Nano Chromium Picolinate Improves Gene Expression Associated with Insulin Signaling in Porcine Skeletal Muscle and Adipose Tissue
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Blood Sampling and Plasma Analyses
2.3. Subcutaneous Adipose and Skeletal Muscle Biopsies Collection
2.4. RNA Extraction and Quantification
2.5. Reverse Transcriptase PCR and Real-Time Quantitative-PCR (Q-PCR)
2.6. Statistical Analyses
3. Results
3.1. Carcass Composition and Plasma Homeostatic Model Assessment of Insulin Resistance
3.2. Adiponectin, Leptin, TNFα and c-Jun N-Terminal Kinase (JNK1) Gene Expression in Porcine Adipose Tissue
3.3. PPARγ, C/EBPα, SREBP and FAS Gene Expression in Porcine Adipose Tissue
3.4. IR, PI3K, AKT, UCP3 and SOCS3 Gene Expression in Porcine Adipose Tissue
3.5. IR, PI3K, AKT, GLUT4 and SOCS3 Gene Expression in Porcine Skeletal Muscle Tissue
3.6. UCP3, IL-15 and JNK1 Gene Expression in Porcine Skeletal Muscle Tissue
3.7. Correlations between mRNA Expression and Phenotypic Parameters
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Sell, H.; Dietze-Schroeder, D.; Eckel, J. The adipocyte–myocyte axis in insulin resistance. Trends Endocrinol. Metab. 2006, 17, 416–422. [Google Scholar] [CrossRef] [PubMed]
- Fryer, L.G.; Kruszynska, Y.T. Insulin Resistance in High Fat Fed Rats. Ann. N. Y. Acad. Sci. 1993, 683, 91–97. [Google Scholar] [CrossRef] [PubMed]
- Shearer, J.; Duggan, G.; Weljie, A.; Hittel, D.S.; Wasserman, D.H.; Vogel, H.J. Metabolomic profiling of dietary-induced insulin resistance in the high fat-fed C57BL/6J mouse. Diabetes Obes. Metab. 2008, 10, 950–958. [Google Scholar] [CrossRef] [PubMed]
- Kandadi, M.R.; Unnikrishnan, M.K.; Warrier, A.K.S.; Du, M.; Ren, J.; Nair, S. Chromium (d-Phenylalanine)3 alleviates high fat-induced insulin resistance and lipid abnormalities. J. Inorg. Biochem. 2011, 105, 58–62. [Google Scholar] [CrossRef] [Green Version]
- Qatanani, M.; Lazar, M.A. Mechanisms of obesity-associated insulin resistance: Many choices on the menu. Genes Dev. 2007, 21, 1443–1455. [Google Scholar] [CrossRef] [Green Version]
- Dunshea, F.R.; Cox, M.L. Effect of dietary protein on body composition and insulin resistance using a pig model of the child and adolescent. Nutr. Diet. 2008, 65, S60–S65. [Google Scholar] [CrossRef]
- Sabin, M.; Yau, S.W.; Russo, V.C.; Clarke, I.J.; Dunshea, F.R.; Chau, J.; Cox, M.; Werther, G. Dietary Monounsaturated Fat in Early Life Regulates IGFBP2: Implications for Fat Mass Accretion and Insulin Sensitivity. Obesity 2011, 19, 2374–2381. [Google Scholar] [CrossRef]
- Dunshea, F.R.; D’Souza, D.N. Review: Fat deposition and metabolism in the pig. In Manipulating Pig Production IX; Paterson, J.E., Ed.; Australasian Pig Science Association (Inc): Werribee, VIC, Australia, 2003; pp. 147–150. [Google Scholar]
- Cao, Z.; Umek, R.M.; McKnight, S.L. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 1991, 5, 1538–1552. [Google Scholar] [CrossRef] [Green Version]
- Rosen, E.D.; Spiegelman, B.M. Molecular Regulation of Adipogenesis. Annu. Rev. Cell Dev. Biol. 2000, 16, 145–171. [Google Scholar] [CrossRef]
