Frequencies Evaluation of β-Casein Gene Polymorphisms in Dairy Cows Reared in Central Italy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Jenness, R. Comparative aspects of milk protein. J. Dairy Res. 1979, 46, 197–210. [Google Scholar] [CrossRef] [PubMed]
- Tailford, K.A.; Berry, C.L.; Thomas, A.C.; Campbell, J.H. A casein variant in cow’s milk is atherogenic. Atherosclerosis 2003, 170, 13–19. [Google Scholar] [CrossRef]
- Rijnkels, M. Multispecies comparison of the casein gene loci and evolution of casein gene family. J. Mammary Gland Biol. Neoplasia 2002, 7, 327–345. [Google Scholar] [CrossRef] [PubMed]
- Stewart, A.F.; Bonsing, J.; Beattie, C.W.; Shah, F.; Willis, I.M.; Mackinlay, A.G. Complete nucleotide sequences of bovine αs2 and β-casein cDNAs: Comparisons with related sequences in other species. Mol. Biol. Evol. 1987, 4, 231–241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pearse, M.J.; Linklater, P.M.; Hall, R.J.; Macaulay, A.G. The effect of casein composition and casein dephosphorylation on the coagulation and synthesis of artificial micelle milk. J. Dairy Res. 1986, 53, 381–390. [Google Scholar] [CrossRef]
- Ng-KwayHang, K.F. Genetic variants of milk proteins and their effects on the yield and quality of cheese. CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources 2006, 56, 1–11. [Google Scholar] [CrossRef]
- Barroso, A.; Dunner, S.; Cañón, J. Technical note: Use of PCR-single-strand conformation polymorphism analysis for detenction of bovine β- casein variants A1, A2, A3, B.J. Anim. Sci. 1999, 77, 2629–2632. [Google Scholar] [CrossRef]
- Massella, E.; Piva, S.; Giacometti, F.; Liuzzo, G.; Zambrini, A.V.; Serraino, A. Evaluations of bovine β- casein polymorphism in two dairy farms located in northern. Ital. J. Food Safety 2017, 6, 6904. [Google Scholar] [CrossRef] [Green Version]
- Farrel, H.M.; Jimenez-Flores, R.; Bleck, G.T.; Brown, E.M.; Butler, J.E.; Creamer, L.K.; Swaisgood, H.E. Nomenclature of the proteins of cows’ milk—sixth revision. J. Dairy Sci. 2004, 87, 1641–1674. [Google Scholar] [CrossRef] [Green Version]
- Voglino, G.F. A new β- casein variant in piedmont cattle. Anim. Genet. 1972, 3, 61–62. [Google Scholar] [CrossRef]
- Bodnár, Á.; Hajzser, A.; Egerszegi, I.; Póti, P.; Kuchtík, J.; Pajor, F. A2 milk and its importance in dairy production and global market. Anim. Welf. 2018, 14, 1–7. [Google Scholar]
- Brooke-Taylor, S.; Dwyer, K.; Woodford, K.; Kost, N. Systematic Review of the Gastrointestinal Effects of A1 Compared with A2 β-Casein. Adv. Nutr. 2017, 15, 739–748. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority. Review of the potential health impact of β-casomorphins and related peptides. EFSA Sci. Rep. 2009, 231, 1–107. [Google Scholar]
- Deth, R.; Andrew Clarke, A.; Jiayi, N.J.; Trivedi, M. Clinical evaluation of glutathione concentrations after consumption of milk containing different subtypes of β-casein: Results from a randomized, cross-over clinical trial. Nutr. J. 2016, 15, 82–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McLachlan, C.N. β-casein A1, ischaemic heart disease mortality and other illnesses. Med. Hypotheses 2001, 56, 262–272. [Google Scholar] [CrossRef] [Green Version]
- Kamiński, S.; Cieślińska, A.; Kostyra, E. Polymorphism of bovine β--casein and its potential effect on human health. J. Appl. Genet. 2007, 48, 189–198. [Google Scholar] [CrossRef]
- Caroli, A.M.; Chessa, S.; Erhardt, G.J. Invited review: Milk protein polymorphism in cattle: Effect on animal breeding and human nutrition. J. Dairy Sci. 2009, 92, 5335–5352. [Google Scholar] [CrossRef] [Green Version]
- Pal, S.; Woodford, K.; Kukuljan, S.; Ho, S. Milk intolerance, β- casein and lactose. Nutrients 2015, 7, 285–297. [Google Scholar] [CrossRef]
- Cieslinska, A.; Sienkiewicz-Szłapka, E.; Wasilewska, J.; Fiedorowicz, E.; Chwała, B.; Moszy’nska-Dumara, M.; Kostyra, E. Influence of candidate polymorphisms on the dipeptidyl peptidase IV and μ -opioid receptor genes expression in aspect of the β-casomorphin-7 modulation functions in autism. Peptides 2015, 65, 6–11. [Google Scholar] [CrossRef]
