Next Article in Journal
Metagenome-Scale Metabolic Network Suggests Folate Produced by Bifidobacterium longum Might Contribute to High-Fiber-Diet-Induced Weight Loss in a Prader–Willi Syndrome Child
Previous Article in Journal
History of COVID-19 Symptoms and Seroprevalence of SARS-CoV-2 Antibodies in HIV-Infected Patients in Northern France after the First Wave of the Pandemic
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Bacteroides-Based Microecologics against Antibiotic-Associated Diarrhea in Mice

1
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China
2
School of Food Science and Technology, Jiangnan University, Wuxi 214122, China
3
National Engineering Research Center for Functional Food, Jiangnan University, Wuxi 214122, China
4
Wuxi Translational Medicine Research Center and Jiangsu Translational Medicine Research Institute Wuxi Branch, Wuxi 214122, China
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(12), 2492; https://doi.org/10.3390/microorganisms9122492
Submission received: 14 November 2021 / Revised: 26 November 2021 / Accepted: 29 November 2021 / Published: 1 December 2021
(This article belongs to the Section Veterinary Microbiology)

Abstract

:
Antibiotic-associated diarrhea (AAD) is a self-limiting disease mediated by antibiotic therapy. In clinical practice, several types of probiotics are used in treating AAD, but minimal research has been done on Bacteroides-based microecologics. Our aim was to evaluate the therapeutic effects of Bacteroidetes uniformis FGDLZ48B1, B. intestinalis FJSWX61K18, Bifidobacterium adolescentis FHNFQ48M5, and B. bifidum FGZ30MM3 and their mixture on AAD in mice. The lincomycin hydrochloride-induced AAD models were gavaged with a single strain or a probiotic mixture for a short period to assess the changes in colonic histopathology and cytokine concentrations, intestinal epithelial permeability and integrity, short-chain fatty acids (SCFAs), and the diversity of intestinal microbiota. Our data indicated that both the sole use of Bacteroides and the combination of Bacteroides and Bifidobacterium beneficially weakened systemic inflammation, increased the recovery rate of tissue structures, increased the concentrations of SCFAs, and restored the gut microbiota. Moreover, the probiotic mixture was more effective than the single strain. Specifically, B. uniformis FGDLZ48B1 combined with the B. adolescentis FHNFQ48M5 group was more effective in alleviating the pathological features of the colon, downregulating the concentrations of interleukin (IL)-6, and upregulating the expression of occludin. In summary, our research suggests that administration of a mixture of B. uniformis FGDLZ48B1 and B. adolescentis FHNFQ48M5 is an effective approach for treating AAD.

1. Introduction

Antibiotic-associated diarrhea (AAD) is a major clinical complication caused by side effects and the overuse of antibiotics [1,2]. AAD is estimated to typically occur in approximately 5–30% of patients during or at the end of antibiotic therapy [3], and often caused significant changes in gut microbiota [4]. Clinical symptoms in patients with AAD vary from mild diarrhea without complications to severe colitis, fulminant pseudomembranous colitis, or even death [5]. A possible mechanism of AAD is the antibiotic acting directly on the intestinal mucosa, thereby leading to the overgrowth of pathogenic bacteria such as Clostridium difficile Staphylococcus, Candida, Enterobacteriaceae, and Klebsiella [6]. Of these, C. difficile is the most common cause of AAD infections [7,8]. The use of antibiotics can cause dysregulation of the metabolic activity of colonic microbiota [9]. Microbial metabolites can modulate the metabolic integrity of epithelial cells and elicit immune reactions [10,11]. In addition, decreased resistance to pathogens caused by AAD is associated with alterations in the metabolism of carbohydrates, SCFAs, and bile acids [12].
Growing evidence indicates that AAD is caused by dysbiosis of the gut microbiota caused by antibiotic treatment [13,14]. Probiotics may maintain or recover intestinal microecology through nutritional competition, receptor competition, favoring the growth of nonpathogenic bacteria, inhibiting mucosal adhesion of pathogens, or simulating immunity during or after antibiotic treatment [15,16]. Current research is mainly focused on the genera Lactobacillus, Bifidobacterium, and Saccharomyces, which are commonly used to prevent or treat AAD [17]. Bifidobacterium preparations are increasingly being used in treating pediatric AAD. Pooled evidence from a systematic review, including five Bifidobacterium preparations from 30 trials, showed that Bifidobacterium preparations might be effective in preventing and treating pediatric AAD [18]. In addition, a study showed that long-term consumption of Clostridium butyricum in combination with a B. infantis mixture facilitated the recovery of gut microbiota and colonic tissue structure, which was a superior response to that observed in single strains in AAD treatments [19]. All of these studies have reinforced the potential role of probiotics in alleviating AAD.
Bacteroides are being actively researched as next-generation probiotics (NGPs) because of their potential benefits to human health. Some of these species can inhibit pathogenic bacteria colonization [20] and alleviate intestinal inflammation [21]. In a recent study, researchers determined that B. fragilis ZY -312 recovered epithelial cell organization and barrier functions through the ERK signaling pathway, thereby improving the abundance of specific commensal microbiota, and subsequently ameliorating diarrheal symptoms associated with AAD [22]. Moreover, the latest study correlated data from 117 individuals in four population-based cohorts and found that 21 bacteria species, including Bacteroides intestinalis, B. uniformis, B. adolescentis, and B. bifidum, showed a strong correlation with ecological recovery following antibiotic treatment [23]. In addition, a series of studies have demonstrated that B. uniformis can reduce the expression of acyl carrier proteins, thereby inhibiting increases in lipopolysaccharide (LPS)-induced proinflammatory cytokine levels, and beneficially reducing inflammation [24,25].
In addition, Kern Rei Chng et al. showed that combining B. thetaiotaomicron and B. adolescentis promoted a synergistic recovery of diversity and mucin enrichment in a mouse model associated with microbiome recovery following antibiotic treatment [23]. They explained that this synergistic effect was a result of the reconstruction of the food web in the intestinal microbial ecosystem, thereby forming a positive feedback pathway, with bacteria capable of colonization, for example, B. thetaiotaomicron provides an energy source for B. adolescentis that cannot colonize, which in turn produces more additional short-chain fatty acids to promote colonization. These findings provide new ideas for developing probiotics that help in the recovery of gut microbiota following antibiotic treatment. Therefore, the purpose of this study was to explore whether B. intestinalis FJSWX61K18, B. uniformis FGDLZ48B1, B. adolescentis FHNFQ48M5, and B. bifidum FGZ30MM3 help alleviate AAD and whether there is a synergistic feedback effect between these species. Specifically, this study assessed whether a combined treatment protects against lincomycin hydrochloride-induced intestinal injury, which is one of the causative mechanisms of AAD metabolic dysfunction.

