Garlic Alleviates the Injurious Impact of Cyclosporine-A in Male Rats through Modulation of Fibrogenic and Steroidogenic Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Ethical Statement
2.2. Chemicals
2.3. Experimental Design
2.4. Collection of Samples
2.5. Biochemical Analysis
2.6. Sperm Count, Motility, Viability, and Morphology
2.7. Molecular Investigation
2.8. Histopathological Examination
2.9. Data Analysis
3. Results
3.1. Behavioral Pattern
3.2. Biochemical Investigations
3.3. Reproductive Hormones and Seminal Analysis
3.4. mRNA Gene Expression
3.5. Histopathologic Studies
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jaeschke, H.; Gores, G.J.; Cederbaum, A.I.; Hinson, J.A.; Pessayre, D.; Lemasters, J.J. Mechanisms of Hepatotoxicity. Toxicol. Sci. 2002, 65, 166–176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kmiec, Z. Cooperation of Liver Cells in Health and Disease: With 18 Tables; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2001; Volume 161. [Google Scholar]
- Dewidar, B.; Meyer, C.; Dooley, S.J.C. TGF-β in Hepatic Stellate Cell Activation and Liver Fibrogenesis—Updated. Cells 2019, 8, 1419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khanchandani, R. Role of omega-3 fatty acid in hepatoprotection against carbon tetra chloride induced liver injury in albino rabbits. J. Biomed. Pharm. Res. 2015, 3, 131–135. [Google Scholar]
- Rezzani, R. Cyclosporine A and adverse effects on organs: Histochemical studies. Prog. Histochem. Cytochem. 2004, 39, 85–128. [Google Scholar] [CrossRef]
- Ergüder, İ.B.; Çetin, R.; Devrim, E.; Kılıçoğlu, B.; Avcı, A.; Durak, İ. Effects of cyclosporine on oxidant/antioxidant status in rat ovary tissues: Protective role of black grape extract. Int. Immunopharmacol. 2005, 5, 1311–1315. [Google Scholar] [CrossRef]
- Srinivas, M.; Agarwala, S.; Gupta, S.D.; Das, S.N.; Jha, P.; Misro, M.M.; Mitra, D.K. Effect of cyclosporine on fertility in male rats. Pediatr. Surg. Int. 1998, 13, 388–391. [Google Scholar] [CrossRef]
- Masuda, H.; Azuma, H.; Ueno, H.; Watsuji, T.; Mori, H.; Katsuoka, Y. 1391: Ultrastructural study on Cytotoxic Effects of Cyclosporine a in Spermiogenesis in Rats. J. Urol. 2004, 171, 366. [Google Scholar] [CrossRef]
- Seethalakshmi, L.; Menon, M.; Malhotra, R.; Diamond, D. Effect of Cyclosporine a on Male Reproduction in Rats. J. Urol. 1987, 138, 991–995. [Google Scholar] [CrossRef]
- Seethalakshmi, L.; Flores, C.; Diamond, D.; Menon, M. Reversal of the Toxic Effects of Cyclosporine on Male Reproduction and Kidney Function of Rats by Simultaneous Administration of hCG + FSH. J. Urol. 1990, 144, 1489–1492. [Google Scholar] [CrossRef]
- Seethalakshmi, L.; Flores, C.; Khauli, R.; Diamond, D.; Menon, M. Evaluation of the effect of experimental cyclosporine tox-icity on male reproduction and renal function. Reversal by concomitant human chorionic gonadotropin administration. Transplantation 1990, 49, 17–19. [Google Scholar] [CrossRef]
