Microbiologic Profiles of Patients with Dental Prosthetic Treatment and Periodontitis before and after Photoactivation Therapy—Randomized Clinical Trial
Abstract
:1. Introduction
2. Materials and Methods
2.1. Trial Design
2.2. Study Group
2.3. Sample Size
2.4. Periodontal Clinical Measurements
2.5. Therapeutic Interventions
2.6. Microbiological Examination
2.6.1. DNA Extraction
2.6.2. Quantification of Periodontopathogens
2.7. Statistical Analysis
3. Results
- -
- The group that underwent SRP therapy plus photoactivation therapy (PDT Group) (n = 50 total patients; number of sites = 318) consisted of 14 patients with stage 1 periodontitis (S1) (number of sites = 79), 16 patients with stage 2 periodontitis (S2) (number of sites = 97), 10 patients with stage 3 periodontitis (S3) (number of sites = 68), and 10 patients with stage 4 periodontitis (S4) (number of sites = 74).
- -
- The group that underwent SRP therapy plus irrigation with chlorhexidine 0.2% (CHX Group) (n = 58 total patients; number of sites = 276) consisted of 18 patients with stage 1 periodontitis (S1) (number of sites = 75), 10 patients with stage 2 periodontitis (S2) (number of sites = 67), 16 patients with stage 3 periodontitis (S3) (number of sites = 71), and 14 patients with stage 4 periodontitis (S4) (number of sites = 63).
- -
- The group with SRP only therapy (Control Group) (n = 52 total patients; number of sites = 256) consisted of 8 patients with periodontitis stage 1 (S1) (number of sites = 51), 14 patients with periodontitis stage 2 (S2) (number of sites = 74), 16 patients with periodontitis stage 3 (S3) (number of sites = 77), and 14 patients with periodontitis stage 4 (S4) (number of sites = 54) (Table 2).
3.1. Periodontal Clinical Parameters
3.2. Subgingival Pathogens
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oruba, Z.; Labuz, P.; Macyk, W.; Chomyszyn-Gajewska, M. Antimicrobial photodynamic therapy-a discovery originating from the pre-antibiotic era in a novel periodontal therapy. Photodiagn. Photodyn. Ther. 2015, 12, 612–618. [Google Scholar] [CrossRef]
- Theodoro, L.H.; Rico Pires, J.; Araujo Fernandes, L.; Gualberto, E.C., Jr.; Longo, M.; Milanezi de Almeida, J.; Gouveia Garcia, V. Effect of antimicrobial photodynamic therapy on periodontally infected tooth sockets in rats. Lasers Med. Sci. 2015, 30, 677–683. [Google Scholar] [CrossRef] [PubMed]
- Kinane, D.F.; Stathopoulou, P.G.; Papapanou, P.N. Periodontal diseases. Nat. Rev. Dis. Primers 2017, 3, 17038. [Google Scholar] [CrossRef]
- Dentino, A.; Lee, S.; Mailhot, J.; Hefti, A.F. Principles of periodontology. Periodontology 2013, 61, 16–53. [Google Scholar] [CrossRef] [Green Version]
- Caton, J.G.; Armitage, G.; Berglundh, T.; Chapple, I.L.C.; Jepsen, S.; Kornman, K.S.; Mealey, B.L.; Papanou, P.N.; Sanz, M.; Tonetti, M.S. A new classification scheme for periodontal and peri-implant diseases and conditions—Introduction and key changes from the 1999 classification. J. Clin. Periodontol. 2018, 45, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, C.; Cabral, C.T. Role of Porphyromonas gingivalis in periodontal disease. Rev. Port. Estomato Cir. Maxilofac. 2007, 48, 167–171. [Google Scholar]