2. Materials and Methods

2.1. Bacterial Strains and Culture

B. intestinalis FJSWX61K18, B. uniformis FGDLZ48B1, B. adolescentis FHNFQ48M5, and B. bifidum FGZ30MM3 (Table 1) were obtained from the culture collection of the Food Microbiology Department, Jiangnan University (Wuxi, China). Bifidobacterium spp. were cultured in a modified de Man, Rogosa, and Sharpe (mMRS) medium. Bacteroides spp. were cultured in a brain heart infusion (BHI) medium. All the strains were cultured in a Whitley DG250 anaerobic workstation.

2.2. Animal Experimental Design

Male SPF BALB/c adult mice (20–22 g) from a single breeding colony were provided by Zhejiang Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). They were placed in an air-conditioned room (21–25 °C) with a relative humidity of 40–60% and a 12 h light/dark cycle.
After seven days of adaptation, the mice were randomly assigned to nine groups of 10 mice each as follows (Table 2): a normal control group (Con), an antibiotic-associated diarrhea group (Mod), and treatment groups, including B. intestinalis FJSWX61K18 (Bi), B. uniformis FGDLZ48B1 (Bu), B. adolescentis FHNFQ48M5 (Ba), B. bifidum FGZ30MM3 (Bb), B. intestinalis FJSWX61K18 and B. adolescentis FHNFQ48M5 (Bi + Ba), B. uniformis FGDLZ48B1 and B. adolescentis FHNFQ48M5 (Bu + Ba), and B. intestinalis FJSWX61K18 and B. bifidum FGZ30MM3 (Bi + Bb). The mice except the Con group were gavaged with lincomycin hydrochloride (3 g/kg) twice daily at 8:00 a.m. and 20:00 p.m. for 3 days. All mice were assessed daily based on the scoring standard of diarrhea status from a previous study [26]. Feces were collected prior to execution, and fecal water content was measured using the freeze-drying method.
Finally, all the mice were anesthetized with isoflurane. The serum was separated from centrifuged blood samples (3000 rpm, 15 min) and frozen at −80 °C. Feces from the colon and cecum of each mouse were collected and frozen at −80 °C. A portion of each colon was fixed with paraformaldehyde (4%), and the remainder was stored at −80 °C.

2.3. Ethics Statement

All experiments involving animals were conducted in accordance with the ethical policies and procedures approved by the Committee of Ethics of Jiangnan University, China (Approval no. JN. No 20210615b1000718(185)). The use and care of laboratory animals were in accordance with the guidelines established by the European Community (Directive 2010/63/EU). We strove to maximize the health of the mice and reduce their suffering.

2.4. Histological Colon Observations

Colon tissue sectioning and staining methods were performed as described by Sun et al. [27]. The colon samples were fixed with 4% paraformaldehyde, then dehydrated with different levels of ethanol and embedded in paraffin. Next, the paraffin sections (5 μm) were deparaffinized and stained with hematoxylin and eosin. A pathological section scanner was used to capture images.

2.5. Biochemical Analyses of the Colon and Serum

The colon tissue was broken in cold saline and centrifuged (3000× g, 4 °C, 10 min). A BCA protein assay kit (Beyotime Biotechnology Inc., Shanghai, China) was used to determine the protein content of the supernatant. The levels of IL-1β, IL-6, IL-17, and TNF-α were measured using the corresponding ELISA kits (R&D Systems China Co., Ltd., Shanghai, China). Serum LPS levels were determined using ELISA assay kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China).

2.6. Analysis of SCFAs

All caecal contents of each mouse (20–50 mg) were collected and stored at −80 °C. The extraction and determination of butyric acid, acetic acid, propionic acid, and isobutyric acid were conducted using a previously described method [28]. Gas chromatography—mass spectrometry (Shimadzu Corporation, Japan) was used to analyze the concentrations of SCFAs.

2.7. Real-Time PCR Analysis

Total RNA from the colon tissue was extracted, and cDNA was synthesized using a RevertAid First Strand cDNA Synthesis Kit (Vazyme Biotech Co., Ltd.; Nanjing, China). Gene expressions of Mucin-2, occluding, and sodium-hydrogen exchange protein (NHE)3 were detected using real-time quantitative polymerase chain reaction [29]. mRNA expression was determined using a real-time quantitative PCR instrument (CFX Connect; Bio-Rad), as well as a universal iTaq SYBR green Supermix and associated primers (Table 3). The conditions were 40 cycles of 95 °C for the 30 s, 95 °C for 5 s, and 60 °C for 30 s. The β-actin gene was used as a reference gene for the calculation of quantitative expression of the target gene. The expression of genes was calculated using the 2−ΔΔCt method with the control group as the base.

2.8. Preparation of Total DNAs and HIGH throughput Sequencing Analysis

Colon contents were used to extract total genomic DNA using the FastDNA® Spin kit (MP Biomedicals Ltd., Santa Ana, CA, USA). Sequencing of the gut microbiota genomes and data processing were performed as described in recent studies [30,31].

2.9. Statistical Analysis

Data are expressed as the mean ± standard error of the mean (SEM). All results were analyzed using one-way analysis of variance (ANOVA), followed by Dunnett’s multiple comparisons test using GraphPad Prism software version v8.0.2(263).

3. Results

3.1. Effects of Different Treatments on Diarrhea Status Scores and Water Content in Feces

Initially, after the administration of lincomycin hydrochloride, all mice except the control group showed mental depression, a red anus, and diarrhea. Compared with the control group, the diarrhea status scores and stool water content of the model group was significant, which suggested that the AAD mouse model was successfully established. As shown in Figure 1B, a significant decrease in diarrhea status scores was observed in the Bu, Bi + Ba, and Bu + Ba groups. Among them, the Bu + Ba group showed a better result than the Bu group. Furthermore, the Bi + Ba and Bu + Ba groups exhibited significantly reduced stool water content. Although the Bi or Bu groups also showed a significant decrease, the effect was not as great as the mixed bacteria group (Figure 1C).