- Iwasaki, M.; Fuse, H.; Katayama, T. The Effects of Cyclosporin Azathioprine and Mizoribine on Male Reproduction in Rats. Nihon Hinyokika Gakkai zasshi. Jpn. J. Urol. 1996, 87, 42–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Misro, M.M.; Chaki, S.P.; Srinivas, M.; Chaube, S.K. Effect of Cyclosporine on Human Sperm Motility in Vitro. Arch. Androl. 1999, 43, 215–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, L.-G.; Xu, H.-M.; Zhang, J.-R.; Song, Q.-Z.; Qi, X.-P.; Wang, X.-H. Effects of different dosages of cyclosporine A on the semen parameters of renal transplant patients. Zhonghua Xue Natl. J. Androl. 2003, 9, 679–680. [Google Scholar]
- Slkka, S.C.; Coy, D.C.; Lemmi, C.A.E.; Rajfer, J. Effect of Cyclosporine on Steroidogenesis in Rat Leydig Cells. Transplantation 1988, 46, 886–889. [Google Scholar] [CrossRef] [PubMed]
- Sikka, S.C.; Bhasin, S.; Coy, D.C.; Koyle, M.A.; Swerdloff, R.S.; Rajfer, J. Effects of cyclosporine on the hypotha-lamic-pituitary-gonadal axis in the male rat: Mechanism of action. Endocrinology 1988, 123, 1069–1074. [Google Scholar] [CrossRef]
- Türk, G.; Ateşşahin, A.; Sönmez, M.; Yüce, A.; Çeribaşi, A.O. Lycopene protects against cyclosporine A-induced testicular toxicity in rats. Theriogenology 2007, 67, 778–785. [Google Scholar] [CrossRef] [Green Version]
- Masuda, H.; Fujihira, S.; Ueno, H.; Kagawa, M.; Katsuoka, Y.; Mori, H. Ultrastructural study on cytotoxic effects of cyclo-sporine A in spermiogenesis in rats. Med. Electron Microsc. 2003, 36, 183–191. [Google Scholar] [CrossRef]
- Philip, A.T.; Gerson, B. Toxicology and adverse effects of drugs used for immunosuppression in organ transplantation. Clin. Lab. Med. 1998, 18, 755–765. [Google Scholar] [CrossRef]
- Vaya, J.; Aviram, M. Nutritional Antioxidants Mechanisms of Action, Analyses of Activities and Medical Applications. Curr. Med. Chem. Immunol. Endocr. Metab. Agents 2001, 1, 99–117. [Google Scholar] [CrossRef]
- Zelko, I.N.; Mariani, T.J.; Folz, R.J. Superoxide dismutase multigene family: A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic. Biol. Med. 2002, 33, 337–349. [Google Scholar] [CrossRef]
- Johnson, F.; Giulivi, C. Superoxide dismutases and their impact upon human health. Mol. Asp. Med. 2005, 26, 340–352. [Google Scholar] [CrossRef] [PubMed]
- Bannister, J.V.; Bannister, W.H.; Rotilio, G. Aspects of the Structure, Function, and Applications of Superoxide Dismutas. Crit. Rev. Biochem. 1987, 22, 111–180. [Google Scholar] [CrossRef] [PubMed]
- Latief, U.; Ahmad, R. Herbal remedies for liver fibrosis: A review on the mode of action of fifty herbs. J. Tradit. Complement. Med. 2018, 8, 352–360. [Google Scholar] [CrossRef] [PubMed]