- Watanabe, T.; Fukuda, M.; Mitani, A.; Ting, C.-C.; Osawa, K.; Nagahara, A.; Satoh, S.; Fujimura, T.; Takahashi, S.; Iwamura, Y.; et al. Nd:YAG laser irradiation of the tooth root surface inhibits demineralization and root surface softening caused by minocycline application. Photomed Laser Surg. 2013, 31, 571–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martu, S.; Amălinei, C.; Tatarciuc, M.; Rotaru, M.; Potarnichie, O.; Liliac, L.; Căruntu, I.D. Healing process and laser therapy in the superficial periodontium: A histological study. Rom. J. Morphol. Embryol. 2012, 53, 111–116. [Google Scholar]
- Munin, E.; Giroldo, L.M.; Alves, L.P.; Costa, M.S. Study of germ tube formation by Candida albicans after photodynamic antimicrobial chemotherapy (PACT). J. Photochem. Photobiol. B Biol. 2007, 88, 16–20. [Google Scholar] [CrossRef]
- Castano, A.P.; Demidova, T.N.; Hamblin, M.R. Mechanisms in photodynamic therapy: Part one-photosensitizers, photochemistry and cellular localization. Photodiagnosis Photodyn. Ther. 2004, 1, 279–293. [Google Scholar] [CrossRef] [Green Version]
- Qin, Y.L.; Luan, X.L.; Sheng, Y.Q.; Zhou, C.N.; Zhang, Z.G. Comparison of toluidine blue-mediated photodynamic therapy and conventional scaling treatment for periodontitis in rats. J. Periodontal. Res. 2008, 43, 162–167. [Google Scholar] [CrossRef]
- Smiley, C.J.; Tracy, S.L.; Abt, E.; Michalwicz, B.S.; John, M.T.; Gunsolley, J.; Cobb, C.M.; Rossmann, J.; Harrel, S.K.; Forrest, J.L.; et al. Systematic review and meta-analysis on the nonsurgical treatment of chronic periodontitis by means of scaling and root planing with or without adjuncts. J. Am. Dent. Assoc. 2015, 146, 508–524. [Google Scholar] [CrossRef]
- Betsy, J.; Prasanth, C.S.; Baiju, K.V.; Prasanthila, J.; Subhash, N. Efficacy of antimicrobial photodynamic therapy in the management of chronic periodontitis: A randomized controlled clinical trial. J. Clin. Periodontol. 2014, 41, 573–581. [Google Scholar] [CrossRef]
- Sgolastra, F.; Petrucci, A.; Severino, M.; Graziani, F.; Gatto, R.; Monaco, A. Adjunctive photodynamic therapy to non-surgical treatment of chronic periodontitis: A systematic review and meta-analysis. J. Clin. Periodontol. 2013, 40, 514–526. [Google Scholar] [CrossRef]
- Queiroz, A.C.; Suaid, F.A.; de Andrade, P.F.; Oliveira, F.S.; Novaes, A.B.; Taba, M.; Palioto, D.B.; Grisi, M.F.; Souza, S.L. Adjunctive effect of antimicrobial photodynamic therapy to nonsurgical periodontal treatment in smokers: A randomized clinical trial. Lasers Med. Sci. 2015, 30, 617–625. [Google Scholar] [CrossRef] [PubMed]
- Armitage, G.C. The complete periodontal examination. Periodontology 2004, 34, 22–33. [Google Scholar] [CrossRef]