3.2. Effect of Different Treatments on Histopathological Structure of Colon Tissues

As shown in Figure 2, the colons of mice in the control group exhibited normal histological features. The mucosal epithelium remained intact, and the intestinal glands were abundant and closely arranged. Compared with the control group, the colonic mucosa of AAD mice showed a small inflammatory cell infiltration and mild edema in the submucosa. There was a slight reduction in the number of cupped glandular cells. These pathological characteristics were also observed in most treatment groups. However, no significant histopathological lesions were observed in mice treated with Bu or Bu + Ba, thereby indicating that it may reduce intestinal inflammation.

3.3. Effects of Different Treatments on Proinflammatory Cytokine Expression

To compare the immunomodulatory effects of different strains on AAD mice, cytokines were detected in colonic tissues by ELISA (Figure 3). The levels of IL-6 in the model group were significantly higher than those in the control group. Among the tested strains, the Bu + Ba group showed reduced levels of IL-6. Although the levels of IL-1β, IL-17, and TNF-α in the colonic tissues of mice were not significantly different from those in the control group, they showed a modest increase, whereas the Bu + Ba treatment decreased these proinflammatory inflammatory factors.

3.4. Effects of Different Treatments on Intestinal Barrier Integrity

To analyze the regulation of different treatments on the intestinal barrier, serum LPS levels were determined. As shown in Figure 4, the level of LPS was significantly higher in the model group, whereas the Bi + Ba and Bi + Bb groups showed decreased LPS levels in the serum. Moreover, the Bi + Ba group showed a significant difference compared with the model group. Compared with the control group, the mRNA expression of occludin and Mucin-2 significantly decreased in the model group. However, the Bu + Ba treatment enhanced the expression of occludin in the colon to the level of the control group. In addition, Bi + Ba and Bu + Ba also increased the Mucin-2 expression. In the model group, diarrhea induced a significant decrease in the expression of NHE3 in the colonic tissues of the mice, whereas a supplementation with Bi, Bi + Ba, and Bu + Ba significantly increased this expression up to the level of the control group.

3.5. Effects of Different Treatments on SCFA Production

After treatment with lincomycin hydrochloride, the concentrations of acetic acid, propionic acid, isobutyric acid, and isovaleric acid in the caecal specimens of the model group mice were significantly reduced (Figure 5). Compared with the model group, the Bi and Bu groups had significantly increased acetic acid, propionic acid, and isobutyric acid concentrations. The Bi + Ba treatment significantly increased propionic acid, isobutyric acid, and isovaleric acid, but did not significantly increase the level of acetic acid. Significant increases in acetic acid, propionic acid, isobutyric acid, and isovaleric acid concentrations were also observed in the Bu + Ba group. The Bi + Bb group showed significantly increased levels of propionic acid, isobutyric acid, and isovaleric acid in the caecal specimens. These results also indicated that the gavage of Bacteroides and the mixture of probiotics most strongly benefitted the recovery of SCFA concentrations in AAD mice.

3.6. Effect of Different Treatments on the Composition and Diversity of Gut Microbiota

The evenness and Shannon indexes presented the evenness and diversity of the gut microbiota, respectively. The results showed that the evenness and diversity were significantly reduced following the lincomycin hydrochloride treatment (Figure 6A,B). Compared with the model group, the Bi + Ba, Bu + Ba, and Bi + Bb groups showed increased evenness index, and there was a significant difference in the increase in the Bu + Ba group. The highest Shannon index values were observed in the Bi + Ba and Bu + Ba groups. The Bi and Bi + Bb groups also exhibited a significant increase. The purpose of the β-diversity analysis was to determine the similarities among the groups, and the principal component analysis (PCoA) of community β-diversity and clustering of distance based on the Jaccard index analysis indicated that the clusters of the microbial compositions of the Bi, Bu, Bi + Ba, Bu + Ba, and Bi + Bb groups were closer to the control group than the model group; this indicated that all these treatment groups potently restored the intestinal microbiota disorder (Figure 6C,D). In conclusion, the mixture of Bacteroides and Bifidobacterium most positively impacted the recovery of flora diversity in AAD mice, with the Bu + Ba group facilitating the best recovery rate.

3.7. Spearman’s Correlation Analysis of Physiological and Anti-Inflammatory Effects

In this study, Spearman’s correlation coefficient was used to express the correlation between the two indicators. As shown in Figure 6E, the water content in the stool was negatively correlated with the Shannon index and the concentrations of isobutyric acid, and positively correlated with the levels of IL-6. In addition, the concentration of acetic acid was positively correlated with occludin. The evenness index was negatively correlated with the diarrhea status scores.