- D’Cruz, S.C.; Vaithinathan, S.; Jubendradass, R.; Mathur, P.P. Effects of plants and plant products on the testis. Asian J. Androl. 2010, 12, 468–479. [Google Scholar] [CrossRef] [Green Version]
- Bayan, L.; Koulivand, P.H.; Gorji, A. Garlic: A review of potential therapeutic effects. Avicenna J. Phytomed. 2014, 4, 1–14. [Google Scholar]
- Batiha, G.E.-S.; Alkazmi, L.; Wasef, L.G.; Beshbishy, A.M.; Nugraha, A.B.; Rashwan, E.K. Syzygium aromaticum L. (Myrtaceae): Traditional Uses, Bioactive Chemical Constituents, Pharmacological and Toxicological Activities. Biomolecules 2020, 10, 202. [Google Scholar] [CrossRef] [Green Version]
- Imai, J.; Ide, N.; Nagae, S.; Moriguchi, T.; Matsuura, H.; Itakura, Y. Antioxidant and Radical Scavenging Effects of Aged Garlic Extract and its Constituents. Planta Medica 1994, 60, 417–420. [Google Scholar] [CrossRef]
- Balaha, M.; Kandeel, S.; Elwan, W. Garlic oil inhibits dextran sodium sulfate-induced ulcerative colitis in rats. Life Sci. 2016, 146, 40–51. [Google Scholar] [CrossRef]
- Hammami, I.; Amara, S.; Benahmed, M.; El May, M.V.; Mauduit, C.J.R.B. Endocrinology. Chronic crude garlic-feeding mod-ified adult male rat testicular markers: Mechanisms of action. Reprod. Biol. Endocrinol. 2009, 7, 65. [Google Scholar] [CrossRef] [Green Version]
- Sheen, L.-Y.; Chen, H.-W.; Kung, Y.-L.; Liu, C.-T.; Lii, C.-K. Effects of garlic oil and its organosulfur compounds on the activ-ities of hepatic drug-metabolizing and antioxidant enzymes in rats fed high-and low-fat diets. Nutr. Cancer 1999, 35, 160–166. [Google Scholar] [CrossRef]
- Kwak, M.K.; Kim, S.G.; Kim, N.D. Effects of garlic oil on rat hepatic P4502E1 expression. Xenobiotica 1995, 25, 1021–1029. [Google Scholar] [CrossRef] [PubMed]
- Siess, M.-H.; Le Bon, A.-M.; Canivenc-Lavier, M.-C.; Suschetet, M. Modification of hepatic drug-metabolizing enzymes in rats treated with alkyl sulfides. Cancer Lett. 1997, 120, 195–201. [Google Scholar] [CrossRef]
- Banerjee, S.K.; Maulik, M.; Manchanda, S.C.; Dinda, A.K.; Das, T.K.; Maulik, S.K. Garlic-induced alteration in rat liver and kidney morphology and associated changes in endogenous antioxidant status. Food Chem. Toxicol. 2001, 39, 793–797. [Google Scholar] [CrossRef]
- Mukherjee, D.; Banerjee, S. Learning and memory promoting effects of crude garlic extract. Indian J. Exp. Boil. 2013, 51, 1094–1100. [Google Scholar]
- Sungnoon, R.; Kanlop, N.; Chattipakorn, S.C.; Tawan, R.; Chattipakorn, N. Effects of garlic on the induction of ventricular fibrillation. Nutrition 2008, 24, 711–716. [Google Scholar] [CrossRef]
- Luo, X.; Yang, T.; Yang, C.; Zhou, J.; Liu, Y.; Huang, Y.; Shi, S. Effects of multiple oral dosing of cyclosporine on the phar-macokinetics of quercetin in rats. Int. J. Clin. Exp. Med. 2016, 9, 5880–5890. [Google Scholar]