- Löe, H. The gingival index, the plaque index and the retention index systems. J. Periodontol. 1967, 38, 610–616. [Google Scholar] [CrossRef]
- Rakašević, D.; Lazić, Z.; Rakonjac, B.; Soldatović, I.; Janković, S.; Magić, M.; Aleksić, Z. Efficiency of photodynamic therapy in the treatment of peri-implantitis: A three-month randomized controlled clinical trial. Srpski arhiv za celokupno lekarstvo 2016, 144, 478–484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Sinaidi, A.; Preethanath, R.S. The effect of fixed partial dentures on periodontal status of abutment teeth. Saudi J. Dent. Res. 2014, 5, 104–108. [Google Scholar] [CrossRef] [Green Version]
- Andersen, R.; Loebel, N.; Hammond, D.; Wilson, M. Treatment of periodontal disease by photodisinfection compared to scaling and root planing. J. Clin. Dent. 2007, 18, 34–38. [Google Scholar]
- Braun, A.; Dehn, C.; Krause, F.; Jepsen, S. Short-term clinical effects of adjunctive antimicrobial photodynamic therapy in periodontal treatment: A randomized clinical trial. J. Clin. Periodontol. 2008, 35, 877–884. [Google Scholar] [CrossRef]
- Polansky, R.; Haas, M.; Heschl, A.; Wimmer, G. Clinical effectiveness of photodynamic therapy in the treatment of periodontitis. J. Clin. Periodontol. 2009, 36, 575–580. [Google Scholar] [CrossRef]
- Ge, L.; Shu, R.; Li, Y.; Li, C.; Luo, L.; Song, Z.; Xie, Y.; Liu, D. Adjunctive effect of photodynamic therapy to scaling and root planing in the treatment of chronic periodontitis. Photomed. Laser Surg. 2011, 29, 33–37. [Google Scholar] [CrossRef]
- Petelin, M.; Perkič, K.; Seme, K.; Gašpirc, B. Effect of repeated adjunctive antimicrobial photodynamic therapy on subgingival periodontal pathogens in the treatment of chronic periodontitis. Lasers Med. Sci. 2015, 30, 1647–1656. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.; Lai, C.H. Bactericidal effects of different laser wavelengths on periodontopathic germs in photodynamic therapy. Lasers Med. Sci. 2003, 18, 51–55. [Google Scholar] [CrossRef]
- Soukos, N.S.; Som, S.; Abernethy, A.D.; Ruggiero, K.; Dunham, J.; Lee, C.; Doukas, A.G.; Goodson, J.M. Phototargeting oral blackpigmented bacteria. Antimicrob. Agents Chemother. 2005, 49, 1391–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Komerik, N.; Wilson, M.; Poole, S. The effect of photodynamic action on two virulence factors of gram-negative bacteria. Photochem. Photobiol. 2000, 72, 676–680. [Google Scholar] [CrossRef]
- Yilmaz, S.; Kuru, B.; Noyan, U.; Argun, D.; Kadir, T. Effect of gallium arsenide diode laser on human periodontal disease: A microbiological and clinical study. Lasers Surg. Med. 2002, 30, 60–66. [Google Scholar] [CrossRef]
- Bullock, S.; Manias, E. Fundamentals of Pharmacology, 7th ed.; Pearson: Frenchs Forest, Australia, 2014; p. 964. [Google Scholar]
- Baym, M.; Stone, L.K.; Kishony, R. Multidrug evolutionary strategies to reverse antibiotic resistance. Science 2016, 351, aad3292. [Google Scholar] [CrossRef] [Green Version]