4. Discussion

This study aimed to determine whether Bifidobacterium strains, Bacteroides strains, and their mixture help alleviate AAD. We successfully established an AAD mouse model via gavage of lincomycin hydrochloride and explored the AAD-alleviating effects of these strains in animal models. The mice from the model group showed diarrhea-like symptoms and an increase in stool water content, as described in a previous study [26]. Notably, the establishment of this model resulted in mild signs of colonic inflammatory cell infiltration. These results suggested the induction of low-grade colonic inflammation in AAD mice. Our data demonstrated that Bacteroides and the combination of Bacteroides and Bifidobacterium alleviated the symptoms of AAD, and that the probiotic mixture groups facilitated the strongest recovery rate following AAD. The combination amplifies the benefits of probiotics to treat AAD, thereby enhancing our understanding of the potential mechanisms of bacterial interactions over the immune–metabolic axis.
In a previous study, the authors noted that the growth of some species depends on the presence of other species based on bacterial food webs [23]. We combined the selected strains based on the dependence patterns between microorganisms. During the recovery period following antibiotic treatment, some Bacteroides can more effectively colonize the epithelial mucosa owing to their mucin-degrading ability [32,33]. Because they also breakdown dietary carbohydrates of plant and animal origin, they act as keystone species to promote the growth of other species [34]. Other species, such as Bifidobacterium, can use the monosaccharides produced by degradation to grow and produce large amounts of SCFAs, which promote the growth of colon cells and thus increase mucin production [35]. From the perspective of diversity and biomass, this positive feedback loop may lead to a faster ecological recovery. In addition, the combined treatment may modify the metabolic pathways of microorganisms, thereby, altering the nutrients available in the intestinal lumen and improving their accessibility to the host. Our results confirmed that their combination reduced diarrhea status scores and water content in stools. This was accompanied by an improvement in energy metabolic pathways and the restoration of intestinal immune homeostasis [36]. Notably, Bacteroides play a greater role than Bifidobacterium in restoring metabolic alterations.
Changes in cytokines have also been associated with the use of antibiotics, such as tumor necrosis factor and interleukins, both of which act as communicators between immune cells and mirror the inflammatory profile of the host. As noted above, the colonic tissue showed mild edema and inflammatory infiltration in AAD mice. Therefore, we next assessed the levels of inflammatory cytokines in colonic tissue and found increases in the concentrations of inflammatory factors, including IL-6 and IL-17. Excessive amounts of proinflammatory cytokines can cause disturbances in the immune response, which in turn can lead to an inflammatory response [37]. The Bu + Ba group decreased the production of IL-6 to relieve intestinal inflammation. This result was consistent with a previous report [19], in which C. butyricum combined with the B. infantis probiotic mixture inhibited the AAD-induced inflammatory response by balancing the levels of proinflammatory cytokines and anti-inflammatory cytokines.
Compared with normal control animals, AAD mice exhibited defective gastrointestinal integrity and abnormal tight junction protein expression. These findings indicate that the defective intestinal barrier provides pathogens with access to the host, and this is likely the primary cause of diarrhea in AAD mice [22]. Occludin and Mucin-2 are two important intestinal barrier-related genes. Our results indicated that the mixture of probiotics restored their expression, and maintained the integrity and permeability of the intestinal barrier. Studies have shown that epithelial cells are surrounded by mucus and tight junctions of the gastrointestinal tract, known as the first barrier of the intestine [38]. Probiotics have beneficial effects in improving the barrier function of the intestinal mucosa. In addition, a previous study showed that a daily gavage of 109 CFU of B. fragilis ZY-312 was associated with increases in mucin synthesis, ZO-1, and epithelial cell proliferation in the colon [22]. NHE3 is one of five plasma membrane Na+/H+ exchangers and plays an important role in fluid reabsorption and acid-base balance [39]. B. subtilis CU1 may increase the ability of the colon to absorb excessive water in the presence of diarrhea by acting on the expression of NHE3 [40]. In our study, treatment with Bacteroides stains increased the expression of NHE3 and thus promoted fluid absorption. Owing to the critical role of intraluminal solute concentration in the development of diarrhea, using probiotics to facilitate changes in intestinal electrolyte transporters may be an effective mechanism for treating AAD.
In this study, 16S rRNA sequencing was performed to determine the microbial composition of the mouse guts. Increases in the evenness index and Shannon index showed that Bacteroides and a mixture of probiotics enhanced the diversity of the microbial community. β-Diversity and distance clustering indicated that the lincomycin hydrochloride treatment significantly altered the overall structure of the microbial community. The mixture of probiotics and Bacteroides attenuated these changes, which resulted in a structure similar to that of the control group, as well as improved the intestinal lumen environment. The multiple effects of antibiotics on the gut microbiota include a reduction in the diversity and evenness of gastrointestinal microorganisms [41]. These drastic changes lead to the exhaustion of the normal intestinal microbiota residents and the chances for pathogens to colonize. Probiotics can inhibit intestinal pathogens by producing antimicrobial compounds, compete for rejection by consuming limited nutritional resources or adhering to epithelial cells, or stimulate intrinsic microbial activity [42]. Zhang et al. [22] observed overgrowths of Klebsiella and Enterobacter in an AAD rat model and demonstrated that an oral treatment with the B. fragilis strain ZY -312 alleviated antibiotic-associated syndromes by restoring intestinal microbiota diversity.
The majority of intestinal SCFAs originated from the fermentation and catabolism of indigestible carbohydrates by microorganisms in the colon via different pathways. SCFAs have reportedly been associated with the preservation of intestinal homeostasis. Acetic acid has been demonstrated to be critical in inhibiting intestinal pathogens [43], and the production of butyric acid may lead to an increase in mucin production and promote tight junction integrity [44]. The study also detailed a strong correlation between SCFA levels in feces and the abundance of Bacteroides [45]. The genus Bacteroides exhibits a high degree of adaptability to the nutritional requirements of the intestinal environment, and can use dietary or host-derived glycans depending on nutritional utilization [46]. Thus, they facilitate the growth of other species that can produce SCFAs [47]. As shown in Figure 5, our results confirmed this view again, and showed that the mixture of Bacteroides and Bifidobacterium most strongly improved restoration. The inhibitory effect of SCFAs on the production of proinflammatory mediators by neutrophils downregulates the proinflammatory cytokines [48]. SCFAs have reportedly inhibited the production of TNF-α, IL-2, and IL-1β by modulating the NF-κB pathway, thus resisting host inflammation [49]. Therefore, the high concentrations of SCFAs in the Bu + Ba group could be a potential mechanism for protecting against intestinal inflammation in AAD mice. We further analyzed the correlation between the mitigating effects of SCFAs and AAD, and the results validated our conclusions.
Unlike Lactobacillus and Bifidobacterium, whose entire species are Generally Regarded as Safe (GRAS) in the USA or licensed for consumption by the European Food Safety Authority [50], the health-promoting properties of Bacteroides are strongly dependent on the strain. Although several studies have considered Bacteroides as potential candidates for next-generation probiotics, the roles of different Bacteroides species in human health and disease are controversial. Researchers have found that B. fragilis containing virulent fragilysin genes accelerates inflammation [51]. Additionally, B. fragilis YCH46 produces fibrinogen-degrading proteases that may disrupt defense systems and enhance infection through a bacterial invasion of the injured tissue [52]. To date, only B. xylanisolvens DSM 23964 has been authorized by the European Commission to supplement pasteurized milk products according to the Novel Food Regulation No. 258/97 [53]. Therefore, it is necessary to conduct a comprehensive safety evaluation of Bacteroides and justify its use under the precondition of avoiding its pathogenicity. However, we also enabled a rational manipulation of the abundance of Bacteroides via diet. Previous studies have indicated that alginate from Laminaria japonica increases the relative abundance of Bacteroides species. Among them, B. finegoldii responded more positively to the intervention [54]. Another study elucidated the basis for proliferating of Bacteroides in response to fructans, and revealed a fructose-binding hybrid two component signaling sensor that controlled the fructose utilization site in B. thetaiotaomicron [55]. In summary, we suggest that further attention should be paid to screening and safety assessments of Bacteroides and the interactions between Bacteroides and other intestinal microorganisms and dietary factors.