- Wassef, R.; Cohen, Z.; Langer, B. Pharmacokinetic profiles of cyclosporine in rats. Influence of route of administration and dosage. Transplantation 1985, 40, 489–493. [Google Scholar] [CrossRef]
- Reitman, S.; Frankel, S. A Colorimetric Method for the Determination of Serum Glutamic Oxalacetic and Glutamic Pyruvic Transaminases. Am. J. Clin. Pathol. 1957, 28, 56–63. [Google Scholar] [CrossRef]
- Kind, P.R.N.; King, E.J. Estimation of Plasma Phosphatase by Determination of Hydrolysed Phenol with Amino-antipyrine. J. Clin. Pathol. 1954, 7, 322–326. [Google Scholar] [CrossRef] [Green Version]
- Bowers, L.D.; Wong, E.T. Kinetic serum creatinine assays. II. A critical evaluation and review. Clin. Chem. 1980, 26, 555–561. [Google Scholar] [CrossRef]
- Allain, C.C.; Poon, L.S.; Chan, C.S.G.; Richmond, W.; Fu, P.C. Enzymatic Determination of Total Serum Cholesterol. Clin. Chem. 1974, 20, 470–475. [Google Scholar] [CrossRef] [PubMed]
- Burstein, M.; Scholnick, H.R.; Morfin, R. Rapid method for the isolation of lipoproteins from human serum by precipitation with polyanions. J. Lipid Res. 1970, 11, 583–595. [Google Scholar]
- Lopes-Virella, M.F.L.; Stone, P.G.; Colwell, J.A. Serum high density lipoprotein in diabetic patients. Diabetol. 1977, 13, 285–291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the Concentration of Low-Density Lipoprotein Cholesterol in Plasma, Without Use of the Preparative Ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [CrossRef] [PubMed]
- Dunn, J.F.; Nisula, B.C.; Rodbard, D. Transport of steroid hormones: Binding of 21 endogenous steroids to both testos-terone-binding globulin and corticosteroid-binding globulin in human plasma. J. Clin. Endocrinol. Me-Tabolism 1981, 53, 58–68. [Google Scholar] [CrossRef] [PubMed]
- Abuid, J.; Klein, A.; Foley, T., Jr.; Larsen, P. Total and free triiodothyronine and thyroxine in early infancy. J. Clin. Endocrinol. Metab. 1974, 39, 263–268. [Google Scholar] [CrossRef] [PubMed]
- Yokoi, K.; Uthus, E.O.; Nielsen, F.H. Nickel Deficiency Diminishes Sperm Quantity and Movement in Rats. Biol. Trace Element Res. 2003, 93, 141–154. [Google Scholar] [CrossRef]
- Sönmez, M.; Türk, G.; Yüce, A. The effect of ascorbic acid supplementation on sperm quality, lipid peroxidation and testos-terone levels of male Wistar rats. Theriogenology 2005, 63, 2063–2072. [Google Scholar] [CrossRef] [Green Version]
- Bearden, H.J.; Fuquay, J.W. Applied Animal Reproduction; Reston Publishing Company, Inc.: Upper Saddle River, NJ, USA, 1984. [Google Scholar]
- Bancroft, J.D.; Cook, H.C. Manual of Histological Techniques and Their Diagnostic Application; Churchill Livingstone: London, UK, 1994. [Google Scholar]
- Ponticelli, C. Cyclosporine: From Renal Transplantation to Autoimmune Diseases. Ann. N. Y. Acad. Sci. 2005, 1051, 551–558. [Google Scholar] [CrossRef]