- Goulard, C.; Langrand, S.; Carniel, E.; Chauvaux, S. The Yersinia pestis chromosome encodes active addiction toxins. J. Bacteriol. 2010, 192, 3669–3677. [Google Scholar] [CrossRef] [Green Version]
- Fontana, C.R.; Abernethy, A.D.; Som, S.; Ruggiero, K.; Doucette, S.; Marcantonio, R.C.; Boussios, C.I.; Kent, R.; Goodson, J.M.; Tanner, A.C.R.; et al. The antibacterial effect of photodynamic therapy in dental plaque derived biofilms. J. Periodontal. Res. 2009, 44, 751–759. [Google Scholar] [CrossRef] [PubMed]
- Meimandi, M.; Ardakani, M.R.; Nejad, A.E.; Yousefnejad, P.; Saebi, K.; Tayeed, M.H. The effect of photodynamic therapy in the treatment of chronic periodontitis: A review of literature. Lasers Med. Sci. 2017, 8, S7. [Google Scholar] [CrossRef] [PubMed]
- Butera, A.; Gallo, S.; Maiorani, C.; Molino, D.; Chiesa, A.; Preda, C.; Esposito, F.; Scribante, A. Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters. Microorganisms 2021, 9, 69. [Google Scholar] [CrossRef] [PubMed]
Patogen | Primer 5′→3′ | Probe 5′→3′ | Gene |
---|---|---|---|
A. a | F: GCGAACGTTAGCGTTTTAC R: GGCAAATAAACGTGGGTGAC | ATTGCCCGCACCGAAACCCAAC 5′_Cy5→BHQ2_3′ | waaA |
P. g | F: TGGTTTCATGCAGCTTCTT R: TCGGCACCTTCGTAATTCTT | GTACCTCATATCCCGAGGGGCTG 5′_HEX→BHQ1_3′ | waaA |
T. d | F: CCTTGAACAAAAACCGGAA R: GGGAAAAGCAGGAAGCATAA | GAGCTCTGAATAATTTTGATGCA 5′_Cy5→BHQ2_3′ | waaG |
T. f | F: CTCGCTCGGTGAGTTTGAA R: ATGGCGAAAAGAACGTCAAC | CGATTCGCAAGCGTTATCCCGACT 5′_HEX→BHQ1_3′ | waaA |
Group | Periodontitis Severity | Number of Subjects | Sites n (%) | Age (Years) (Mean ± SD) | Gender (%) | |
---|---|---|---|---|---|---|
Male | Female | |||||
PDT | S1 | 14 | 79 (9.29%) | 47.3 ± 7.4 | 42.8 | 57.2 |
S2 | 16 | 97 (11.41%) | 52.5 ± 10.2 | 50.5 | 49.5 | |
S3 | 10 | 68 (8.00%) | 53.1 ± 10.1 | 60.0 | 40 | |
S4 | 10 | 74 (8.71%) | 47.9 ± 9.6 | 75.0 | 25 | |
CHX | S1 | 18 | 75 (8.82%) | 45.3 ± 7.9 | 66.7 | 33.3 |
S2 | 10 | 67 (7.88%) | 47.5 ± 7.6 | 60.0 | 40 | |
S3 | 16 | 71 (8.35%) | 57.2 ± 11.9 | 62.5 | 37.5 | |
S4 | 14 | 63 (7.41%) | 50.3 ± 12.4 | 71.4 | 28.6 | |
Control | S1 | 8 | 51 (6.00%) | 46.9 ± 8.8 | 50.0 | 50.0 |
S2 | 14 | 74 (8.71%) | 52.1 ± 10.8 | 42.8 | 57.2 | |
S3 | 16 | 77 (9.07%) | 50.8 ± 11.4 | 50.0 | 50 | |
S4 | 14 | 54 (6.35%) | 49.2 ± 8.6 | 57.1 | 42.9 |
Parameter | PDT | CHX | Control | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
S1 | S2 | S3 | S4 | S1 | S2 | S3 | S4 | S1 | S2 | S3 | S4 | |
Baseline evaluation | ||||||||||||
PI (+)(%) | 98.7 | 97.9 | 95.6 | 92.6 | 98.7 | 94.0 | 95.8 | 90.5 | 96.0 | 97.3 | 92.2 | 92.6 |
BOP (+)(%) | 87.3 | 85.6 | 89.7 | 93.2 | 89.3 | 88.1 | 87.3 | 85.7 | 86.3 | 91.9 | 91.0 | 87.0 |
PD (Mean ±DS) | 3.24± 0.42 | 4.40± 0.21 | 5.21± 1.93 | 7.20 ± 1.18 | 3.21± 0.74 | 4.20± 0.95 | 5.18± 1.27 | 7.50± 1.72 | 3.01± 0.79 | 4.10 ± 1.13 | 5.15 ± 1.87 | 6.90 ± 1.41 |
CAL (Mean± DS) | 1.40 ± 0.32 | 3.50 ± 0.44 | 4.22 ± 0.42 | 5.68 ± 1.16 | 1.61 ± 0.28 | 3.23 ± 0.33 | 4.48 ± 0.99 | 5.90 ± 1.24 | 1.42 ± 0.78 | 3.19 ± 0.32 | 4.21 ± 1.31 | 5.41 ± 1.75 |