- Horton, J.D.; Shimomura, I.; Brown, M.S.; Hammer, R.; Goldstein, J.L.; Shimano, H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J. Clin. Investig. 1998, 101, 2331–2339. [Google Scholar] [CrossRef]
- Galic, S.; Oakhill, J.S.; Steinberg, G.R. Adipose tissue as an endocrine organ. Mol. Cell. Endocrinol. 2010, 316, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S.; Arner, P.; Caro, J.F.; Atkinson, R.L.; Spiegelman, B.M. Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J. Clin. Investig. 1995, 95, 2409–2415. [Google Scholar] [CrossRef] [PubMed]
- Lihn, A.S.; Pedersen, S.B.; Richelsen, B. Adiponectin: Action, regulation and association to insulin sensitivity. Obes. Rev. 2005, 6, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Kamohara, S.; Burcelin, R.; Halaas, J.L.; Friedman, J.M.; Charron, M.J. Acute stimulation of glucose metabolism in mice by leptin treatment. Nature 1997, 389, 374–377. [Google Scholar] [CrossRef]
- Ogawa, Y.; Masuzaki, H.; Hosoda, K.; Aizawa-Abe, M.; Suga, J.; Suda, M.; Ebihara, K.; Iwai, H.; Matsuoka, N.; Satoh, N.; et al. Increased glucose metabolism and insulin sensitivity in transgenic skinny mice overexpressing leptin. Diabetes 1999, 48, 1822–1829. [Google Scholar] [CrossRef]
- Steinberg, G.R.; Dyck, D.J. Development of leptin resistance in rat soleus muscle in response to high-fat diets. Am. J. Physiol. Metab. 2000, 279, E1374–E1382. [Google Scholar] [CrossRef] [Green Version]
- Mertz, W.; Roginski, E.E. Effects of Chromium(III) Supplementation on Growth and Survival Under Stress in Rats Fed Low Protein Diets. J. Nutr. 1969, 97, 531–536. [Google Scholar] [CrossRef] [Green Version]
- Mertz, W. Chromium in Human Nutrition: A Review. J. Nutr. 1993, 123, 626–633. [Google Scholar] [CrossRef]
- Amoikon, E.K.; Fernandez, J.M.; Southern, L.L.; Thompson, D.L.; Ward, T.L.; Olcott, B.M. Effect of chromium tripicolinate on growth, glucose tolerance, insulin sensitivity, plasma metabolites, and growth hormone in pigs2. J. Anim. Sci. 1995, 73, 1123–1130. [Google Scholar] [CrossRef]
- Jeejeebhoy, K.N.; Chu, R.C.; Marliss, E.B.; Greenberg, G.R.; Bruce-Robertson, A. Chromium deficiency, glucose intolerance, and neuropathy reversed by chromium supplementation, in a patient receiving long-term total parenteral nutrition. Am. J. Clin. Nutr. 1977, 30, 531–538. [Google Scholar] [CrossRef]
- Padmavathi, I.J.; Rao, K.R.; Venu, L.; Ganeshan, M.; Kumar, K.A.; Rao, C.N.; Harishankar, N.; Ismail, A.; Raghunath, M. Chronic Maternal Dietary Chromium Restriction Modulates Visceral Adiposity: Probable Underlying Mechanisms. Diabetes 2009, 59, 98–104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, J.; Wang, Z.Q.; Zhang, X.H.; Wachtel, D.; Volaufova, J.; Matthews, D.E.; Cefalu, W.T. Chromium Picolinate Supplementation Attenuates Body Weight Gain and Increases Insulin Sensitivity in Subjects With Type 2 Diabetes. Diabetes Care 2006, 29, 1826–1832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, T.J.H.; Blum, K.; Kaats, G.; Braverman, E.R.; Eisenberg, A.; Sherman, M.; Davis, K.; Comings, D.E.; Wood, R.; Pullin, D.; et al. Chromium Picolinate (CrP) a putative anti-obesity nutrient induces changes in body composition as a function of the Taq1 dopamine D2 receptor polymorphisms in a randomized double-blind placebo controlled study. Gene. Ther. Mol. Biol. 2007, 11, 161–170. [Google Scholar]