- Kuruş, M.; Eşrefoğlu, M.; Sogutlu, G.; Atasever, A. Melatonin Prevents Cyclosporine-Induced Hepatotoxicity in Rats. Med Princ. Pr. 2009, 18, 407–410. [Google Scholar] [CrossRef]
- Larrey, D. Drug-induced liver diseases. J. Hepatol. 2000, 32, 77–88. [Google Scholar] [CrossRef]
- Gulmez, S.E.; Larrey, D.; Pageaux, G.-P.; Lignot, S.; Lassalle, R.; Jové, J.; Gatta, A.; McCormick, P.A.; Metselaar, H.J.; Monteiro, E.; et al. Transplantation for Acute Liver Failure in Patients Exposed to NSAIDs or Paracetamol (Acetaminophen). Drug Saf. 2013, 36, 135–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amagase, H.; Petesch, B.L.; Matsuura, H.; Kasuga, S.; Itakura, Y. Intake of Garlic and Its Bioactive Components. J. Nutr. 2001, 131, 955S–962S. [Google Scholar] [CrossRef] [PubMed]
- Borek, C. Antioxidant Health Effects of Aged Garlic Extract. J. Nutr. 2001, 131, 1010S–1015S. [Google Scholar] [CrossRef] [Green Version]
- Sivakrishnan, S.; Kottaimuthu, A. Hepatoprotective activity of ethanolic extract of aerial parts of Albizia procera Roxb (Benth.) against paracetamol induced liver toxicity on Wistar rats. Int. J. Pharm. Pharm. Sci. 2014, 6, 233–238. [Google Scholar]
- El Okle, O.S.; El Euony, O.I.; Khafaga, A.F.; Lebda, M.A. Thiamethoxam induced hepatotoxicity and pro-carcinogenicity in rabbits via motivation of oxidative stress, inflammation, and anti-apoptotic pathway. Environ. Sci. Pollut. Res. 2017, 25, 4678–4689. [Google Scholar] [CrossRef]
- Aladaileh, S.H.; Khafaga, A.F.; Abd El-Hack, M.E.; Al-Gabri, N.A.; Abukhalil, M.H.; Alfwuaires, M.A.; Bin-Jumah, M.; Al-kahtani, S.; Abdel-Daim, M.M.; Aleya, L. Spirulina platensis ameliorates the sub chronic toxicities of lead in rabbits via an-ti-oxidative, anti-inflammatory, and immune stimulatory properties. Sci. Total. Environ. 2020, 701, 134879. [Google Scholar] [CrossRef]
- Mohsenikia, M.; Hajipour, B.; Somi, M.H.; Khodadadi, A.; Noori, M. Prophylactic Effect of Vitamin C on Cyclosporine A-induced Liver Toxicity. Thrita 2011, 1, 24–26. [Google Scholar] [CrossRef] [Green Version]
- Ademiluyi, A.O.; Oboh, G.; Owoloye, T.R.; Agbebi, O.J.; Omonkhua, A.A. Modulatory effects of dietary inclusion of garlic (Allium sativum) on gentamycin–induced hepatotoxicity and oxidative stress in rats. Asian Pac. J. Trop. Biomed. 2013, 3, 470–475. [Google Scholar] [CrossRef] [Green Version]
- Galán, A.; Fernández, E.; Felipe, A.; Morón, D.; Muñoz, M.; Jiménez, R. Cyclosporine A toxicity and effect of the S-adenosylmethionine. Ars Pharm. 1999, 40, 151–163. [Google Scholar]
- Mirunalini, S.; Arulmozhi, V.; Arulmozhi, T. Curative effect of garlic on alcoholic liver diseased patients. Jordan J. Biol. Sci. 2010, 147, 1–5. [Google Scholar]
- Fahmy, S.R.; Hamdi, S.A. Antioxidant effect of the Egyptian freshwater Procambarus clarkii extract in rat liver and erythro-cytes. Afr. J. Pharm. Pharmacol. 2011, 5, 776–785. [Google Scholar] [CrossRef] [Green Version]