One month evaluation | ||||||||||||
PI (+)(%) | 5.1 * | 6.2 * | 3.0 * | 8.1 * | 1.3 * | 7.5 * | 11.2 * | 12.7 * | 4.0 * | 8.1 * | 7.8 * | 7.4 * |
BOP (+)(%) | 2.5 * | 2.1 * | 1.5 * | 4.1 * | 4.0 * | 3.0 * | 5.7 * | 9.5 * | 13.7 * | 12.2 * | 31.6 | 42.2 |
PD (Mean± SD) | 1.98 ± 0.31 * | 2.21 ± 0.22 * | 3.87 ± 0.41 * | 5.42 ± 0.84 * | 1.87 ± 0.63 * | 3.12 ± 0.32 * | 4.99 ± 0.55 | 6.62 ± 0.41 | 1.95 ± 0.1 * | 3.72 ± 0.88 | 5.01 ± 1.16 | 6.39 ± 1.23 |
CAL (Mean± SD) | 1.12 ± 0.42 * | 1.81 ± 0.21 * | 2.03 ± 0.35 * | 4.32 ± 1.63 * | 1.13 ± 0.17 * | 2.67 ± 0.43 * | 4.21 ± 1.17 | 5.22 ± 1.73 | 0.82 ± 0.24 * | 2.93 ± 0.52 | 4.19 ± 1.16 | 5.40 ± 1.97 |
Six months evaluation | ||||||||||||
PI (+)(%) | 4.2 * | 4.7 * | 2.6 * | 7.2 * | 3.6 * | 9.6 * | 12.5 * | 14.2 * | 15.3 * | 14.9 * | 16.5 * | 17.2 * |
BOP (+)(%) | 1.3 * | 1.7 * | 1.2 * | 2.5 * | 23.7 * | 26.9 * | 43.6 | 61.7 | 39.42 | 38.3 | 42.8 | 57.1 |
PD (Mean± SD) | 1.61 ± 0.37 * | 1.82 ± 1.41 * | 3.34 ± 1.66 * | 5.23 ± 1.92 * | 2.02 ± 1.14 * | 3.51 ± 1.42 * | 5.29 ± 1.90 | 6.97 ± 2.46 | 3.05 ± 1.53 | 4.61 ± 2.07 | 5.56 ± 2.44 | 7.19 ± 2.88 |
CAL (Mean± SD) | 0.95 ± 0.14 * | 1.34 ± 0.27 * | 1.88 ± 0.41 * | 4.75 ± 2.63 * | 1.27 ± 0.43 * | 2.93 ± 0.63 * | 4.65 ± 1.04 | 5.98 ± 1.48 | 1.24 ± 0.41 | 3.46 ± 0.73 | 4.91 ± 1.77 | 6.22 ± 2.24 |
Stage | Baseline | At One Month | At 6 Months | ||
---|---|---|---|---|---|
S1 | 5.4 × 106 (2.6 × 104–8.3 × 108) | 1.6 × 103 (9.5 × 102–8.9 × 104) * | 5.2 × 103 (1.2 × 102–7.5 × 105) * | ||
S2 | 1.6 × 107 (3.8 × 106–5.2 × 109) | 9.6 × 103 (6.2 × 102–9.2 × 104) * | 1.7 × 104 (9.1 × 102–9.6 × 105) * | ||
S3 | 3.2 × 108 (6.8 × 106–9.8 × 109) | 6.9 × 104 (1.4 × 103–8.1 × 107) * | 1.4 × 105 (2.7 × 103–8.3 × 107) * | ||
S4 | 8.3 × 108 (5.2 × 106–9.3 × 109) | 8.5 × 104 (2.5 × 103–1.2 × 107) * | 1.8 × 105 (5.5 × 103–5.3 × 107) * |
Stage | Baseline | At One Month | At 6 Months |
---|---|---|---|
S1 | 5.6 × 106 (6.2 × 104–7.5 × 108) | 8.4 × 104 (5.5 × 102–2.1 × 106) * | 3.7 × 105 (9.1 × 102–9.2 × 106) *° |
S2 | 1.9 × 107 (4.6 × 106–9.2 × 109) | 0.5 × 104 (7.8 × 102–6.3 × 106) * | 6.2 × 105 (9.3 × 102–8.7 × 106) *° |
S3 | 3.6 × 108 (6.5 × 106–9.1 × 109) | 9.1 × 107 (2.9 × 103–0.1 × 109) ° | 1.8 × 108 (7.4 × 105–7.5 × 109) ° |
S4 | 7.9 × 108 (2.9 × 106–8.3 × 109) | 0.3 × 108 (1.8 × 105–2.3 × 109) ° | 6.2 × 108 (5.9 × 105–8.4 × 109) ° |
Stage | Baseline | At One Month | At 6 Months |
---|---|---|---|
S1 | 4.9 × 106 (1.6 × 104–2.3 × 108) | 0.3 × 106 (1.5 × 104–1.2 × 108) ° | 5.1 × 106 (5.5 × 104–4.7 × 108) ° |
S2 | 1.7 × 107 (7.1 × 106–8.1 × 108) | 0.2 × 107 (1.5 × 106–6.4 × 108) ° | 2.3 × 107 (5.9 × 106–7.8 × 108) ° |
S3 | 3.1 × 108 (6.3 × 106–8.8 × 109) | 2.1 × 108 (5.2 × 106–7.3 × 109) ° | 2.7 × 109 (7.9 × 107–9.1 × 109) †° |
S4 | 7.8 × 108 (6.5 × 106–8.1 × 109) | 6.6 × 108 (4.2 × 106–5.3 × 109) ° | 8.7 × 109 (8.8 × 108–9.8 × 109) †° |
Pathogen | Stage | Baseline | At One Month | At 6 Months |
---|---|---|---|---|
Aggregatibacter actinomycetemcomitans | S1 | 0.0 | 0.0 | 0.0 |
S2 | 2.1 | 0.0 a | 0.0 a | |
S3 | 30.9 | 1.4 b | 2.9 b | |
S4 | 33.8 | 2.7 b | 5.4 b | |
Porphyromonas gingivalis | S1 | 6.3 | 0.0 b | 1.3 b |
S2 | 14.4 | 0.0 b | 2.1 b | |
S3 | 63.2 | 4.4 b | 10.3 b | |
S4 | 83.8 | 6.7 b | 10.9 b | |
Tannerella forsythia | S1 | 30.4 | 0.0 b | 2.5 b |
S2 | 32.9 | 4.1 b | 6.2 b | |
S3 | 67.6 | 8.8 b | 10.3 b | |
S4 | 93.2 | 8.1 b | 12.2 b | |
Treponema denticola | S1 | 22.8 | 2.5 b | 3.8 b |
S2 | 29.9 | 2.1 b | 5.1 b | |
S3 | 57.4 | 5.8 b | 7.3 b | |
S4 | 66.2 | 8.1 b | 10.8 b |
Pathogen | Stage | Baseline | At One Month | At 6 Months |
---|---|---|---|---|
Aggregatibacter actinomycetemcomitans | S1 | 0.0 | 0.0 | 0.0 |
S2 | 2.9 | 1.2 | 1.5 | |
S3 | 26.8 | 14.1 a | 23.9 | |
S4 | 30.1 | 19.1 | 22.2 | |
Porphyromonas gingivalis | S1 | 9.3 | 4.0 c | 8.0 |
S2 | 16.4 | 5.9 c | 13.4 | |
S3 | 63.4 | 30.9 c | 47.9 | |
S4 | 85.7 | 30.2 c | 71.8 | |
Tannerella forsythia | S1 | 34.7 | 4.0 c | 14.7 b |
S2 | 37.3 | 4.5 c | 32.8 | |
S3 | 57.7 | 32.4 | 47.9 | |
S4 | 85.7 | 69.8 | 73.0 | |
Treponema denticola | S1 | 22.7 | 1.3 c | 21.6 |
S2 | 32.8 | 4.5 c | 29.8 | |
S3 | 54.9 | 36.7 | 43.7 | |
S4 | 73.0 | 55.5 | 72.2 |
Pathogen | Stage | Baseline | At One Month | At 6 Months |
---|---|---|---|---|
Aggregatibacter actinomycetemcomitans | S1 | 0.0 | 0.0 | 0.0 |
S2 | 4.1 | 2.7 | 2.7 | |
S3 | 28.6 | 22.1 | 24.7 | |
S4 | 35.2 | 29.6 | 31.5 | |
Porphyromonas gingivalis | S1 | 9.8 | 3.9 b | 7.8 |
S2 | 17.6 | 8.1 b | 13.5 | |
S3 | 62.3 | 45.5 | 51.9 | |
S4 | 81.4 | 66.7 | 74.1 | |
Tannerella forsythia | S1 | 33.3 | 13.7 a | 27.4 |
S2 | 39.2 | 27.0 | 29.7 | |
S3 | 76.6 | 57.1 | 67.3 | |
S4 | 90.7 | 77.8 | 85.9 | |
Treponema denticola | S1 | 19.6 | 5.9 b | 17.7 |
S2 | 28.4 | 14.9 a | 25.7 | |
S3 | 58.4 | 41.6 | 44.1 | |
S4 | 74.1 | 57.4 | 66.7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mocanu, R.C.; Martu, M.-A.; Luchian, I.; Sufaru, I.G.; Maftei, G.A.; Ioanid, N.; Martu, S.; Tatarciuc, M. Microbiologic Profiles of Patients with Dental Prosthetic Treatment and Periodontitis before and after Photoactivation Therapy—Randomized Clinical Trial. Microorganisms 2021, 9, 713. https://doi.org/10.3390/microorganisms9040713
Mocanu RC, Martu M-A, Luchian I, Sufaru IG, Maftei GA, Ioanid N, Martu S, Tatarciuc M. Microbiologic Profiles of Patients with Dental Prosthetic Treatment and Periodontitis before and after Photoactivation Therapy—Randomized Clinical Trial. Microorganisms. 2021; 9(4):713. https://doi.org/10.3390/microorganisms9040713
Chicago/Turabian StyleMocanu, Raluca Cristina, Maria-Alexandra Martu, Ionut Luchian, Irina Georgeta Sufaru, George Alexandru Maftei, Nicoleta Ioanid, Silvia Martu, and Monica Tatarciuc. 2021. "Microbiologic Profiles of Patients with Dental Prosthetic Treatment and Periodontitis before and after Photoactivation Therapy—Randomized Clinical Trial" Microorganisms 9, no. 4: 713. https://doi.org/10.3390/microorganisms9040713