- Chen, W.-Y.; Chen, C.-J.; Liu, C.-H.; Mao, F.C. Chromium supplementation enhances insulin signalling in skeletal muscle of obese KK/HlJ diabetic mice. Diabetes Obes. Metab. 2009, 11, 293–303. [Google Scholar] [CrossRef]
- Hung, A.T.; Leury, B.J.; Sabin, M.; Lien, T.F.; Dunshea, F.R. Dietary chromium picolinate of varying particle size improves carcass characteristics and insulin sensitivity in finishing pigs fed low- and high-fat diets. Anim. Prod. Sci. 2015, 55, 454–460. [Google Scholar] [CrossRef]
- Katz, A.; Nambi, S.S.; Mather, K.J.; Baron, A.D.; Follmann, D.A.; Sullivan, G.; Quon, M.J. Quantitative Insulin Sensitivity Check Index: A Simple, Accurate Method for Assessing Insulin Sensitivity In Humans. J. Clin. Endocrinol. Metab. 2000, 85, 2402–2410. [Google Scholar] [CrossRef]
- Qiao, W.; Peng, Z.; Wang, Z.; Wei, J.; Zhou, A. Chromium Improves Glucose Uptake and Metabolism Through Upregulating the mRNA Levels of IR, GLUT4, GS, and UCP3 in Skeletal Muscle Cells. Biol. Trace Elem. Res. 2009, 131, 133–142. [Google Scholar] [CrossRef]
- Wang, Z.Q.; Cefalu, W.T. Current Concepts about Chromium Supplementation in Type 2 Diabetes and Insulin Resistance. Curr. Diabetes Rep. 2010, 10, 145–151. [Google Scholar] [CrossRef]
- Yan, X.; Zhang, F.; Li, N.; Zhu, X.; Jia, Z. Effects of Chromium on Energy Metabolism in Lambs Fed with Different Dietary Protein Levels. Asian-Australas. J. Anim. Sci. 2009, 23, 205–212. [Google Scholar] [CrossRef]
- Crawford, V.; Scheckenbach, R.; Preuss, H.G. Effects of niacin-bound chromium supplementation on body composition in overweight African-American women. Diabetes Obes. Metab. 1999, 1, 331–337. [Google Scholar] [CrossRef]
- Howard, J.K.; Flier, J.S. Attenuation of leptin and insulin signaling by SOCS proteins. Trends Endocrinol. Metab. 2006, 17, 365–371. [Google Scholar] [CrossRef] [PubMed]
- Rieusset, J.; Bouzakri, K.; Chevillotte, E.; Ricard, N.; Jacquet, D.; Bastard, J.-P.; Laville, M.; Vidal, H. Suppressor of cytokine signaling 3 expression and insulin resistance in skeletal muscle of obese and type 2 diabetic patients. Diabetes 2004, 53, 2232–2241. [Google Scholar] [CrossRef] [Green Version]
- Steinberg, G.R.; McAinch, A.; Chen, M.B.; O’Brien, P.E.; Dixon, J.B.; Cameron-Smith, D.; Kemp, B. The Suppressor of Cytokine Signaling 3 Inhibits Leptin Activation of AMP-Kinase in Cultured Skeletal Muscle of Obese Humans. J. Clin. Endocrinol. Metab. 2006, 91, 3592–3597. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watt, M.J.; Dzamko, N.; Thomas, W.G.; Rose-John, S.; Ernst, M.; Carling, D.; Kemp, B.; Febbraio, M.; Steinberg, G.R. CNTF reverses obesity-induced insulin resistance by activating skeletal muscle AMPK. Nat. Med. 2006, 12, 541–548. [Google Scholar] [CrossRef] [PubMed]
- Rui, L.; Yuan, M.; Frantz, D.; Shoelson, S.; White, M.F. SOCS-1 and SOCS-3 Block Insulin Signaling by Ubiquitin-mediated Degradation of IRS1 and IRS2. J. Biol. Chem. 2002, 277, 42394–42398. [Google Scholar] [CrossRef] [Green Version]