- Hulzebos, C.V.; Bijleveld, C.M.; Stellaard, F.; Kuipers, F.; Fidler, V.; Slooff, M.J.; Peeters, P.M.; Sauer, P.J.; Verkade, H.J. Cy-closporine A–Induced reduction of bile salt synthesis associated with increased plasma lipids in children after liver trans-plantation. Liver Transplant. 2004, 10, 872–880. [Google Scholar] [CrossRef] [PubMed]
- El-Kott, A.F. Amelioration of Nitrateinduced Hepatotoxicity. J. Med. Sci. 2012, 12, 85–91. [Google Scholar]
- Sobolová, L.; Skottová, N.; Vecera, R.; Urbánek, K. Effect of silymarin and its polyphenolic fraction on cholesterol absorption in rats. Pharmacol. Res. 2006, 53, 104–112. [Google Scholar] [CrossRef] [PubMed]
- Zouboulis, C.C.; Degitz, K. Androgen action on human skin—from basic research to clinical significance. Exp. Dermatol. 2004, 13, 5–10. [Google Scholar] [CrossRef]
- Rajfer, J.; Sikka, S.C.; Lemmi, C.; Koyle, M.A. Cyclosporine Inhibits Testosterone Biosynthesis in the Rat Testis*. Endocrinology 1987, 121, 586–589. [Google Scholar] [CrossRef]
- Obidike, I.R.; Ezema, W.S.; Aka, L.O.; Omoja, V.U.; Odo, R.I.; Onuoha, E.O.; Obodoechi, L.O. Effects of aqueous garlic (Allium sativum) extract on testicular morphology and function in lead nitrate (Pb(NO3)2)-treated albino rats. Comp. Haematol. Int. 2012, 22, 685–690. [Google Scholar] [CrossRef]
- Hammami, I.; El May, M. Impact of garlic feeding (A llium sativum) on male fertility. Andrologia 2013, 45, 217–224. [Google Scholar] [CrossRef]
- Prasad, A.S.; Mantzoros, C.S.; Beck, F.W.; Hess, J.W.; Brewer, G.J. Zinc status and serum testosterone levels of healthy adults. Nutrition 1996, 12, 344–348. [Google Scholar] [CrossRef]
- Netter, A.; Nahoul, K.; Hartoma, R. Effect of Zinc Administration on Plasma Testosterone, Dihydrotestosterone, and Sperm Count. Arch. Androl. 1981, 7, 69–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rais-Jalali, G.; Roozbeh, J.; Mohammadzadeh, A.; Sharifian, M.; Sagheb, M.M.; Jahromi, A.H.; Shabani, S.; Ghaffarpasand, F.; Afshariani, R. Impact of oral zinc therapy on the level of sex hormones in male patients on hemodialysis. Ren. Fail. 2010, 32, 417–419. [Google Scholar] [CrossRef] [PubMed]
- Costello, L.C.; Liu, Y.; Zou, J.; Franklin, R.B. Evidence for a Zinc Uptake Transporter in Human Prostate Cancer Cells Which Is Regulated by Prolactin and Testosterone. J. Biol. Chem. 1999, 274, 17499–17504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsuda, S.; Koyasu, S. Mechanisms of action of cyclosporine. Immunopharmacol. 2000, 47, 119–125. [Google Scholar] [CrossRef]
- Oettgen, H.C.; Terhorst, C.; Cantley, L.C.; Rosoff, P.M. Stimulation of the T3-T cell receptor complex induces a mem-brane-potential-sensitive calcium influx. Cells 1985, 40, 583–590. [Google Scholar] [CrossRef]
