virol. Sin. 2008, 23, 167–172. [Google Scholar] [CrossRef]
- Parida, M.; Sannarangaiah, S.; Dash, P.K.; Rao, P.V.L.; Morita, K. Loop mediated isothermal amplification (LAMP): A new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev. Med. Virol. 2008, 18, 407–421. [Google Scholar] [CrossRef] [PubMed]
- Zanoli, L.M.; Spoto, G. Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices. Biosensors 2013, 3, 18–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Green Version]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef]
- Aliotta, J.M.; Pelletier, J.J.; Ware, J.L.; Moran, L.S.; Benner, J.S.; Kong, H. Thermostable Bst DNA polymerase I lacks a 3′ → 5′ proofreading exonuclease activity. Genet. Anal. Biomol. Eng. 1996, 12, 185–195. [Google Scholar] [CrossRef]
- Hawwa, R.; Aikens, J.; Turner, R.J.; Santarsiero, B.D.; Mesecar, A.D. Structural basis for thermostability revealed through the identification and characterization of a highly thermostable phosphotriesterase-like lactonase from Geobacillus stearothermophilus. Arch. Biochem. Biophys. 2009, 488, 109–120. [Google Scholar] [CrossRef] [Green Version]
- Schaad, N.W.; Jones, J.B.; Chun, W. Laboratory Guide for the Identification of Plant. Pathogenic Bacteria, 3rd ed.; American Phytopathological Society, APS Press: St. Paul, MN, USA, 2001. [Google Scholar]
- King, E.O.; Ward, M.K.; Raney, D.E. Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 1954, 44, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Roberts, S.J.; Koenraadt, H. 7-019a: Detection of Xanthomonas Campestris pv. Campestris on Brassica spp., 4th ed.; International Rules for Seed Testing, Chapter 7: Validated Seed Health Testing Methods; International Seed Testing Association: Bassersdorf, Switzerland, 2015. [Google Scholar]
- Bühlmann, A.; Pothier, J.F.; Tomlinson, J.A.; Frey, J.E.; Boonham, N.; Smits, T.H.M.; Duffy, B. Genomics-informed design of loop-mediated isothermal amplification for detection of phytopathogenic Xanthomonas arboricola pv. pruni at the intraspecific level. Plant Pathol. 2013, 62, 475–484. [Google Scholar] [CrossRef]
- Hodgetts, J.; Hall, J.; Karamura, G.; Grant, M.; Studholme, D.; Boonham, N.; Karamura, E.; Smith, J.J. Rapid, specific, simple, in-field detection of Xanthomonas campestris pathovar musacearum by loop-mediated isothermal amplification. J. Appl. Microbiol. 2015, 119, 1651–1658. [Google Scholar] [CrossRef] [PubMed]
- Lang, J.M.; Langlois, P.; Nguyen, M.H.R.; Triplett, L.R.; Purdie, L.; Holton, T.A.; Djikeng, A.; Vera Cruz, C.M.; Verdier, V.; Leach, J.E. Sensitive Detection of Xanthomonas oryzae Pathovars oryzae and oryzicola by Loop-Mediated Isothermal Amplification. Appl. Environ. Microbiol. 2014, 80, 4519–4530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langlois, P.A.; Snelling, J.; Hamilton, J.P.; Bragard, J.P.; Koebnik, R.; Verdier, V.; Triplett, L.R.; Blom, J.; Tisserat, N.A.; Leach, J.E. Characterization of the Xanthomonas translucens Complex Using Draft Genomes, Comparative Genomics, Phylogenetic Analysis, and Diagnostic LAMP Assays. Phytopathology 2017, 107, 519–527. [Google Scholar] [CrossRef] [Green Version]