5. Conclusions

Collectively, Bacteroides and the mixture of Bifidobacterium and Bacteroides protected against antibiotic-associated diarrhea in our study. B. uniformis FGDLZ48B1 + B. adolescentis FHNFQ48M5 had the best protective effect against diarrhea in mice with AAD. Specifically, Bu + Ba decreased the levels of inflammatory cytokines and increased the production of SCFAs, and then restored the integrity of the intestinal barrier by promoting the expression of tight junction proteins. Furthermore, Bu + Ba also changed the composition and structure of the intestinal microbiota of mice, thereby promoting the specimens’ recovery from AAD. However, additional studies are needed to evaluate the safety of B. uniformis FGDLZ48B1 in the human environment.

Author Contributions

Writing—original draft, H.G.; writing—reviewing and editing, L.Y.; data curation, formal analysis, methodology, H.G., L.Y. and Q.Z.; supervision, L.Y. and Q.Z.; project administration, F.T.; and funding acquisition, J.Z., H.Z., W.C. and Q.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 31871773 and U1903205); the Natural Science Foundation of Jiangsu Province (BK20200084); and the Collaborative Innovation Center of Food Safety and Quality Control in Jiangsu Province.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Experimental Animal Ethics Committee of Jiangnan University (JN. No 20210615b1000718(185)). 15 June 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data presented in this study are available in the main body of the manuscript.

Acknowledgments

We would like to thank the National Engineering Research Center for Functional Food, Jiangnan University, Wuxi, for technical support.

Conflicts of Interest

All authors declared no conflict of interest.