- Tavakoli, P.; Ahmadi, R.; Amin, N. The Protective Effects of Garlic on Thyroid Function in Amphetamine Receiving Rats. Int. J. Adv. Chem. Engg. Biol. Sci. (IJACEBS) 2015, 2, 43–45. [Google Scholar]
- Banerjee, S.K.; Mukherjee, P.K.; Maulik, S.K. Garlic as an antioxidant: The good, the bad and the ugly. Phytotherapy Res Int. J. Devoted Pharmacol. Toxicol. Eval. Nat. Prod. Deriv. 2003, 17, 97–106. [Google Scholar] [CrossRef]
- L’Azou, B.; Medina, J.; Frieauff, W.; Cordier, A.; Cambar, J.; Wolf, A. In vitro models to study mechanisms involved in cy-closporine A-mediated glomerular contraction. Arch. Toxicol. 1999, 73, 337–345. [Google Scholar] [CrossRef]
- Ekeleme-Egedigwe, C.A.; Famurewa, A.C.; David, E.E.; Eleazu, C.O.; Egedigwe, U.O. Antioxidant potential of garlic oil sup-plementation prevents cyclophosphamide-induced oxidative testicular damage and endocrine depletion in rats. J. Nutr. Intermed. Metab. 2019, 18, 100109. [Google Scholar] [CrossRef]
- Tirkey, N.; Kaur, G.; Vij, G.; Chopra, K. Curcumin, a diferuloylmethane, attenuates cyclosporine-induced renal dysfunction and oxidative stress in rat kidneys. BMC Pharmacol. 2005, 5, 15. [Google Scholar]
- Banerjee, S.K.; Dinda, A.K.; Manchanda, S.C.; Maulik, S.K. Chronic garlic administration protects rat heart against oxidative stress induced by ischemic reperfusion injury. BMC Pharmacol. 2002, 2, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balamurugan, M.; Parthasarathi, K.; Ranganathan, L.S.; Cooper, E.L. Hypothetical mode of action of earthworm extract with hepatoprotective and antioxidant properties. J. Zhejiang Univ. Sci. B 2008, 9, 141–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Argenio, G.; Mazzone, G.; Ribecco, M.T.; Lembo, V.; Vitaglione, P.; Guarino, M.; Morisco, F.; Napolitano, M.; Fogliano, V.; Caporaso, N. Garlic extract attenuating rat liver fibrosis by inhibiting TGF-β. Clin. Nutr. 2013, 32, 252–258. [Google Scholar] [CrossRef] [PubMed]
- Faponle, A.; Osonuga, I.; Ezima, E.; Adenowo, T.; Adelegan, A. Effect of aqueous extract of Allium sativum (Garlic) on fertil-ity in male Wistar rats. Ann. Health Res. 2020, 6, 100–107. [Google Scholar]
Gene Symbol | Accession No. | Sequence (5′→3′) |
---|---|---|
SOD-1 | NM_017050.1 | F: TTTTGCTCTCCCAGGTTCCG |
R: CCCATGCTCGCCTTCAGTTA | ||
TGF-1β | NM_021578.2 | F: GGCCAGATCCTGTCCAAACT |
R: CGTGTTGCTCCACAGTTGAC | ||
Txn-1 | NM_053800.3 | F: GGTAGTGGACTTCTCTGCCAC |
R: AGGTCGGCATGCATTTGACT | ||
Col1a1 | NM_053304.1 | F: TTTCCCCCAACCCTGGAAAC |
R: CAGTGGGCAGAAAGGGACTT | ||
STAR | NM_031558 | F: CACACTTTGGGGAGATGCCT |
R: GAACTTCCAATGGCGTGCAG | ||
CYP17A1 | NM_012753.2 | F: ACTGAGGGTATCGTGGATGC |
R: TCGAACTTCTCCCTGCACTT | ||
3β-HSD | M38178 | F: CCCATACAGCAAAAGGATGG |
R: GCCGCAAGTATCATGACAGA | ||
β-actin | EF156276.1 | F: TCTTCCAGCCTTCCTTCCTG |
R: CACACAGAGTACTTGCGCTC |
Treated Groups | ALT (IU/L) | AST (IU/L) | ALP (IU/L) | Albumin (g/dL) | Total Protein (g/dL) |