- Rigano, L.A.; Marano, M.R.; Castagnaro, A.P.; Do Amaral, A.M.; Vojnov, A.A. Rapid and sensitive detection of Citrus Bacterial Canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiol. 2010, 10, 176. [Google Scholar] [CrossRef] [Green Version]
- Larrea-Sarmiento, A.; Dhakal, U.; Boluk, G.; Fatdal, L.; Alvarez, A.; Strayer-Scherer, A.; Paret, M.; Jones, J.; Jenkins, D.; Arif, M. Development of a genome-informed loop-mediated isothermal amplification assay for rapid and specific detection of Xanthomonas euvesicatoria. Sci. Rep. 2018, 8, 1–11. [Google Scholar] [CrossRef]
- Araújo, E.R.; Costa, J.R.; Ferreira, M.A.S.V.; Quezado-Duval, A.M. Simultaneous detection and identification of the Xanthomonas species complex associated with tomato bacterial spot using species-specific primers and multiplex PCR. J. Appl. Microbiol. 2012, 113, 1479–1490. [Google Scholar] [CrossRef]
- Obradovic, A.; Mavridis, A.; Rudolph, K.; Janse, J.D.; Arsenijevic, M.; Jones, J.B.; Minsavage, G.V.; Wang, J.F. Characterization and PCR-based typing of Xanthomonas campestris pv. vesicatoria from peppers and tomatoes in Serbia. Eur. J. Plant Pathol. 2004, 110, 285–292. [Google Scholar] [CrossRef]
- Wang, H.; Turechek, W.W. A loop-mediated isothermal amplification assay and sample preparation procedure for sensitive detection of Xanthomonas fragariae in strawberry. PLoS ONE 2016, 11, e0147122. [Google Scholar] [CrossRef]
- Kebede, M.; Timilsina, S.; Ayalew, A.; Admassu, B.; Potnis, N.; Minsavage, G.V.; Jones, J.B. Molecular characterization of Xanthomonas strains responsible for bacterial spot of tomato in Ethiopia. Eur. J. Plant Pathol. 2014, 140, 677–688. [Google Scholar] [CrossRef]
- Leite, R.P.; Minsavage, G.V.; Bonas, U.; Stall, R.E. Detection and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to the hrp genes of Xanthomonas campestris pv. vesicatoria. Appl. Environ. Microbiol. 1994, 60, 1068–1077. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keremane, M.L.; Ramadugu, C.; Rodriguez, E.; Kubota, R.; Shibata, S.; Hall, R.F. A rapid field detection system for citrus huanglongbing associated‘Candidatus Liberibacter asiaticus’ from the psyllid vector, Diaphorina citri Kuwayama and its implications in disease management. Crop. Prot. 2015, 68, 41–48. [Google Scholar] [CrossRef] [Green Version]
- Golmohammadi, M.; Llop, P.; Scuderi, G.; Gell, I.; Graham, J.H.; Cubero, J. mRNA from selected genes is useful for specific detection and quantification of viable Xanthomonas citri subsp. citri. Plant Pathol. 2012, 61, 479–488. [Google Scholar] [CrossRef]
- Simões, T.H.; Gonçalves, E.R.; Rosato, Y.B.; Mehta, A. Differentiation of Xanthomonas species by PCR-RFLP of rpfB and atpD genes. FEMS Microbiol. Lett. 2007, 271, 33–39. [Google Scholar] [CrossRef] [Green Version]
Name 1 | Collection | Number in Collection | Geographic Origin | LAMP Result 5 |
---|---|---|---|---|
Xanthomonas gardneri | ||||
X. gardneri2 | DSMZ | 19127 | Yugoslavia | + |
X. gardneri | CFBP | 8588 | France (Réunion) | + |
X. gardneri | CFBP | 7992 | France (Réunion) | + |
X. gardneri | CFBP | 8120 | Costa Rica | + |
Other (non-gardneri) Xanthomonas | ||||
X. alfalfae subsp. alfalfae | CFBP | 3836 | Sudan | − |