References

  1. Fernandes, P.; Martens, E. Antibiotics in late clinical development. Biochem. Pharmacol. 2017, 133, 152–163. [Google Scholar] [CrossRef] [Green Version]
  2. Silverman, M.A.; Konnikova, Y.; Gerber, J.S. Impact of antibiotics on necrotizing enterocolitis and antibiotic-associated diarrhea. Gastroenterol. Clin. N. Am. 2017, 46, 61–76. [Google Scholar] [CrossRef] [Green Version]
  3. Naghavi, M. GBD 2013 Mortality and Causes of Death Collaborators. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990–2013: A systematic analysis for the global burden of disease study 2013. Lancet 2015, 385, 117171. [Google Scholar]
  4. Gillespie, D.; Hood, K.; Bayer, A.; Carter, B.; Duncan, D.; Espinasse, A.; Evans, M.; Nuttall, J.; Stanton, H.; Acharjya, A.; et al. Antibiotic prescribing and associated diarrhoea: A prospective cohort study of care home residents. Age Ageing 2015, 44, 853–860. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Ma, H.; Zhang, L.; Zhang, Y.; Liu, Y.; He, Y.; Guo, L. Combined administration of antibiotics increases the incidence of antibiotic-associated diarrhea in critically ill patients. Infect. Drug Resist. 2019, 12, 1047–1054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Hogenauer, C.; Hammer, H.F.; Krejs, G.J.; Reisinger, E.C. Mechanisms and management of antibiotic-associated diarrhea. Clin. Infect. Dis. 1998, 27, 702–710. [Google Scholar] [CrossRef] [Green Version]
  7. Sammons, J.S.; Toltzis, P.; Zaoutis, T.E. Clostridium difficile infection in children. JAMA Pediatrics 2013, 167, 567–573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Szajewska, H.; Mrukowicz, J.Z. Probiotics in prevention of antibiotic-associated diarrhea: Meta-analysis. J. Pediatr. 2003, 142, 85. [Google Scholar]
  9. Lee, W.-J.; Hase, K. Gut microbiota–generated metabolites in animal health and disease. Nat. Chem. Biol. 2014, 10, 416–424. [Google Scholar] [CrossRef]
  10. Arpaia, N.; Rudensky, A.Y. Microbial metabolites control gut inflammatory responses. Proc. Natl. Acad. Sci. USA 2014, 111, 2058–2059. [Google Scholar] [CrossRef] [Green Version]
  11. Lu, Y.-M.; Xie, J.-J.; Peng, C.-G.; Wang, B.-H.; Wang, K.-C.; Li, L.-J. Enhancing clinical efficacy through the gut microbiota: A new field of traditional Chinese medicine. Engineering 2018, 5, 40–49. [Google Scholar] [CrossRef]
  12. Antunes, L.C.M.; Han, J.; Ferreira, R.; Lolić, P.; Borchers, C.H.; Finlay, B.B. Effect of antibiotic treatment on the intestinal metabolome. Antimicrob. Agents Chemother. 2011, 55, 1494–1503. [Google Scholar] [CrossRef] [Green Version]
  13. Hao, Q.; Dong, B.R.; Wu, T. Probiotics for preventing acute upper respiratory tract infections. Cochrane Database Syst. Rev. 2015, 2, 1–58. [Google Scholar] [CrossRef]
  14. Lange, K.W.; Nakamura, Y.; Guo, J.; Chen, N. Diet and medical foods in Parkinson’s disease. Food Sci. Hum. Wellness 2019, 8, 83–95. [Google Scholar] [CrossRef]
  15. Rolfe, R.D. The role of probiotic cultures in the control of gastrointestinal health. J. Nutr. 2000, 130, 396S–402S. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, C.; Gong, W.; Li, Z.; Gao, D.; Gao, Y. Research progress of gut flora in improving human wellness. Food Sci. Hum. Wellness 2019, 8, 102–105. [Google Scholar] [CrossRef]
  17. Hempel, S.; Newberry, S.J.; Maher, A.R.; Wang, Z.; Miles, J.N.V.; Shanman, R.; Johnsen, B.; Shekelle, P.G. Probiotics for the prevention and treatment of antibiotic-associated diarrhea: A systematic review and meta-analysis. JAMA 2012, 307, 1959–1969. [Google Scholar] [PubMed] [Green Version]
  18. Xu, H.-B.; Jiang, R.-H.; Sheng, H.-B. Meta-analysis of the effects of Bifidobacterium preparations for the prevention and treatment of pediatric antibiotic-associated diarrhea in China. Complement. Ther. Med. 2017, 33, 105–113. [Google Scholar] [CrossRef] [PubMed]
  19. Ling, Z.; Liu, X.; Cheng, Y.; Luo, Y.; Yuan, L.; Li, L.; Xiang, C. Clostridium butyricum combined with bifidobacterium infantis probiotic mixture restores fecal microbiota and attenuates systemic inflammation in mice with antibiotic-associated diarrhea. BioMed Res. Int. 2015, 2015, 582048. [Google Scholar] [CrossRef] [Green Version]
  20. Li, Z.; Deng, H.; Zhou, Y.; Tan, Y.; Wang, X.; Han, Y.; Liu, Y.; Wang, Y.; Yang, R.; Bi, Y.; et al. Bioluminescence imaging to track bacteroides fragilis inhibition of vibrio parahaemolyticus infection in mice. Front. Cell. Infect. Microbiol. 2017, 7, 170. [Google Scholar] [CrossRef] [Green Version]
  21. Hudcovic, T.; Kozáková, H.; Kolínská, J.; Štěpánková, R.; Hrncir, T.; Tlaskalová-Hogenová, H. Monocolonization with Bacteroides ovatus protects immunodeficient SCID mice from mortality in chronic intestinal inflammation caused by long-lasting dextran sodium sulfate treatment. Physiol. Res. 2009, 58, 101–110. [Google Scholar] [CrossRef]
  22. Zhang, W.; Zhu, B.; Xu, J.; Liu, Y.; Qiu, E.; Li, Z.; Li, Z.; He, Y.; Zhou, H.; Bai, Y.; et al. Bacteroides fragilis protects against antibiotic-associated diarrhea in rats by modulating intestinal defenses. Front. Immunol. 2018, 9, 1040. [Google Scholar] [CrossRef] [Green Version]
  23. Chng, K.R.; Ghosh, T.; Tan, Y.H.; Nandi, T.; Lee, I.R.; Ng, A.H.Q.; Li, C.; Ravikrishnan, A.; Lim, K.M.; Lye, D.; et al. Metagenome-wide association analysis identifies microbial determinants of post-antibiotic ecological recovery in the gut. Nat. Ecol. Evol. 2020, 4, 1256–1267. [Google Scholar] [CrossRef]
  24. Masoudi, A.; Raetz, C.R.H.; Zhou, P.; Iv, C.W.P.; Pemble, C.W. Chasing acyl carrier protein through a catalytic cycle of lipid A production. Nature 2013, 505, 422–426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Cani, P.D.; Amar, J.; Iglesias, M.A.; Poggi, M.; Knauf, C.; Bastelica, D.; Neyrinck, A.M.; Fava, F.; Tuohy, K.M.; Chabo, C.; et al. Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 2007, 56, 1761–1772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Cui, M.; Zhou, R.; Wang, Y.; Zhang, M.; Liu, K.; Ma, C.-C. Beneficial effects of sulfated polysaccharides from the red seaweed Gelidium pacificum Okamura on mice with antibiotic-associated diarrhea. Food Funct. 2020, 11, 4625–4637. [Google Scholar] [CrossRef] [PubMed]
  27. Sun, X.; Gao, Y.; Wang, X.; Hu, G.; Wang, Y.; Feng, B.; Hu, Y.; Mu, X.; Zhang, Y.; Dong, H. Escherichia coli O101-induced diarrhea develops gut microbial dysbiosis in rats. Exp. Ther. Med. 2018, 17, 824–834. [Google Scholar] [CrossRef] [Green Version]