- Virkamäki, A.; Ueki, K.; Kahn, C.R. Protein–protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J. Clin. Investig. 1999, 103, 931–943. [Google Scholar] [CrossRef] [Green Version]
- Saltiel, A.R.; Kahn, C.R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature 2001, 414, 799–806. [Google Scholar] [CrossRef]
- Cefalu, W.T.; Wang, Z.Q.; Zhang, X.H.; Baldor, L.C.; Russell, J.C. Oral chromium picolinate improves carbohydrate and lipid metabolism and enhances skeletal muscle Glut-4 translocation in obese, hyperinsulinemic (JCR-LA corpulent) rats. J. Nutr. 2002, 132, 1107–1114. [Google Scholar] [CrossRef]
- Sreejayan, N.; Dong, F.; Kandadi, M.R.; Yang, X.; Ren, J. Chromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice. Obesity 2008, 16, 1331–1337. [Google Scholar] [CrossRef]
- Hua, Y.; Clark, S.; Ren, J.; Nair, S. Molecular mechanisms of chromium in alleviating insulin resistance. J. Nutr. Biochem. 2012, 23, 313–319. [Google Scholar] [CrossRef] [Green Version]
- Ozcan, U. Endoplasmic Reticulum Stress Links Obesity, Insulin Action, and Type 2 Diabetes. Science 2004, 306, 457–461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huppertz, C.; Fischer, B.M.; Kim, Y.-B.; Kotani, K.; Vidal-Puig, A.; Slieker, L.J.; Sloop, K.W.; Lowell, B.B.; Kahn, B.B. Uncoupling Protein 3 (UCP3) Stimulates Glucose Uptake in Muscle Cells through a Phosphoinositide 3-Kinase-dependent Mechanism. J. Biol. Chem. 2001, 276, 12520–12529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MacLellan, J.D.; Gerrits, M.F.; Gowing, A.; Smith, P.J.S.; Wheeler, M.B.; Harper, M.-E. Physiological Increases in Uncoupling Protein 3 Augment Fatty Acid Oxidation and Decrease Reactive Oxygen Species Production Without Uncoupling Respiration in Muscle Cells. Diabetes 2005, 54, 2343–2350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, C.B.; Harper, M.-E. Uncoupling proteins: Role in insulin resistance and insulin insufficiency. Curr. Diabetes Rev. 2006, 2, 271–283. [Google Scholar] [CrossRef]
- Zhang, L.; Keung, W.; Samokhvalov, V.; Wang, W.; Lopaschuk, G.D. Role of fatty acid uptake and fatty acid β-oxidation in mediating insulin resistance in heart and skeletal muscle. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2010, 1801, 1–22. [Google Scholar] [CrossRef]
- Gao, Z.; Zhang, X.; Zuberi, A.; Hwang, D.; Quon, M.J.; Lefevre, M.; Ye, J. Inhibition of Insulin Sensitivity by Free Fatty Acids Requires Activation of Multiple Serine Kinases in 3T3-L1 Adipocytes. Mol. Endocrinol. 2004, 18, 2024–2034. [Google Scholar] [CrossRef]
- Quinn, L.S.; Anderson, B.G.; Drivdahl, R.H.; Alvarez, B.; Argilés, J.M. Overexpression of interleukin-15 induces skeletal muscle hypertrophy in vitro: Implications for treatment of muscle wasting disorders. Exp. Cell Res. 2002, 280, 55–63. [Google Scholar] [CrossRef]
- Busquets, S.; Figueras, M.T.; Meijsing, S.; Carbó, N.; Quinn, L.S.; Almendro, V.; Argilés, J.M.; López-Soriano, F.J. Interleukin-15 decreases proteolysis in skeletal muscle: A direct effect. Int. J. Mol. Med. 2005, 16, 471–476. [Google Scholar] [CrossRef]