- Reichelt, K.L.; Tveiten Bioengineer, D.; Knivsberg, A.M.; Brønstad, G. Peptides’ role in autism with emphasis on exorphins. Microb. Ecol. Health Dis. 2012, 23, 18958. [Google Scholar] [CrossRef]
- Kullenberg de Gaudry, D.; Lohner, S.; Schmucker, C.; Kapp, P.; Motschall, E.; Horrlein, S.; Roger, C.; Meerpohl, J.J. Milk A1 b-casein and health-related outcomes in humans: A systematic review. Nutr. Rev. 2019, 77, 278–306. [Google Scholar] [CrossRef] [PubMed]
- Chessa, S.; Chiatti, F.; Ceriotti, G.; Caroli, A.; Consolandi, C.; Pagnacco, G.; Castiglioni, B. Development of a Single Nucleotide Polymophism genotyping microarray platform for the identification of bovine milk protein genetic polymorphisms. J. Dairy Sci. 2007, 90, 451–464. [Google Scholar] [CrossRef] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research--an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Canavesi, F. Selezionare per produrre latte A2. Professione Allevatore 2016, 16, 52–54. [Google Scholar]
- Jann, O.; Ceriotti, G.; Caroli, A.; Ethardt, G. A new variant in exon VII of bovine β-casein gene (CSN2) and its distribution among European cattle breeds. J. Anim. Breed. Genet. 2002, 119, 65–68. [Google Scholar] [CrossRef]
βcasein Variant | Amino Acid Position | ||||||||
---|---|---|---|---|---|---|---|---|---|
36 | 37 | 67 | 72 | 88 | 93 | 106 | 122 | 138 | |
A2 * | Glu (E) | Glu (E) | Pro (P) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Pro (P) |
A1 * | Glu (E) | Glu (E) | His (H) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Pro (P) |
A3 * | Glu (E) | Glu (E) | Pro (P) | Gln (Q) | Leu (L) | Met (M) | Gln (Q) | Ser (S) | Pro (P) |
B * | Glu (E) | Glu (E) | His (H) | Gln (Q) | Leu (L) | Met (M) | His (H) | Arg (R) | Pro (P) |
C * | Glu (E) | Lys (K) | His (H) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Pro (P) |
E * | Lys (K) | Glu (E) | Pro (P) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Pro (P) |
I * | Glu (E) | Glu (E) | Pro (P) | Gln (Q) | Leu (L) | Leu (L) | His (H) | Ser (S) | Pro (P) |
D | Glu (E) | Glu (E) | Pro (P) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Pro (P) |
F | Glu (E) | Glu (E) | His (H) | Gln (Q) | Leu (L) | Met (M) | His (H) | Ser (S) | Leu (L) |
G | Glu (E) | Glu (E) | His (H) | Gln (Q) | Leu (L) | Met (M) | His (H) | Leu (L) | Pro (P) |
H1 | Glu (E) | Glu (E) | Pro (P) | Gln (Q) | Ile (I) | Met (M) | His (H) | Ser (S) | Pro (P) |
H2 | Glu (E) | Glu (E) | Pro (P) | Glu (E) | Leu (L) | Leu (L) | His (H) | Ser (S) | Glu (E) |
Target Gene | Target Sequence | Primer Sequences | Amplification Product (bp) | Reference |
---|---|---|---|---|
CSN2 | Exon 6 | For CATCAATAAGGTAAAACCCCTCATATT Rev TTGTCAAAGTTTTTATTTCTTGCACTG | 274 | This study |
Exon 7 | For TTTCCAGGATGAACTCCAGGAT Rev CATCAGAAGTTAAACAGGCACAGTTAG | 547 |
Allele | Allele Frequency (%) | Genotype | Genotype Frequency (%) |
---|---|---|---|
A2 | 60.65 | A2/A2 | 36.96 |
A1 | 30.39 | A1/A2 | 35.79 |
B | 5.68 | A1/A1 | 9.88 |
I | 3.10 | A2/B | 7.55 |
A3 | 0.15 | A2/I | 3.93 |
C | 0.03 | A1/B | 3.07 |
A1/I | 2.03 | ||
B/I | 0.25 | ||
B/B | 0.18 | ||
A2/A3 | 0.12 | ||
A3/B | 0.12 | ||
A1/A3 | 0.06 | ||
A1/C | 0.06 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sebastiani, C.; Arcangeli, C.; Ciullo, M.; Torricelli, M.; Cinti, G.; Fisichella, S.; Biagetti, M. Frequencies Evaluation of β-Casein Gene Polymorphisms in Dairy Cows Reared in Central Italy. Animals 2020, 10, 252. https://doi.org/10.3390/ani10020252
Sebastiani C, Arcangeli C, Ciullo M, Torricelli M, Cinti G, Fisichella S, Biagetti M. Frequencies Evaluation of β-Casein Gene Polymorphisms in Dairy Cows Reared in Central Italy. Animals. 2020; 10(2):252. https://doi.org/10.3390/ani10020252
Chicago/Turabian StyleSebastiani, Carla, Chiara Arcangeli, Marcella Ciullo, Martina Torricelli, Giulia Cinti, Stefano Fisichella, and Massimo Biagetti. 2020. "Frequencies Evaluation of β-Casein Gene Polymorphisms in Dairy Cows Reared in Central Italy" Animals 10, no. 2: 252. https://doi.org/10.3390/ani10020252