  28. Wang, L.; Hu, L.; Xu, Q.; Jiang, T.; Fang, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Bifidobacteria exert species-specific effects on constipation in BALB/c mice. Food Funct. 2017, 8, 3587–3600. [Google Scholar] [CrossRef]
  29. Wang, G.; Tang, H.; Zhang, Y.; Xiao, X.; Xia, Y.; Ai, L. The intervention effects of Lactobacillus casei LC2W on Escherichia coli O157:H7 -induced mouse colitis. Food Sci. Hum. Wellness 2020, 9, 289–294. [Google Scholar] [CrossRef]
  30. Yue, Y.; He, Z.; Zhou, Y.; Ross, R.P.; Stanton, C.; Zhao, J.; Zhang, H.; Yang, B.; Chen, W. Lactobacillus plantarum relieves diarrhea caused by enterotoxin-producing Escherichia coli through inflammation modulation and gut microbiota regulation. Food Funct. 2020, 11, 10362–10374. [Google Scholar] [CrossRef]
  31. Lin, J.-N.; Lee, P.-S.; Mei, N.-W.; Cheng, A.-C.; Yu, R.C.; Pan, M.-H. Effects of ginseng dietary supplementation on a high-Fat diet-induced obesity in C57BL/6 Mice. Food Sci. Hum. Wellness 2019, 8, 344–350. [Google Scholar] [CrossRef]
  32. Sicard, J.-F.; Le Bihan, G.; Vogeleer, P.; Jacques, M.; Harel, J. Interactions of intestinal bacteria with components of the intestinal mucus. Front. Cell. Infect. Microbiol. 2017, 7, 387. [Google Scholar] [CrossRef] [PubMed]
  33. Tailford, L.E.; Crost, E.H.; Kavanaugh, D.; Juge, N. Mucin glycan foraging in the human gut microbiome. Front. Genet. 2015, 6, 81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Flint, H.J.; Scott, K.P.; Duncan, S.; Louis, P.; Forano, E. Microbial degradation of complex carbohydrates in the gut. Gut Microbes 2012, 3, 289–306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Willemsen, L.E.M.; Koetsier, M.A.; van Deventer, S.J.H.; van Tol, E.A.F. Short chain fatty acids stimulate epithelial mucin 2 expression through differential effects on prostaglandin E1 and E2 production by intestinal myofibroblasts. Gut 2003, 52, 1442–1447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Lu, M.; Xuan, S.; Wang, Z. Oral microbiota: A new view of body health. Food Sci. Hum. Wellness 2019, 8, 8–15. [Google Scholar] [CrossRef]
  37. Reyes-Díaz, A.; Mata-Haro, V.; Hernández, J.; González-Córdova, A.F.; Hernández-Mendoza, A.; Reyes-Díaz, R.; Torres-Llanez, M.J.; Beltrán-Barrientos, L.M.; Vallejo-Cordoba, B. Milk fermented by specific lactobacillus strains regulates the serum levels of IL-6, TNF-α and IL-10 cytokines in a LPS-stimulated murine model. Nutrients 2018, 10, 691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Pelaseyed, T.; Bergström, J.H.; Gustafsson, J.K.; Ermund, A.; Birchenough, G.M.H.; Schütte, A.; van der Post, S.; Svensson, F.; Rodríguez-Piñeiro, A.M.; Nyström, E.E.L.; et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol. Rev. 2014, 260, 8–20. [Google Scholar] [CrossRef] [Green Version]
  39. Schultheis, P.J.; Clarke, L.L.; Meneton, P.; Miller, M.L.; Soleimani, M.; Gawenis, L.R.; Riddle, T.M.; Duffy, J.J.; Doetschman, T.; Wang, T.; et al. Renal and intestinal absorptive defects in mice lacking the NHE3 Na+/H+ exchanger. Nat. Genet. 1998, 19, 282–285. [Google Scholar] [CrossRef]
  40. Urdaci, M.C.; Lefevre, M.; Lafforgue, G.; Cartier, C.; Rodriguez, B.; Fioramonti, J. Antidiarrheal action of bacillus subtilis CU1 CNCM I-2745 and lactobacillus plantarum CNCM I-4547 in mice. Front. Microbiol. 2018, 9, 1537. [Google Scholar] [CrossRef] [Green Version]
  41. Zhang, L.; Huang, Y.; Zhou, Y.; Buckley, T.; Wang, H.H. Antibiotic administration routes significantly influence the levels of antibiotic resistance in gut microbiota. Antimicrob. Agents Chemother. 2013, 57, 3659–3666. [Google Scholar] [CrossRef] [Green Version]
  42. Mekonnen, S.A.; Merenstein, D.; Fraser, C.M.; Marco, M.L. Molecular mechanisms of probiotic prevention of antibiotic-associated diarrhea. Curr. Opin. Biotechnol. 2020, 61, 226–234. [Google Scholar] [CrossRef]
  43. Fukuda, S.; Toh, H.; Hase, K.; Oshima, K.; Nakanishi, Y.; Yoshimura, K.; Tobe, T.; Clarke, J.M.; Topping, D.L.; Suzuki, T.; et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 2011, 469, 543–547. [Google Scholar] [CrossRef] [PubMed]
  44. Jung, T.-H.; Park, J.H.; Jeon, W.-M.; Han, K.-S. Butyrate modulates bacterial adherence on LS174T human colorectal cells by stimulating mucin secretion and MAPK signaling pathway. Nutr. Res. Pr. 2015, 9, 343–349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Zhao, Y.; Wu, J.; Li, J.; Zhou, N.-Y.; Tang, H.; Wang, Y. Gut microbiota composition modifies fecal metabolic profiles in mice. J. Proteome Res. 2013, 12, 2987–2999. [Google Scholar] [CrossRef] [PubMed]
  46. Sonnenburg, J.L.; Xu, J.; Leip, D.D.; Chen, C.-H.; Westover, B.P.; Weatherford, J.; Buhler, J.D.; Gordon, J.I. Glycan foraging in vivo by an intestine-adapted bacterial symbiont. Science 2005, 307, 1955–1959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Arike, L.; Hansson, G.C. The densely o-glycosylated MUC2 mucin protects the intestine and provides food for the commensal bacteria. J. Mol. Biol. 2016, 428, 3221–3229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Vinolo, M.A.; Rodrigues, H.; Hatanaka, E.; Sato, F.T.; Sampaio, S.C.; Curi, R. Suppressive effect of short-chain fatty acids on production of proinflammatory mediators by neutrophils. J. Nutr. Biochem. 2011, 22, 849–855. [Google Scholar] [CrossRef] [PubMed]
  49. Qi, Y.; Chen, L.; Gao, K.; Shao, Z.; Huo, X.; Hua, M.; Liu, S.; Sun, Y.; Li, S. Effects of Schisandra chinensis polysaccharides on rats with antibiotic-associated diarrhea. Int. J. Biol. Macromol. 2018, 124, 627–634. [Google Scholar] [CrossRef]
  50. O’Toole, P.W.; Marchesi, J.R.; Hill, C. Next-generation probiotics: The spectrum from probiotics to live biotherapeutics. Nat. Microbiol. 2017, 2, 17057. [Google Scholar] [CrossRef]
  51. Yim, S.; Gwon, S.-Y.; Hwang, S.; Kim, N.H.; Jung, B.D.; Rhee, K.-J. Enterotoxigenic bacteroides fragilis causes lethal colitis in Mongolian gerbils. Anaerobe 2013, 21, 64–66. [Google Scholar] [CrossRef]
  52. Chen, Y.; Kinouchi, T.; Kataoka, K.; Akimoto, S.; Ohnishi, Y. Purification and characterization of a fibrinogen-degrading protease in bacteroides fragilis strain YCH46. Microbiol. Immunol. 1995, 39, 967–977. [Google Scholar] [CrossRef]