- Quinn, L.S.; Strait-Bodey, L.; Anderson, B.G.; Argilés, J.M.; Havel, P. Interleukin-15 stimulates adiponectin secretion by 3T3-L1 adipocytes: Evidence for a skeletal muscle-to-fat signaling pathway. Cell Biol. Int. 2005, 29, 449–457. [Google Scholar] [CrossRef] [Green Version]
- Busquets, S.; Figueras, M.; Almendro, V.; López-Soriano, F.J.; Argilés, J.M. Interleukin-15 increases glucose uptake in skeletal muscle an antidiabetogenic effect of the cytokine. Biochim. Biophys. Acta (BBA) Gen. Subj. 2006, 1760, 1613–1617. [Google Scholar] [CrossRef]
- Lien, T.-F.; Wu, C.-P.; Horng, Y.-M. Chromium picolinate depressed proliferation and differentiation of 3T3-L1 preadipocytes. Nutr. Res. 2007, 27, 176–180. [Google Scholar] [CrossRef]
- Lee, C.-H.; Olson, P.; Evans, R.M. Minireview: Lipid Metabolism, Metabolic Diseases, and Peroxisome Proliferator-Activated Receptors. Endocrinology 2003, 144, 2201–2207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Freytag, S.; Paielli, D.L.; Gilbert, J.D. Ectopic expression of the CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a variety of mouse fibroblastic cells. Genes Dev. 1994, 8, 1654–1663. [Google Scholar] [CrossRef] [Green Version]
- Wu, Z.; Rosen, E.D.; Brun, R.; Hauser, S.; Adelmant, G.; Troy, A.; McKeon, C.; Darlington, G.J.; Spiegelman, B.M. Cross-Regulation of C/EBPα and PPARγ Controls the Transcriptional Pathway of Adipogenesis and Insulin Sensitivity. Mol. Cell 1999, 3, 151–158. [Google Scholar] [CrossRef]
- Ahima, R.S.; Lazar, M.A. Adipokines and the peripheral and neural control of energy balance. Mol. Endocrinol. 2008, 22, 1023–1031. [Google Scholar] [CrossRef]
- Kubota, N.; Terauchi, Y.; Yamauchi, T.; Kubota, T.; Moroi, M.; Matsui, J.; Eto, K.; Yamashita, T.; Kamon, J.; Satoh, H.; et al. Disruption of Adiponectin Causes Insulin Resistance and Neointimal Formation. J. Biol. Chem. 2002, 277, 25863–25866. [Google Scholar] [CrossRef] [Green Version]
- Díez, J.J.; Iglesias, P. The role of the novel adipocyte-derived hormone adiponectin in human disease. Eur. J. Endocrinol. 2003, 148, 293–300. [Google Scholar] [CrossRef] [Green Version]
- Kadowaki, T.; Yamauchi, T.; Kubota, N.; Hara, K.; Ueki, K.; Tobe, K. Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J. Clin. Investig. 2006, 116, 1784–1792. [Google Scholar] [CrossRef] [Green Version]
- Swarbrick, M.M.; Havel, P. Physiological, Pharmacological, and Nutritional Regulation of Circulating Adiponectin Concentrations in Humans. Metab. Syndr. Relat. Disord. 2008, 6, 87–102. [Google Scholar] [CrossRef] [Green Version]
- Yaturu, S.; Daberry, R.P.; Rains, J.; Jain, S.K. Resistin and adiponectin levels in subjects with coronary artery disease and type 2 diabetes. Cytokine 2006, 34, 219–223. [Google Scholar] [CrossRef] [PubMed]