---|---|---|---|---|---|
CTR | 65.77 ± 3.28 c | 151.52 ± 12.37 c | 120.50 ± 7.18 c | 4.02 ± 0.40 a | 7.05 ± 0.43 a |
PAL | 67.40 ± 1.89 c | 152.58 ± 9.96 c | 121.48 ± 6.46 c | 3.97 ± 0.15 a | 6.85 ± 0.34 a |
GAR | 68.50 ± 1.93 c | 154.42 ± 9.36 c | 121.18 ± 9.13 c | 4.11 ± 0.57 a | 6.94 ± 0.41 a |
CsA | 98.52 ± 4.63 a | 205.00 ± 14.52 a | 182.28 ± 7.18 a | 3.24 ± 0.29 d | 4.59 ± 0.73 b |
GAR + CsA | 73.70 ± 1.50 b | 160.62 ± 8.85 b | 163.28 ± 12.90 b | 3.38 ± 0.30 c | 5.04 ± 0.60 b |
Treated Groups | Total Cholesterol (mg/dL) | Triglycerides (mg/dL) | HDL-c (mg/dL) | LDL-c (mg/dL) |
---|---|---|---|---|
CTR | 70.64 ± 6.98 c | 62.41 ± 4.206 c | 49.48 ± 5.37 a | 8.50 ± 2.95 d |
PAL | 71.77 ± 6.77 c | 65.05 ± 2.69 c | 48.91 ± 4.02 a | 9.67 ± 3.23 d |
GAR | 72.07 ± 3.38 c | 67.79 ± 2.95 bc | 46.51 ± 5.23 ab | 13.00 ± 6.41 cd |
CsA | 97.51 ± 12.09 a | 88.28 ± 11.64 a | 35.06 ± 6.22 c | 44.86 ± 3.66 a |
GAR + CsA | 85.79 ± 4.94 b | 79.73 ± 2.36 b | 41.77 ± 4.98 bc | 28.11 ± 5.31 b |
Treated Groups | Testosterone (ng/dL) | T3 (ng/dL) | T4 (µg/dL) |
---|---|---|---|
CTR | 2.17 ± 0.09 a | 2.73 ± 0.03 a | 16.77 ± 0.819 a |
PAL | 2.14 ± 0.07 a | 2.52 ± 0.07 ab | 16.35 ± 0.61 ab |
GAR | 1.95 ± 0.06 ab | 2.58 ± 0.13 ab | 16.49 ± 0.50 ab |
CsA | 0.72 ± 0.04 c | 1.46 ± 0.06 d | 12.53 ± 0.15 d |
GAR+CsA | 1.41 ± 0.11 b | 1.80 ± 0.10 c | 14.56 ± 0.27 c |
Groups/Parameters | Control | PAL | GAR | CsA | GAR + CsA |
---|---|---|---|---|---|
Sperm cell count (× 106/mL) | 151.10 ± 2.51 a | 150.50 ± 3.52 a | 153.50 ± 4.50 a | 102.2 ± 4.49 c | 143.50 ± 3.51 ab |
Sperm motility% | 92.00 ± 2.22 a | 91.00 ± 2.14 a | 92.00 ± 2.07 a | 72.10 ± 3.92 c | 85.00 ± 1.97 b |
Live spermatozoa% | 94.10 ± 3.22 a | 92.10 ± 1.74 a | 93.00 ± 3.67 a | 76.12 ± 2.92 c | 87.12 ± 3.02 b |
Abnormality% | 7.10 ± 0.41 c | 7.41 ± 0.88 c | 7.33 ± 0.33 c | 19.40 ± 0.71 a | 10.03 ± 0.98 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shukry, M.; Alotaibi, S.S.; Albogami, S.M.; Fathallah, N.; Farrag, F.; Dawood, M.A.O.; Gewaily, M.S. Garlic Alleviates the Injurious Impact of Cyclosporine-A in Male Rats through Modulation of Fibrogenic and Steroidogenic Genes. Animals 2021, 11, 64. https://doi.org/10.3390/ani11010064
Shukry M, Alotaibi SS, Albogami SM, Fathallah N, Farrag F, Dawood MAO, Gewaily MS. Garlic Alleviates the Injurious Impact of Cyclosporine-A in Male Rats through Modulation of Fibrogenic and Steroidogenic Genes. Animals. 2021; 11(1):64. https://doi.org/10.3390/ani11010064
Chicago/Turabian StyleShukry, Mustafa, Saqer S. Alotaibi, Sarah M. Albogami, Nora Fathallah, Foad Farrag, Mahmoud A. O. Dawood, and Mahmoud S. Gewaily. 2021. "Garlic Alleviates the Injurious Impact of Cyclosporine-A in Male Rats through Modulation of Fibrogenic and Steroidogenic Genes" Animals 11, no. 1: 64. https://doi.org/10.3390/ani11010064