X. arboricola pv. pruni | BCCM/LMG | 854 | New Zealand | − |
X. axonopodis pv. allii | CFBP | 6369 | Not specified (N.S.) 4 | − |
X. axonopodis pv. carotoae | NCPPB | 3440 | Brazil | − |
X. axonopodis pv. vesicatoria | CRI | 1013 | Czech Republic | − |
X. campestris pv. incanae | HRI-W | 6377 | UK | − |
X. campestris pv. phaseoli | NCAIM | B.01695 | Hungary | − |
X. campestris pv. pisi | NCAIM | B.01393 | N.S. 4 | − |
X. campestris pv. raphani | HRI-W | 8305 | UK | − |
X. campestris pv. vesicatoria | BCCM/LMG | 934 | Brazil | − |
X. campestris pv. vesicatoria | BCCM/LMG | 921 | USA (Long Island) | − |
X. euvesicatoria | BCCM/LMG | 918 | India | − |
X. euvesicatoria | BCCM/LMG | 922 | USA (Florida) | − |
X. euvesicatoria | BCCM/LMG | 921 | USA (Long Island) | − |
X. fragariae2 | CFBP | 6766 | USA | − |
X. oryzae pv. Oryzicola 3 | CFBP | 2286 | N.S. 4 | − |
X. perforans 9.22 | CFBP | 7293 | USA (Florida) | − |
X. perforans 9.2 | CFBP | 8122 | Thailand | − |
X. perforans2 | DSMZ | 18975 | USA | − |
X. vesicatoria | BCCM/LMG | 925 | Hungary | − |
X. vesicatoria2 | CFBP | 2537 | New Zealand | − |
X. vesicatoria | BCCM/LMG | 920 | Italy | − |
Other species | ||||
Agrobacterium tumefaciens | CCM | 2835 | Czech Republic | − |
Burkholderia glumae | BCCM/LMG | 20138 | Philippines (province Jalajala Riza) | − |
B. glumae2 | BCCM/LMG | 2196 | Japan (Ehime) | − |
Clavibacter michiganensis subsp. michiganensis | CFBP | 1460 | France | − |
C. michiganensis subsp. sepedonicus | NCPPB | 3467 | Poland | − |
Erwinia amylovora | CRI | Ea10/96 | Czech Republic | − |
Pantoea agglomerans2 | CFBP | 3845 | N.S. 4 | − |
Pseudomonas syringae pv. phaseolicola | CRI | 186/2 | Czech Republic | − |
P. syringae pv. pisi | NCPPB | 3496 | USA | − |
P. syringae pv. syringae | NCPPB | 2306 | Italy | − |
P. syringae pv. tomato | CRI | 8119 | Czech Republic | − |
Ralstonia pseudosolanacearum | CFBP | 3936 | China (Guangdong) | − |
R. solanacearum | NCPPB | 2505 | Sweden | − |
Stenotrophomonas sp. | NCPPB | 2859 | Turkey | − |
Primer Name | Primer Length (nt) | Tm (°C) | Sequence (5′–3′) |
---|---|---|---|
F3 | 16 | 61.60 | CGGGGTGCAGGTCAGC |
B3 | 15 | 61.13 | ACCGGCACCGCCAAG |
FIP | 37 | - | CCACCTCGGCACGTTGCAGGCGAGGTATGCGAGTTGC |
BIP | 35 | - | GCCGCCATCTCGCCTTGCGCCCCGATCCGATCACG |
LB | 17 | 61.26 | CGAGCTGGTGGGCTTGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stehlíková, D.; Beran, P.; Cohen, S.P.; Čurn, V. Development of Real-Time and Colorimetric Loop Mediated Isothermal Amplification Assay for Detection of Xanthomonas gardneri. Microorganisms 2020, 8, 1301. https://doi.org/10.3390/microorganisms8091301
Stehlíková D, Beran P, Cohen SP, Čurn V. Development of Real-Time and Colorimetric Loop Mediated Isothermal Amplification Assay for Detection of Xanthomonas gardneri. Microorganisms. 2020; 8(9):1301. https://doi.org/10.3390/microorganisms8091301
Chicago/Turabian StyleStehlíková, Dagmar, Pavel Beran, Stephen P. Cohen, and Vladislav Čurn. 2020. "Development of Real-Time and Colorimetric Loop Mediated Isothermal Amplification Assay for Detection of Xanthomonas gardneri" Microorganisms 8, no. 9: 1301. https://doi.org/10.3390/microorganisms8091301