  53. Brodmann, T.; Endo, A.; Gueimonde, M.; Vinderola, G.; Kneifel, W.; de Vos, W.M.; Salminen, S.; Gómez-Gallego, C. Safety of novel microbes for human consumption: Practical examples of assessment in the European Union. Front. Microbiol. 2017, 8, 1725. [Google Scholar] [CrossRef] [PubMed]
  54. Ai, C.; Jiang, P.; Liu, Y.; Duan, M. The specific use of alginate from Laminaria japonica by Bacteroides species determined its modulation of the Bacteroides community. Food Funct. 2019, 10, 4304–4314. [Google Scholar] [CrossRef] [PubMed]
  55. Sonnenburg, E.D.; Zheng, H.; Joglekar, P.; Higginbottom, S.K.; Firbank, S.J.; Bolam, D.N.; Sonnenburg, J.L. Specificity of polysaccharide use in intestinal bacteroides species determines diet-induced microbiota alterations. Cell 2010, 141, 1241–1252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Figure 1. (A) Schematic diagram of the experimental design: (B) diarrhea status scores; and (C) water content in stool. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Figure 1. (A) Schematic diagram of the experimental design: (B) diarrhea status scores; and (C) water content in stool. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Microorganisms 09 02492 g001
Figure 2. Histological examination of the representative image of H&E staining (scale bar = 100 µm). Yellow arrow—depletion of goblet cells; green arrow—mucosal edema; and black arrow—inflammatory cellular infiltration.
Figure 2. Histological examination of the representative image of H&E staining (scale bar = 100 µm). Yellow arrow—depletion of goblet cells; green arrow—mucosal edema; and black arrow—inflammatory cellular infiltration.
Microorganisms 09 02492 g002
Figure 3. Analysis of cytokines in colon tissue by ELISA: (A) IL-6, (B) IL-17, (C) IL-1β, and (D) TNF-α. * and ** indicate significant differences (p < 0.05, p < 0.01 respectively) between groups.
Figure 3. Analysis of cytokines in colon tissue by ELISA: (A) IL-6, (B) IL-17, (C) IL-1β, and (D) TNF-α. * and ** indicate significant differences (p < 0.05, p < 0.01 respectively) between groups.
Microorganisms 09 02492 g003
Figure 4. ELISA analyses of (A) lipopolysaccharide (LPS). Real-time PCR analysis of (B) occludin, (C) Mucin-2, and (D) NHE3, mRNA expression normalized to β-actin in the colons. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Figure 4. ELISA analyses of (A) lipopolysaccharide (LPS). Real-time PCR analysis of (B) occludin, (C) Mucin-2, and (D) NHE3, mRNA expression normalized to β-actin in the colons. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Microorganisms 09 02492 g004
Figure 5. Effects of different treatments on the concentrations of (A) propionic acid, (B) acetic acid, (C) isovaleric acid, and (D) isobutyric acid. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Figure 5. Effects of different treatments on the concentrations of (A) propionic acid, (B) acetic acid, (C) isovaleric acid, and (D) isobutyric acid. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Microorganisms 09 02492 g005
Figure 6. (A) Evenness index, (B) Shannon index, (C) principal coordinate analysis (PCoA), (D) clustering of distance based on the Jaccard index, and (E) correlation between the physiological and anti-inflammatory effects. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Figure 6. (A) Evenness index, (B) Shannon index, (C) principal coordinate analysis (PCoA), (D) clustering of distance based on the Jaccard index, and (E) correlation between the physiological and anti-inflammatory effects. *, **, ***, and **** indicate significant differences (p < 0.05, p < 0.01, p < 0.001, and p < 0.0001, respectively) between groups.
Microorganisms 09 02492 g006
Table 1. Strains used in the work.
Table 1. Strains used in the work.
StrainOriginRegion
FJSWX61K18Human fecesJiangsu Province, China
FGDLZ48B1Human fecesGuangdong Province, China
FHNFQ48M5Human fecesHenan Province, China
FGZ30MM3Human fecesGuizhou Province, China
Table 2. Animal experimental design.
Table 2. Animal experimental design.
GroupsModeling Period (3 Days)Recovery Period (3 Days)
ConPBSPBS
Modlincomycin hydrochloride (3 g/kg) twice dailyPBS
Bilincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. intestinalis FJSWX61K18
Bulincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. uniformis FGDLZ48B1
Balincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. adolescentis FHNFQ48M5
Bblincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. bifidum FGZ30MM3
Bi + Balincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. intestinalis FJSWX61K18 +
5 × 108 CFUs of B. adolescentis FHNFQ48M5
Bu + Balincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. uniformis FGDLZ48B1 +
5 × 108 CFUs of B. adolescentis FHNFQ48M5
Bi + Bblincomycin hydrochloride (3 g/kg) twice daily5 × 108 CFUs of B. intestinalis FJSWX61K18 +
5 × 108 CFUs of B. bifidum FGZ30MM3
Table 3. Primer sequences used for qPCR analysis.
Table 3. Primer sequences used for qPCR analysis.
GeneForward (5′ to 3′)Reverse (5′ to 3′)
β-actinGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT
Mucin-2CAACAAGCTTCACCACAATCTCCAGACCAAAAGCAGCAAGGTA
OccludinCACACTTGCTTGGGACAGAGTAGCCATAGCCTCCATAGCC
NHE3TGGCCGGGCTTTCGACCACAGGGACCCACGGCGCTCTCCCT
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Guo, H.; Yu, L.; Tian, F.; Zhao, J.; Zhang, H.; Chen, W.; Zhai, Q. Effects of Bacteroides-Based Microecologics against Antibiotic-Associated Diarrhea in Mice. Microorganisms 2021, 9, 2492. https://doi.org/10.3390/microorganisms9122492

AMA Style

Guo H, Yu L, Tian F, Zhao J, Zhang H, Chen W, Zhai Q. Effects of Bacteroides-Based Microecologics against Antibiotic-Associated Diarrhea in Mice. Microorganisms. 2021; 9(12):2492. https://doi.org/10.3390/microorganisms9122492

Chicago/Turabian Style

Guo, Hang, Leilei Yu, Fengwei Tian, Jianxin Zhao, Hao Zhang, Wei Chen, and Qixiao Zhai. 2021. "Effects of Bacteroides-Based Microecologics against Antibiotic-Associated Diarrhea in Mice" Microorganisms 9, no. 12: 2492. https://doi.org/10.3390/microorganisms9122492

APA Style

Guo, H., Yu, L., Tian, F., Zhao, J., Zhang, H., Chen, W., & Zhai, Q. (2021). Effects of Bacteroides-Based Microecologics against Antibiotic-Associated Diarrhea in Mice. Microorganisms, 9(12), 2492. https://doi.org/10.3390/microorganisms9122492

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop