Deletion of the PA4427-PA4431 Operon of Pseudomonas aeruginosa PAO1 Increased Antibiotics Resistance and Reduced Virulence and Pathogenicity by Affecting Quorum Sensing and Iron Uptake
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
2.2. RT-PCR
2.3. Construction of Mutants
2.4. Complementation of the In-Frame Deletion Mutants
2.5. The Disk Diffusion and Antibiotics Susceptibility Tests
2.6. Biofilm Assay
2.7. ATP Measurement
2.8. Assays of Pyocyanin, Rhamnolipid, Extracellular Polysaccharide, Elastase, and Motility
2.9. In Vivo Virulence Assays
2.10. RNA-Seq and Differentially Expressed Genes (DEGs) Analysis
2.11. The Expression Level Measurement of the Genes Related to Quorum Sensing and Iron Absorption
2.12. Measurement of Intracellular Iron Concentration
2.13. Statistical Analysis
3. Results
3.1. Deletion of PA4429–31 Increased Aminoglycoside Antibiotics Resistance
3.2. The Function Analysis of PA4429–31
3.3. The Effects of PA4429–31 Deficiency on the Phenotypic Traits Related to Virulence of P. aeruginosa PAO1
3.4. The Effects of PA4429–31 on the Pathogenicity of P. aeruginosa PAO1
3.5. PA4429–31 Deletion Affected the Quorum Sensing and Iron Adsorption Systems of P. aeruginosa PAO1
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Chen, J.; Strous, M. Denitrification and aerobic respiration, hybrid electron transport chains and co-evolution. Biochim. Biophys Acta 2013, 1827, 136–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arai, H. Regulation and Function of Versatile Aerobic and Anaerobic Respiratory Metabolism in Pseudomonas aeruginosa. Front. Microbiol. 2011, 2, 103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mazat, J.P.; Ransac, S. The cytochrome bc1 complex in the mitochondrial respiratory chain functions according to the Q cycle hypothesis of Mitchell: The proof using a stochastic approach? Med. Sci. (Paris) 2010, 26, 1079–1086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, D.; Esser, L.; Tang, W.; Zhou, F.; Zhou, Y.; Yu, L.; Yu, C. Structural analysis of cytochrome bc1 complexes: Implications to the mechanism of function. Biochim. Biophys. Acta 2013, 1827, 1278–1294. [Google Scholar] [CrossRef] [Green Version]
- Vartak, R.; Porras, C.A.; Bai, Y. Respiratory supercomplexes: Structure, function and assembly. Protein Cell 2013, 4, 582–590. [Google Scholar] [CrossRef] [Green Version]
- Bhatti, J.S.; Bhatti, G.K.; Reddy, P.H. Mitochondrial dysfunction and oxidative stress in metabolic disorders—A step towards mitochondria based therapeutic strategies. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 1066–1077. [Google Scholar] [CrossRef]
- Wang, L.; Zhang, X.; Cui, G.; Chan, J.W.; Wang, L.; Li, C.; Shan, L.; Xu, C.; Zhang, Q.; Wang, Y.; et al. A novel agent exerts antitumor activity in breast cancer cells by targeting mitochondrial complex II. Oncotarget 2016, 7, 32054–32064. [Google Scholar] [CrossRef]
- Sharaf, M.S.; Stevens, D.; Kamunde, C. Mitochondrial transition ROS spike (mTRS) results from coordinated activities of complex I and nicotinamide nucleotide transhydrogenase. Biochim. Biophys. Acta Bioenerg. 2017, 1858, 955–965. [Google Scholar] [CrossRef]
- Small, J.L.; Park, S.W.; Kana, B.D.; Ioerger, T.R.; Sacchettini, J.C.; Ehrt, S. Perturbation of cytochrome c maturation reveals adaptability of the respiratory chain in Mycobacterium tuberculosis. mBio 2013, 4, e00475-13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lencina, A.M.; Franza, T.; Sullivan, M.J.; Ulett, G.C.; Ipe, D.S.; Gaudu, P.; Gennis, R.B.; Schurig-Briccio, L.A. Type 2 NADH Dehydrogenase Is the Only Point of Entry for Electrons into the Streptococcus agalactiae Respiratory Chain and Is a Potential Drug Target. mBio 2018, 9, e01034-18. [Google Scholar] [CrossRef] [Green Version]
- Auzat, I.; Chapuy-Regaud, S.; Le Bras, G.; Dos Santos, G.; Ogunniyi, A.D.; Le Thomas, I.; Garel, J.R.; Paton, J.C.; Trombe, M.C. The NADH oxidase of Streptococcus pneumoniae: Its involvement in competence and virulence. Mol. Microbiol. 1999, 34, 1018–1028. [Google Scholar] [CrossRef]
- Ge, X.; Yu, Y.; Zhang, M.; Chen, L.; Chen, W.; Elrami, F.; Kong, F.; Kitten, T.; Xu, P. Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis. Infect. Immun. 2016, 84, 1470–1477. [Google Scholar] [CrossRef] [Green Version]
- Xiao, Y.; Esser, L.; Zhou, F.; Li, C.; Zhou, Z.; Yu, C.; Qin, Z.; Xia, D. Studies on inhibition of respiratory cytochrome bc1 complex by the fungicide pyrimorph suggest a novel inhibitory mechanism. PLoS ONE 2014, 9, e93765. [Google Scholar] [CrossRef] [PubMed]
- Martins Vde, P.; Dinamarco, T.M.; Curti, C.; Uyemura, S.A. Classical and alternative components of the mitochondrial respiratory chain in pathogenic fungi as potential therapeutic targets. J. Bioenerg. Biomembr. 2011, 43, 81–88. [Google Scholar] [CrossRef]
- Murai, M.; Habu, S.; Murakami, S.; Ito, T.; Miyoshi, H. Production of new amilorides as potent inhibitors of mitochondrial respiratory complex I. Biosci. Biotechnol. Biochem. 2015, 79, 1061–1066. [Google Scholar] [CrossRef] [Green Version]
- Bald, D.; Villellas, C.; Lu, P.; Koul, A. Targeting Energy Metabolism in Mycobacterium tuberculosis, a New Paradigm in Antimycobacterial Drug Discovery. mBio 2017, 8, e00272-17. [Google Scholar] [CrossRef] [Green Version]
- Chevalier, S.; Bouffartigues, E.; Bodilis, J.; Maillot, O.; Lesouhaitier, O.; Feuilloley, M.G.J.; Orange, N.; Dufour, A.; Cornelis, P. Structure, function and regulation of Pseudomonas aeruginosa porins. FEMS Microbiol. Rev. 2017, 41, 698–722. [Google Scholar] [CrossRef]
- Karpeisky, M.; Ilyin, V.A. Analysis of non-polar regions in proteins. J. Mol. Biol. 1992, 224, 629–638. [Google Scholar] [CrossRef]
- Lister, P.D.; Wolter, D.J.; Hanson, N.D. Antibacterial-resistant Pseudomonas aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009, 22, 582–610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raba, D.A.; Rosas-Lemus, M.; Menzer, W.M.; Li, C.; Fang, X.; Liang, P.; Tuz, K.; Minh, D.D.L.; Juárezt, O. Characterization of the Pseudomonas aeruginosa NQR complex, a bacterial proton pump with roles in autopoisoning resistance. J. Biol. Chem. 2018, 293, 15664–15677. [Google Scholar] [CrossRef] [Green Version]
- Williams, H.D.; Zlosnik, J.E.; Ryall, B. Oxygen, cyanide and energy generation in the cystic fibrosis pathogen Pseudomonas aeruginosa. Adv. Microb. Physiol. 2007, 52, 1–71. [Google Scholar]
- Slizen, M.V.; Galzitskaya, O.V. Comparative Analysis of Proteomes of a Number of Nosocomial Pathogens by KEGG Modules and KEGG Pathways. Int. J. Mol. Sci. 2020, 21, 7839. [Google Scholar] [CrossRef] [PubMed]
- Winsor, G.L.; Griffiths, E.J.; Lo, R.; Dhillon, B.K.; Shay, J.A.; Brinkman, F.S.L. Enhanced annotations and features for comparing thousands of Pseudomonas genomes in the Pseudomonas genome database. Nucleic. Acids. Res. 2016, 44, 646–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Yang, L.; Zhao, X.Y.; Shen, L.X.; Duan, K.M. Identification of Pseudomonas aeruginosa genes associated with antibiotic susceptibility. Sci. China Life Sci. 2010, 53, 1247–1251. [Google Scholar] [CrossRef]
- Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [Google Scholar] [CrossRef]
- Starkey, M.; Rahme, L.G. Modeling Pseudomonas aeruginosa pathogenesis in plant hosts. Nat. Protoc. 2009, 4, 117–124. [Google Scholar] [CrossRef]
- Poole, K.; Krebes, K.; McNally, C.; Neshatt, S. Multiple antibiotic resistance in Pseudomonas aeruginosa: Evidence for involvement of an efflux operon. J. Bacteriol. 1993, 175, 7363–7372. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.W.; Yu, S.; Zhang, Z.; Wei, Q.; Yan, L.; Ai, G.; Liu, H.; Ma, L.Z. Coordination of swarming motility, biosurfactant synthesis, and biofilm matrix exopolysaccharide production in Pseudomonas aeruginosa. App. Environ. Microbiol. 2014, 80, 6724–6732. [Google Scholar] [CrossRef] [Green Version]
- John, J.B. Determination of ATP in Chlorella with the luciferin-luciferase enzyme system. Anal. Biochem. 1970, 37, 409–416. [Google Scholar] [CrossRef]
- Peng, X.; Wang, S.; Yu, S.; Zhang, Z.; Wei, Q.; Yan, L.; Ai, G.; Liu, H.; Ma, L.Z. Expression of a mitochondrial gene orfH79 from the CMS-HongLian rice inhibits Saccharomyces cerevisiae growth and causes excessive ROS accumulation and decrease in ATP. Biotechnol. Lett. 2009, 31, 409–414. [Google Scholar] [CrossRef]
- Essar, D.W.; Eberly, L.; Hadero, A.; Crawford, I.P. Identification and characterization of genes for a second anthranilate synthase in Pseudomonas aeruginosa: Interchangeability of the two anthranilate synthases and evolutionary implications. J. Bacteriol. 1990, 172, 884–900. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinzon, N.M.; Ju, L.K. Analysis of rhamnolipid biosurfactants by methylene blue complexation. App. Microbiol. Biotech. 2009, 82, 975–981. [Google Scholar] [CrossRef]
- Taha, M.N.; Saafan, A.E.; Ahmedy, A.; El Gebaly, E.; Khairalla, A.S. Two novel synthetic peptides inhibit quorum sensing-dependent biofilm formation and some virulence factors in Pseudomonas aeruginosa PAOJ. Microbiology 2019, 57, 618–625. [Google Scholar]
- Qi, J.; Wang, B.; Li, J.; Ning, H.; Wang, Y.; Kong, W.; Shen, L. Genetic determinants involved in the biodegradation of naphthalene and phenanthrene in Pseudomonas aeruginosa PAO1. Environ. Sci. Pollut. Res. Int. 2015, 22, 6743–6755. [Google Scholar] [CrossRef] [PubMed]
- Duan, K.; Dammel, C.; Stein, J.; Rabin, H.; Surette, M.G. Modulation of Pseudomonas aeruginosa gene expression by host microflora through interspecies communication. Mol. Microbiol. 2003, 50, 1477–1491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hamada, M.; Toyofuku, M.; Miyano, T.; Nomura, N. cbb3-type cytochrome c oxidases, aerobic respiratory enzymes, impact the anaerobic life of Pseudomonas aeruginosa PAO1. J. Bacteriol. 2014, 196, 3881–3889. [Google Scholar] [CrossRef] [Green Version]
- Schreiber, K.; Krieger, R.; Benkert, B.; Eschbach, M.; Arai, H.; Schobert, M.; Jahn, D. The anaerobic regulatory network required for Pseudomonas aeruginosa nitrate respiration. J. Bacteriol. 2007, 189, 4310–4314. [Google Scholar] [CrossRef] [Green Version]
- Hazan, R.; Que, Y.A.; Maura, D.; Strobel, B.; Majcherczyk, P.A.; Hopper, L.R.; Wilbur, D.J.; Hreha, T.N.; Barquera, B.; Rahme, L.G. Auto Poisoning of the Respiratory Chain by a Quorum-Sensing-Regulated Molecule Favors Biofilm Formation and Antibiotic Tolerance. Curr. Biol. 2016, 26, 195–206. [Google Scholar] [CrossRef] [Green Version]
- Kawakami, T.; Kuroki, M.; Ishii, M.; Igarashi, Y.; Arai, H. Differential expression of multiple terminal oxidases for aerobic respiration in Pseudomonas aeruginosa. Environ. Microbiol. 2010, 12, 1399–1412. [Google Scholar]
- Cui, Q.; Lv, H.; Qi, Z.; Jiang, B.; Xiao, B.; Liu, L.; Ge, Y.; Hu, X. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1. PLoS ONE 2016, 11, e0144447. [Google Scholar] [CrossRef]
- Pearson, J.P.; Pesci, E.C.; Iglewski, B.H. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in control of elastase and rhamnolipid biosynthesis genes. J. Bacteriol. 1997, 179, 5756–5767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colvin, K.M.; Irie, Z.; Tart, C.S.; Urbano, R.; Whitney, J.C.; Ryder, C.; Howell, P.L.; Wozniak, D.J.; Parsek, M.R. The Pel and Psl polysaccharides provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ. Microbiol. 2012, 14, 1913–1928. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hnamte, S.; Parasuraman, P.; Ranganathan, S.; Ampasala, D.R.; Reddy, D.; Kumavath, R.N.; Suchiang, K.; Mohanty, S.K.; Busi, S. Mosloflavone attenuates the quorum sensing controlled virulence phenotypes and biofilm formation in Pseudomonas aeruginosa PAO1: In vitro, in vivo and in silico approach. Microb. Pathog. 2019, 131, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Minandri, F.; Imperi, F.; Frangipani, E.; Bonchi, C.; Visaggio, D.; Facchini, M.; Pasquali, P.; Bragonzi, A.; Visca, P. Role of Iron Uptake Systems in Pseudomonas aeruginosa Virulence and Airway Infection. Infect. Immun. 2016, 84, 2324–2335. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamont, I.L.; Beare, P.A.; Ochsner, U.; Vasil, A.I.; Vasil, M.L. Siderophore-mediated signaling regulates virulence factor production in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 2002, 99, 7072–7077. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kostakioti, M.; Hadjifrangiskou, M.; Hultgren, S.J. Bacterial biofilms: Development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harb. Perspect. Med. 2013, 3, a010306. [Google Scholar] [CrossRef] [Green Version]
- Torres, A.; Kasturiarachi, N.; DuPont, M.; Cooper, V.S.; Bomberger, J.; Zemke, A. NADH Dehydrogenases in Pseudomonas aeruginosa Growth and Virulence. Front. Microbiol. 2019, 10, 75. [Google Scholar] [CrossRef]
- Taber, H.W.; Mueller, J.P.; Miller, P.F.; Arrow, A.S. Bacterial uptake of aminoglycoside antibiotics. Microbiol. Rev. 1987, 51, 439–457. [Google Scholar] [CrossRef]
- Ezraty, B.; Vergnes, A.; Banzhaf, M.; Duverger, Y.; Huguenot, A.; Brochado, A.R.; Su, S.Y.; Espinosa, L.; Loiseau, L.; Py, B.; et al. Fe-S cluster biosynthesis controls uptake of aminoglycosides in a ROS-less death pathway. Science 2013, 340, 1583–1587. [Google Scholar] [CrossRef]
- Newman, J.W.; Floyd, R.V.; Fothergill, J.L. The contribution of Pseudomonas aeruginosa virulence factors and host factors in the establishment of urinary tract infections. FEMS. Microbiol. Lett. 2017, 364, fnx124. [Google Scholar] [CrossRef]
Strains or Plasmids | Genotype or Phenotype | References |
---|---|---|
Strains | ||
E. coli | ||
DH10B | F mcrA Δ(mrr-hsdRMS-mcrBC) F 80lacZΔM15 ΔlacX74 recA1 araΔ139Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG | Invitrogen |
P. aeruginosa | ||
PAO1 | Wild type | This lab |
PAO1(Δ4429) | PA4429 deletion mutant of PAO1 | This study |
PAO1(Δ4430) | PA4430 deletion mutant of PAO1 | This study |
PAO1(Δ4431) | PA4431 deletion mutant of PAO1 | This study |
PAO1(Δ4429–31) | PA4429–31 deletion mutant of PAO1 | This study |
PAO1(Δ4429)C1 | PAO1(Δ4429) complement contains pAK4429 | This study |
PAO1(Δ4429)C2 | PAO1(Δ4429) complement contains pAK4429–31 | This study |
PAO1(Δ4430)C1 | PAO1(Δ4430) complement contains pAK4430 | This study |
PAO1(Δ4430)C2 | PAO1(Δ4430) complement contains pAK4429–31 | This study |
PAO1(Δ4431)C1 | PAO1(Δ4431) complement contains pAK4431 | This study |
PAO1(Δ4431)C2 | PAO1(Δ4431) complement contains pAK4429–31 | This study |
PAO1(Δ4429–31)C | PAO1(Δ4429–31) complement contains pA4429–31 | This study |
Plasmids | ||
pEX18Tc | oriT+sacB+ gene replacement vector with mμltiple cloning site from pUC18; Tcr | This lab |
pRK2013 | Broad-host-range helper vector; Tra+, KanR | This lab |
pAK1900 | Multicopy E. coli-P. aeruginosa shuttle vectorwith an MCS within lacZ fragment | This lab |
pMS402 | Expression reporter plasmid carrying the promoter less luxCDABE, KanR,TmpR | This lab |
pKD-phzA1 | pMS402 contains phzA1 promoter region | This study |
pKD-phzA2 | pMS402 contains phzA2 promoter region | This study |
pKD-lasI | pMS402 contains lasI promoter region | This study |
pKD-lasR | pMS402 contains lasR promoter region | This study |
pKD-rhlR | pMS402 contains rhlR promoter region | This study |
pKD-rhlI | pMS402 contains rhlI promoter region | This study |
pKD-pqsH | pMS402 contains pqsH promoter region | This study |
pKD-fur | pMS402 contains fur promoter region | This study |
pKD-tonB1 | pMS402 contains tonB1promoter region | This study |
Primer | Sequence (5′→3′) | Restriction Site |
---|---|---|
PA4429-UP-S | CGTGAATTCTCAACGGAAGACAGGCT | EcoR I |
PA4429-UP-A | CGTGAGCTCTCTTCGTATTCGCCTATC | Sac I |
PA4429-D-S | AGCGAGCTCACATGATCCAGTTGCGG | Sac I |
PA4429-D-A | AATGGTACCTCGGCGTGGACCAGGAGA | Kpn I |
PA4430-UP-S | AGTGAATTCGGGTCGGAATAGCAGGTC | EcoR I |
PA4430-UP-A | CTTGAGCTCCTGATGCCGTTCTACACC | Sac I |
PA4430-D-S | AGTGAGCTCTTGACCAGCACCAGCAGC | Sac I |
PA4430-D-A | TATCCCGGGTAAGAAAGTCGGTCTGCG | Sma I |
PA4431-UP-S | GTCGAATTCTCATCAGCCAGTCACCCT | EcoR I |
PA4431-UP-A | ATAGAGCTCCGTGGACCAGGAGAAAGC | Sac I |
PA4431-D-S | CGAGAGCTCCATTCACGCCGTCATTA | Sac I |
PA4431-D-A PA4429–31-UP-S PA4429–31-UP-A PA4429–31-D-S PA4429–31-D-A | GCAGGTACCAAGACCACCGACAAGATG CCTGAGCTCCGATATGTATCGCAAGCTG AAGTCTAGAGCCTGCATTCACGCCGTC CTGTCTAGATAACCCGCACGTTGGTC GAACTGCAGACATTGAGCACGATCTG | Kpn I Sac I Xba I Xba I Pst I |
For Complemented Strains | ||
PA4429-F | ATCGAAGCTTAGGCTGCCAGGTTAA | Hind Ⅲ |
PA4429-R | AATAGGATCCGATCCGAATATCGA | BamH I |
PA4430-F | CGCAAGCTTATACGTTCGATGCTGAC | Hind Ⅲ |
PA4430-R | CCTTCTAGAGCCAGAATCAGTGCAGC | Xba I |
PA4431-F | TGGGCATGCGTCAGGCTATTACCTTG | Sph I |
PA4431-R | GGCGTCGACTCTTCCCACATCTTGG | Spl I |
PA4429–31-F | AGTTCTAGACGGCGTGAATGCAGGC | Xba I |
PA4429–31-R | AAGGAGCTCACCAACGTGCGGGTTAG | Sac I |
RT-PCR | ||
random PCR primer F | GTGCTGACCCCGGATGAAGTGGTTCGCATC | None |
random PCR primer R | GGATGCGTCTAAAAGCCTGC | None |
r1 | GACATTGAGCACGATCTG | None |
r2 | ACAAGCTGACCTGCTATTC | None |
r3 | ACATGATCCAGTTGCGG | None |
r4 | CGTGGACCAGGAGAAAGC | None |
r5 | GGGTCGGAATAGCAGGTC | None |
r6 | GAACCTGGTGACCTTCCTG | None |
The Strain | MIC (μg/mL) | |||
---|---|---|---|---|
Kan | Gm | Tob | Amk | |
PAO1 | 64 | 32 | 2 | 1 |
PAO1(△4429) | 256 | 128 | 8 | 4 |
PAO1(△4430) | 256 | 128 | 8 | 4 |
PAO1(△4431) | 256 | 128 | 8 | 4 |
Gene ID | Gene Name | Product | Fold Change |
---|---|---|---|
PA5531 | tonB1 | Transporter TonB | 3.18 |
PA4764 | fur | Ferric uptake regulation protein | 1.12 |
PA2426 | pvds | Extracytoplasmic-function sigma-70 factor | 3.27 |
PA2398 | fpvA | Ferripyoverdine receptor | 2.86 |
PA2386 | pvdA | L-ornithine, N5-oxygenase, pyoverdine produce | 2.25 |
PA1911 | fecR | Iron dicitrate transport regulator FecR | 4.86 |
PA3209 | ykgJ | Zinc/iron-chelating, domain-containing protein | −12.95 |
PA3518 | Iron-containing redox enzyme family protein | −11.80 | |
PA4159 | fepB | Transporter periplasmic-binding protein | 2.14 |
PA4191 | Iron oxidase | −9.19 | |
PA1910 | fcuA | Ferric-mycobactin receptor FemA | 2.01 |
PA2466 | foxA | Ferrioxamine receptor FoxA | 2.46 |
PA3812 | iscA | Iron-binding protein IscA | 2.31 |
PA3814 | iscS | Cysteine desulfurase | 2.35 |
PA5483 | algB | Two-component response regulator AlgB | −2.06 |
PA2384 | Ferric uptake regulator, Fur family | 6.59 | |
PA3901 | fecA | Fe(III) dicitrate transporter FecA | 3.41 |
Gene ID | Gene Name | Product | Fold Change |
---|---|---|---|
PA0609 | trpE | Anthranilate synthase component I | −1.15 |
A0649 | trpG | Anthranilate synthase component II | −1.17 |
PA0996 | pqsA | Anthranilate--CoA ligase | −1.01 |
PA0997 | pqsB | PqsB | −1.48 |
PA0998 | pqsC | Beta-keto-ACP synthase | −1.17 |
PA1303 | lepB | Signal peptidase | −13.23 |
PA1432 | lasI | Acyl-homoserine-lactone synthase | −1.05 |
PA1871 | lasA | Protease LasA | −2.28 |
PA1901 | phzC | Phenazine biosynthesis protein PhzC | −1.14 |
PA2570 | lecA | PA-I galactophilic lectin | 1.24 |
PA3478 | Rhamnosyltransferase subunit B | −1.38 | |
PA3724 | lasB | Elastase LasB | −1.08 |
PA4206 | mdtA | Resistance-nodulation-cell division (RND) efflux membrane Fusion protein | −1.66 |
PA4210 | phzA1 | Phenazine biosynthesis protein | −2.62 |
PA4211 | phzB1 | Phenazine biosynthesis protein phzB 1 | −1.95 |
PA4212 | phzC | Phenazine biosynthesis protein PhzC | −1.16 |
PA4815 | Integral membrane protein | 1.78 | |
PA4944 | hfq | RNA-binding protein Hfq | 1.06 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, L.; Gao, L.; Yang, M.; Zhang, J.; Wang, Y.; Feng, Y.; Wang, L.; Wang, S. Deletion of the PA4427-PA4431 Operon of Pseudomonas aeruginosa PAO1 Increased Antibiotics Resistance and Reduced Virulence and Pathogenicity by Affecting Quorum Sensing and Iron Uptake. Microorganisms 2021, 9, 1065. https://doi.org/10.3390/microorganisms9051065
Shen L, Gao L, Yang M, Zhang J, Wang Y, Feng Y, Wang L, Wang S. Deletion of the PA4427-PA4431 Operon of Pseudomonas aeruginosa PAO1 Increased Antibiotics Resistance and Reduced Virulence and Pathogenicity by Affecting Quorum Sensing and Iron Uptake. Microorganisms. 2021; 9(5):1065. https://doi.org/10.3390/microorganisms9051065
Chicago/Turabian StyleShen, Lixin, Lang Gao, Mengjiao Yang, Jian Zhang, Yulu Wang, Yuqi Feng, Liping Wang, and Shiwei Wang. 2021. "Deletion of the PA4427-PA4431 Operon of Pseudomonas aeruginosa PAO1 Increased Antibiotics Resistance and Reduced Virulence and Pathogenicity by Affecting Quorum Sensing and Iron Uptake" Microorganisms 9, no. 5: 1065. https://doi.org/10.3390/microorganisms9051065