- Jain, S.K.; Croad, J.L.; Velusamy, T.; Rains, J.L.; Bull, R. Chromium dinicocysteinate supplementation can lower blood glucose, CRP, MCP-1, ICAM-1, creatinine, apparently mediated by elevated blood vitamin C and adiponectin and inhibition of NFκB, Akt, and Glut-2 in livers of zucker diabetic fatty rats. Mol. Nutr. Food Res. 2010, 54, 1371–1380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Proctor, S.D.; Kelly, S.E.; Stanhope, K.L.; Havel, P.; Russell, J.C. Synergistic effects of conjugated linoleic acid and chromium picolinate improve vascular function and renal pathophysiology in the insulin-resistant JCR:LA-cp rat. Diabetes Obes. Metab. 2007, 9, 87–95. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Primer Sequence | Annealing Temp. (°C) | Amplicon Size (bp) | GC% |
---|---|---|---|---|---|
β-actin | DQ845171 | For 5′ACATCCGCAAGGACCTCTAC3′ Rev 5′ACATCTGCTGGAAGGTGGAC3′ | 56.5 56.9 | 210 | 55 55 |
Insulin receptor | XM003123154.3 | For 5′CAACACTGGTGGTGATGGAG3′ Rev 5′CCATCCCATCAGCAATCTCT3′ | 52.7 51.2 | 150 | 55 50 |
PI3K | NM213939 | For 5′AACCTCCAGATCTACTGCGGCAAA3′ Rev5′AGGAAGCGGTGGTCTATCAGCAAT3′ | 60.1 60.0 | 134 | 50 50 |
AKT | NM001159776 | For 5′TTCTACAACCAGGACCACGA3′ Rev 5′AATACCTGGTGTCCGTCTCG3′ | 52.4 53.4 | 268 | 50 50 |
GLUT4 | NM001128433 | For 5′GTCCAACTTCATCATCGGCA3′ Rev 5′ATGAAGAAGCCAAGCAGGAG3′ | 52.5 52.0 | 99 | 50 50 |
PPARγ | AB097926 | For 5′CTTTATGGAGCCCAAGTTCG3′ Rev 5′GAGGACTCTGGGTGGTTCAA3 | 50.8 53.0 | 200 | 50 55 |
C/EBPα | AF103944 | For 5′GCTGACCAGTGACAATGACC3′ Rev 5′GGCACCGGAATCTCCTAGTC3′ | 55.4 58.8 | 250 | 55 60 |
SREBP-1 | AY338729 | For 5′TCCTTCCACCATGAGCTCCC3′ Rev 5′CACCGACGGGTACATCTTCA3′ | 55.3 53.7 | 118 | 60 55 |
JNK1 | XM003359272.1 | For 5′ACCTGACAAGCAGTTGGATG3′ Rev 5′TAGTCATCTACAGCAGCCCA3′ | 56.0 56.5 | 238 | 50 50 |
FAS | AY183428 | For 5′TCGTGGGCTACAGCATGATA3′ Rev 5′GGAGTTAGGCTTCAGCAGGA3′ | 57.3 57.0 | 208 | 50 55 |
IL-15 | NM214390 | For 5′CAACCTGGCAGCACGTAAT3′ Rev5′CAGGAGAAAGCACTTCATCGCTGT3′ | 52.5 57.5 | 137 | 50 50 |
UCP3 | NM214049 | For 5′ACACAGATGTCCAGAGGTCA3′ Rev 5′CCAAACTCCACACCCTTCAA3′ | 58.0 57.9 | 182 | 50 50 |
SOCS3 | AY944571 | For 5′CTGGCTCTTTGATTTGGTTT3′ Rev 5′TGGACTCTGGGACCTGTATT3′ | 54.7 54.0 | 280 | 40 50 |
Adiponectin | EF601160 | For 5′CTTGCGGGTCCTTGATAAAT3′ Rev 5′CCCCTAACCTCAGTGGAAAA3′ | 50.0 50.8 | 192 | 45 50 |
Leptin | NM213840 | For 5′CCTCTGAATGGTCTGGGTTG3′ Rev 5′GGACTTGGGACCATCTGCTA3′ | 57.4 57.2 | 182 | 55 55 |
TNF-α | NM214022 | For 5′CTGCCTTGGTTCAGATGTGT3′ Rev 5′CAGCGATGTAGCGACAAGTT3′ | 52.3 53.0 | 172 | 50 50 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
T. Hung, A.; Leury, B.J.; A. Sabin, M.; Fahri, F.; DiGiacomo, K.; Lien, T.-F.; Dunshea, F.R. Nano Chromium Picolinate Improves Gene Expression Associated with Insulin Signaling in Porcine Skeletal Muscle and Adipose Tissue. Animals 2020, 10, 1685. https://doi.org/10.3390/ani10091685
T. Hung A, Leury BJ, A. Sabin M, Fahri F, DiGiacomo K, Lien T-F, Dunshea FR. Nano Chromium Picolinate Improves Gene Expression Associated with Insulin Signaling in Porcine Skeletal Muscle and Adipose Tissue. Animals. 2020; 10(9):1685. https://doi.org/10.3390/ani10091685
Chicago/Turabian StyleT. Hung, Alex, Brian J. Leury, Matthew A. Sabin, Fahri Fahri, Kristy DiGiacomo, Tu-Fa Lien, and Frank R. Dunshea. 2020. "Nano Chromium Picolinate Improves Gene Expression Associated with Insulin Signaling in Porcine Skeletal Muscle and Adipose Tissue" Animals 10, no. 9: 1685. https://doi.org/10.3390/ani10091685