Detection of Novel Variations Related to Litter Size in BMP15 Gene of Luzhong Mutton Sheep (Ovis aries)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and DNA Extraction
2.2. Full-Length Sequencing and Polymorphism Detection of the BMP15 ORF Sequence
2.3. Statistical Analysis
3. Results
3.1. Detection of BMP15 Polymorphism in Luzhong Sheep
3.2. Population Genetic Analysis of SNPs in BMP15 Gene in Luzhong Sheep
3.3. Association of Polymorphisms in BMP15 with Litter Size in Luzhong Sheep
3.4. Geographic Distribution of Allele Frequency of Two Variations in the BMP15 Gene
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Galloway, S.M.; Gregan, S.M.; Wilson, T.; McNatty, K.P.; Juengel, J.L.; Ritvos, O.; Davis, G.H. Bmp15 mutations and ovarian function. Mol. Cell. Endocrinol. 2002, 191, 15–18. [Google Scholar] [CrossRef]
- Taheri, M.M.; Saki, G.; Nikbakht, R.; Eftekhari, A.R.M. Bone morphogenetic protein 15 induces differentiation of mesenchymal stem cells derived from human follicular fluid to oocyte-like cell. Cell Biol. Int. 2021, 45, 127–139. [Google Scholar] [CrossRef]
- Christoforou, E.R.; Pitman, J.L. Intrafollicular growth differentiation factor 9: Bone morphogenetic 15 ratio determines litter size in mammals†. Biol. Reprod. 2019, 100, 1333–1343. [Google Scholar] [CrossRef]
- Galloway, S.M.; McNatty, K.P.; Cambridge, L.M.; Laitinen, M.P.; Juengel, J.L.; Jokiranta, T.S.; McLaren, R.J.; Luiro, K.; Dodds, K.G.; Montgomery, G.W.; et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 2000, 25, 279–283. [Google Scholar] [CrossRef] [PubMed]
- Hanrahan, J.P.; Gregan, S.M.; Mulsant, P.; Mullen, M.; Davis, G.H.; Powell, R.; Galloway, S.M. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol. Reprod. 2004, 70, 900–909. [Google Scholar] [CrossRef] [PubMed]
- Bodin, L.; Di Pasquale, E.; Fabre, S.; Bontoux, M.; Monget, P.; Persani, L.; Mulsant, P. A novel mutation in the bone morphogenetic protein 15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology 2007, 148, 393–400. [Google Scholar] [CrossRef]
- Martinez-Royo, A.; Jurado, J.J.; Smulders, J.P.; Martí, J.I.; Alabart, J.L.; Roche, A.; Fantova, E.; Bodin, L.; Mulsant, P.; Serrano, M.; et al. A deletion in the bone morphogenetic protein 15 gene causes sterility and increased prolificacy in Rasa Aragonesa sheep. Anim. Genet. 2008, 39, 294–297. [Google Scholar] [CrossRef] [PubMed]
- Monteagudo, L.V.; Ponz, R.; Tejedor, M.T.; Laviña, A.; Sierra, I. A 17 bp deletion in the Bone Morphogenetic Protein 15 (BMP15) gene is associated to increased prolificacy in the Rasa Aragonesa sheep breed. Anim. Reprod. Sci. 2009, 110, 139–146. [Google Scholar] [CrossRef] [PubMed]
- Foroughinia, G.; Fazileh, A.; Eghbalsaied, S. Expression of genes involved in BMP and estrogen signaling and AMPK production can be important factors affecting total number of antral follicles in ewes. Theriogenology 2017, 91, 36–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peluso, C.; Goldman, C.; Cavalcanti, V.; Gastaldo, G.; Trevisan, C.M.; Christofolini, D.M.; Barbosa, C.P.; Bianco, B. Use of Bone Morphogenetic Protein 15 Polymorphisms to Predict Ovarian Stimulation Outcomes in Infertile Brazilian Women. Genet. Test. Mol. Biomark. 2017, 21, 328–333. [Google Scholar] [CrossRef]
- Juengel, J.L.; Davis, G.H.; McNatty, K.P. Using sheep lines with mutations in single genes to better understand ovarian function. Reprod. Camb. Engl. 2013, 146, R111–R123. [Google Scholar] [CrossRef] [PubMed]
- Demars, J.; Fabre, S.; Sarry, J.; Rossetti, R.; Gilbert, H.; Persani, L.; Tosser-Klopp, G.; Mulsant, P.; Nowak, Z.; Drobik, W.; et al. Genome-wide association studies identify two novel BMP15 mutations responsible for an atypical hyperprolificacy phenotype in sheep. PLoS Genet. 2013, 9, e1003482. [Google Scholar] [CrossRef]
- Lassoued, N.; Benkhlil, Z.; Woloszyn, F.; Rejeb, A.; Aouina, M.; Rekik, M.; Fabre, S.; Bedhiaf-Romdhani, S. FecXBar a Novel BMP15 mutation responsible for prolificacy and female sterility in Tunisian Barbarine Sheep. BMC Genet. 2017, 18, 43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chu, M.X.; Liu, Z.H.; Jiao, C.L.; He, Y.Q.; Fang, L.; Ye, S.C.; Chen, G.H.; Wang, J.Y. Mutations in BMPR-IB and BMP-15 genes are associated with litter size in Small Tailed Han sheep (Ovis aries). J. Anim. Sci. 2007, 85, 598–603. [Google Scholar] [CrossRef] [PubMed]
- Guan, F.; Liu, S.R.; Shi, G.Q.; Yang, L.G. Polymorphism of FecB gene in nine sheep breeds or strains and its effects on litter size, lamb growth and development. Anim. Reprod. Sci. 2007, 99, 44–52. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.K.; Arora, A.L.; Kumar, S.; Prince, L.L. Studies on effect of Booroola (FecB) genotype on lifetime ewes’ productivity effi ciency, litter size and number of weaned lambs in Garole × Malpura sheep. Anim. Reprod. Sci. 2009, 113, 293–298. [Google Scholar] [CrossRef] [PubMed]
- El-Seedy, A.S.; Hashem, N.M.; El-Azrak, K.M.; Nour El-Din, A.; Ramadan, T.A.; Taha, T.A.; Salem, M.H. Genetic screening of FecB, FecXG and FecXI mutations and their linkage with litter size in Barki and Rahmani sheep breeds. Reprod. Domest. Anim. 2017, 52, 1133–1137. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Mishra, A.K.; Kolte, A.P.; Arora, A.L.; Singh, D.; Singh, V.K. Effects of the Booroola (FecB) genotypes on growth performance, ewe’s productivity efficiency and litter size in Garole × Malpura sheep. Anim. Reprod. Sci. 2008, 105, 319–331. [Google Scholar] [CrossRef] [PubMed]
- Souza, C.J.; MacDougall, C.; MacDougall, C.; Campbell, B.K.; McNeilly, A.S.; Baird, D.T. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endocrinol. 2001, 169, R1–R6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Liu, S.; Li, F.; Pan, X.; Li, C.; Zhang, X.; Ma, Y.; La, Y.; Xi, R.; Li, T. Polymorphisms of the Ovine BMPR-IB, BMP-15 and FSHR and Their Associations with Litter Size in Two Chinese Indigenous Sheep Breeds. Int. J. Mol. Sci. 2015, 18, 11385–11397. [Google Scholar] [CrossRef] [Green Version]
- Cao, J.; Wei, C.; Zhang, S.; Capellini, T.D.; Zhang, L.; Zhao, F.; Li, L.; Zhong, T.; Wang, L.; Du, L.; et al. Screening of reproduction-related single-nucleotide variations from MeDIP-seq data in sheep. Mol. Reprod. Dev. 2016, 83, 958–967. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; La, Y.; Zhou, X.; Zhang, X.; Li, F.; Liu, B. The genetic polymorphisms of TGFβ superfamily genes are associated with litter size in a Chinese indigenous sheep breed (Hu sheep). Anim. Reprod. Sci. 2018, 189, 19–29. [Google Scholar] [CrossRef]
- Wang, F.; Chu, M.; Pan, L.; Wang, X.; He, X.; Zhang, R.; Tao, L.; La, Y.; Ma, L.; Di, R. Polymorphism Detection of GDF9 Gene and Its Association with Litter Size in Luzhong Mutton Sheep (Ovis aries). Animals 2021, 11, 571. [Google Scholar] [CrossRef] [PubMed]
- Saleh, A.; Hammoud, M.; Dabour, N.; Hafez, E.; Sharaby, M. BMPR-1B, BMP-15 and GDF-9 genes structure and their relationship with litter size in six sheep breeds reared in Egypt. BMC Res. Notes 2020, 13, 215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dolebo, A.T.; Khayatzadeh, N.; Melesse, A.; Wragg, D.; Rekik, M.; Haile, A.; Rischkowsky, B.; Rothschild, M.F.; Mwacharo, J.M. Genome-wide scans identify known and novel regions associated with prolificacy and reproduction traits in a sub-Saharan African indigenous sheep (Ovis aries). Mamm. Genome 2019, 30, 339–352. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, G.H.; Balakrishnan, L.; Ross, I.K.; Wilson, T.; Galloway, S.M.; Lumsden, B.M.; Hanrahan, J.P.; Mullen, M.; Mao, X.Z.; Wang, G.L.; et al. Investigation of the Booroola (FecB) and Inverdale (FecXI) mutations in 21 prolific breeds and strains of sheep sampled in 13 countries. Anim. Reprod. Sci. 2006, 92, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Chu, M.; Jia, L.; Zhang, Y.; Jin, M.; Chen, H.; Fang, L.; Di, R.; Cao, G.; Feng, T.; Tang, Q.; et al. Polymorphisms of coding region of BMPRIB gene and their relationship with litter size in sheep. Mol. Biol. Rep. 2011, 38, 4071–4076. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, T.; Geng, C.X.; Lang, X.Z.; Chu, M.X.; Cao, G.L.; Di, R.; Fang, L.; Chen, H.Q.; Liu, X.L.; Li, N. Polymorphisms of caprine GDF9 gene and their association with litter size in Jining Grey goats. Mol. Biol. Rep. 2011, 38, 5189–5197. [Google Scholar] [CrossRef]
- Najafabadi, H.A.; Khansefid, M.; Mahmoud, G.G.; Haruna, I.L.; Zhou, H.; Hickford, J.G.H. Identification of sequence variation in the oocyte-derived bone morphogenetic protein 15 (BMP15) gene (BMP15) associated with litter size in New Zealand sheep (Ovis aries) breeds. Mol. Biol. Rep. 2021, 48, 6335–6342. [Google Scholar] [CrossRef] [PubMed]
- Niu, Z.G.; Qin, J.; Jiang, Y.; Ding, X.D.; Ding, Y.G.; Tang, S.; Shi, H.C. The Identification of Mutation in BMP15 Gene Associated with Litter Size in Xinjiang Cele Black Sheep. Animals 2021, 11, 668. [Google Scholar] [CrossRef] [PubMed]
- Calvo, J.H.; Chantepie, L.; Serrano, M.; Sarto, M.P.; Iguacel, L.P.; Jiménez, M.; Alabart, J.L.; Folch, J.; Fabre, S.; Lahoz, B. A new allele in the BMP15 gene (FecXRA) that affects prolificacy co-segregates with FecXR and FecXGR in Rasa aragonesa sheep. Theriogenology 2020, 144, 107–111. [Google Scholar] [CrossRef]
- Nadri, S.; Zamani, P.; Ahmadi, A. Novel Mutation in Exon 1 of the BMP15 Gene and its Association with Reproduction Traits in Sheep. Anim. Biotechnol. 2016, 27, 256–261. [Google Scholar] [CrossRef]
- Chantepie, L.; Bodin, L.; Sarry, J.; Woloszyn, F.; Plisson-Petit, F.; Ruesche, J.; Drouilhet, L.; Fabre, S. Genome-Wide Identification of a Regulatory Mutation in BMP15 Controlling Prolificacy in Sheep. Front. Genet. 2020, 11, 585. [Google Scholar] [CrossRef] [PubMed]
- Wioleta, D.; Elżbieta, M.; Zuzanna, N.; Urszula, K.; Mirosław, K. Frequency of BMP15 and GDF9 mutations increasing litter size and their phenotypic effects in Olkuska sheep population. Ann. Anim. Sci. 2021, 21, 89–108. [Google Scholar] [CrossRef]
- Kona, S.S.; Praveen Chakravarthi, V.; Siva Kumar, A.V.; Srividya, D.; Padmaja, K.; Rao, V.H. Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro. Theriogenology 2016, 85, 315–322. [Google Scholar] [CrossRef]
- Peng, J.; Li, Q.; Wigglesworth, K.; Rangarajan, A.; Kattamuri, C.; Peterson, R.T.; Eppig, J.J.; Thompson, T.B.; Matzuk, M.M. Growth differentiation factor 9:bone morphogenetic protein 15 heterodimers are potent regulators of ovarian functions. Proc. Natl. Acad. Sci. USA 2013, 110, E776–E785. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, M.N.; Zhang, K.; Xu, T.M. The role of BMP15 and GDF9 in the pathogenesis of primary ovarian insufficiency. Hum. Fertil. Camb. Engl. 2019, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Davis, G.H.; Dodds, K.G.; Wheeler, R.; Jay, N.P. Evidence that an imprinted gene on the X chromosome increases ovulation rate in sheep. Biol. Reprod. 2001, 64, 216–221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, G.H.; Dodds, K.G.; Bruce, G.D. Combined effect of the Inverdale and Booroola prolificacy genes on ovulation rate in sheep. Proc. Assoc. Adv. Anim. Breed. Genet. 1999, 13, 74–77. [Google Scholar]
- Stocker, W.A.; Walton, K.L.; Richani, D.; Chan, K.L.; Beilby, K.H.; Finger, B.J.; Green, M.P.; Gilchrist, R.B.; Harrison, C.A. A variant of human growth differentiation factor-9 that improves oocyte developmental competence. J. Biol. Chem. 2020, 295, 7981–7991. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′–3′) | Annealing Temperature/°C | Amplified Fragment/bp |
---|---|---|---|
BMP15-F1 | CTGCCTGCCAGCCTTTCAT | 60 | 718 |
BMP15-R1 | ACATCAATGAGTTGCCCTG | ||
BMP15-F2 | GGGAAAACCGCACCATTG | 60 | 843 |
BMP15-R2 | CAGAAGCAACTATGAGGGAA | ||
BMP15-F3 | GGCTGTTTGTCTTGTTTTAT | 60 | 892 |
BMP15-R3 | GAAGATGTGGGTTTGAT | ||
BMP15-F4 | AGGTGTGTGTGCGAACTCAG | 60 | 488 |
BMP15-R4 | CATTTGCTGTGCTGTACCAC | ||
BMP15-F5 | CATCTTCCGTGTTTCCT | 60 | 703 |
BMP15-R5 | CCTATTTCATTCTTTGGT | ||
BMP15-F6 | AGGCATTGTTCTAGGTGTTGG | 60 | 1084 |
BMP15-R6 | CCTTTTACCTGCTGGTAAACAC | ||
BMP15-F7 | TTCCTGGCCCTGATCCTTAG | 60 | 1021 |
BMP15-R7 | CACTGTTTCCCCATCTATTTGC | ||
BMP15-F8 | GTTCATGGATTCAGTGGAGAAGG | 60 | 1179 |
BMP15-R8 | CCAAACTGTGATGCTGACACC | ||
BMP15-F9 | GTTTGGGTGAACTCCAGGAGT | 60 | 1061 |
BMP15-R9 | CATTTTGCAGACGAGGAAACT | ||
BMP15-F10 | TGTATTTGAGGTGTTTTTCTCCG | 60 | 1381 |
BMP15-R10 | AAGTACAATGCTGAAGGCAAGG |
Region | Location in ENSOART000 00010201.1 | Genomic Location (ChrX: Oar_v4.0) | Wild | Mutant | Amino Acid Change | Variations in Ensembl Database |
---|---|---|---|---|---|---|
Exon 1 | c.58_60del | 50986688–50986686 | CTT | del | Leu (L)11 del | Yes (rs592773279) |
Exon 2 | c.782T>C | 50980656 | T | C | Leu (L) 252 Pro (P) | Yes (rs55628000) |
c.747G>T | 50980691 | G | T | Gln (Q) 240 His (H) | No | |
Intron 1 | c.353-1303T>G | 50982388 | T | G | - | No |
c.353-1453T>C | 50982538 | T | C | - | Yes (rs403715147) | |
c.353-2036T>A | 50983121 | T | A | - | No | |
c.352+1937T>C | 50984457 | T | C | - | No | |
c.352+1778C>T | 50984616 | C | T | - | No | |
c.352+1323C>T | 50985071 | C | T | - | Yes (rs420350765) | |
c.352+1232T>C | 50985162 | T | C | - | Yes (rs400940002) | |
c.352+1165A>G | 50985229 | A | G | - | No | |
c.352+419G>A | 50985975 | G | A | - | Yes (rs412881200) | |
c.352+342C>A | 50986052 | C | A | - | Yes (rs426251007) |
Variations | Genotype Frequency | Allele Frequency | PIC | He | Ne | Chi-Square Test (p-Value) | |||
---|---|---|---|---|---|---|---|---|---|
c.352+342C>A | CC | AC | AA | C | A | ||||
0.844(130) | 0.156(24) | 0.000(0) | 0.922 | 0.078 | 0.133 | 0.144 | 1.168 | 0.294 | |
c.352+419G>A | GG | AG | AA | G | A | ||||
0.974(150) | 0.026(4) | 0.000(0) | 0.987 | 0.013 | 0.025 | 0.026 | 1.026 | 0.870 | |
c.352+1165A>G | AA | AG | GG | A | G | ||||
0.935(144) | 0.065(10) | 0.000(0) | 0.967 | 0.033 | 0.061 | 0.063 | 1.067 | 0.677 | |
c.352+1232T>C | CC | CT | TT | C | T | ||||
0.234(36) | 0.532(82) | 0.234(36) | 0.500 | 0.500 | 0.375 | 0.500 | 2.000 | 0.420 | |
c.352+1323C>T | CC | CT | TT | C | T | ||||
0.299(46) | 0.558(86) | 0.143(22) | 0.578 | 0.422 | 0.369 | 0.488 | 1.952 | 0.073 | |
c.352+1778C>T | CC | CT | TT | C | T | ||||
0.987(152) | 0.013(2) | 0.000(0) | 0.993 | 0.007 | 0.013 | 0.013 | 1.013 | 0.935 | |
c.352+1937T>C | TT | CT | CC | T | C | ||||
0.974(150) | 0.026(4) | 0.000(0) | 0.987 | 0.013 | 0.025 | 0.026 | 1.026 | 0.870 | |
c.353-2036T>A | TT | AT | AA | T | A | ||||
0.961(148) | 0.039(6) | 0.000(0) | 0.980 | 0.020 | 0.038 | 0.038 | 1.040 | 0.805 | |
c.353-1453T>C | CC | CT | TT | C | T | 0.073 | |||
0.234(36) | 0.571(88) | 0.195(30) | 0.520 | 0.480 | 0.375 | 0.499 | 1.997 | ||
c.353-1303T>G | TT | GT | GG | T | G | 0.935 | |||
0.987(152) | 0.013(2) | 0.000(0) | 0.994 | 0.007 | 0.013 | 0.013 | 1.013 | ||
c.747G>T | GG | GT | TT | G | T | 0.497 | |||
0.896(132) | 0.104(22) | 0.000(0) | 0.948 | 0.052 | 0.094 | 0.099 | 1.109 | ||
c.782T>C | CC | CT | TT | C | T | 0.000 | |||
0.013(2) | 0.662(102) | 0.325(50) | 0.344 | 0.656 | 0.349 | 0.451 | 1.823 | ||
c.58_60del | CTT/CTT | CTT/--- | ---/--- | CTT | --- | 0.001 | |||
0.234(36) | 0.623(96) | 0.143(22) | 0.545 | 0.455 | 0.373 | 0.496 | 1.984 |
Variation | Genotype | Litter Size (Mean ± SD) |
---|---|---|
c.352+342C>A | CA(24) | 2.083 a ± 0.647 |
CC(130) | 1.531 b ± 0.648 | |
c.352+419G>A | GG(150) | 1.620 a ± 0.681 |
AG(4) | 1.500 a ± 0.535 | |
c.782T>C | CT(102) | 1.686 a ± 0.702 |
CC(2) | 1.500 a ± 0.000 | |
TT(50) | 1.460 a ± 0.610 | |
c.353-1453T>C | CC(36) | 1.611 a ± 0.595 |
TT(88) | 1.833 a ± 0.785 | |
CT(30) | 1.545 a ± 0.657 | |
c.352+1323C>T | CC(46) | 1.652 a ± 0.636 |
TT(22) | 1.558 a ± 0.623 | |
CT(86) | 1.773 a ± 0.912 | |
c.352+1232T>C | TT(36) | 1.861 a ± 0.827 |
CT (82) | 1.639 ab ± 0.635 | |
CC (36) | 1.500 b ± 0.591 | |
c.352+1165A>G | AA(144) | 1.645 a ± 0.683 |
AG(10) | 1.200 b ± 0.410 | |
c.352+1778C>T | CC(152) | 1.612 a ± 0.670 |
CT(2) | 2.000 a ± 1.155 | |
c.352+1937T>C | TT(150) | 1.613 a ± 0.672 |
CT(4) | 1.750 a ± 0.886 | |
c.353-2036T>A | TT(148) | 1.608 b ± 0.675 |
TA(6) | 1.833 a ± 0.718 | |
c.353-1303T>G | TT(152) | 1.625 a ± 0.678 |
TG(2) | 1.000 a ± 0.000 | |
c.747G>T | GG(132) | 1.674 a ± 0.684 |
GT(22) | 1.125 a ± 0.336 | |
c.58_60del | CTT/---(96) | 1.573 a ± 0.643 |
---/---(22) | 1.727 a ± 0.634 | |
CTT/CTT(36) | 1.667 a ± 0.787 |
FecB or GDF9 c.994G>A Variation | BMP15 Variation | p-Value |
---|---|---|
FecB | c.352+342C>A | 0.147 |
GDF9 (c.994G>A) | 0.039 | |
FecB | c.352+1232T>C | 0.041 |
GDF9 (c.994G>A) | 0.805 | |
FecB | c.352+1165A>G | 0.010 |
GDF9 (c.994G>A) | 0.448 | |
FecB | c.353-2036T>A | 0.772 |
GDF9 (c.994G>A) | 0.170 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di, R.; Wang, F.; Yu, P.; Wang, X.; He, X.; Mwacharo, J.M.; Pan, L.; Chu, M. Detection of Novel Variations Related to Litter Size in BMP15 Gene of Luzhong Mutton Sheep (Ovis aries). Animals 2021, 11, 3528. https://doi.org/10.3390/ani11123528
Di R, Wang F, Yu P, Wang X, He X, Mwacharo JM, Pan L, Chu M. Detection of Novel Variations Related to Litter Size in BMP15 Gene of Luzhong Mutton Sheep (Ovis aries). Animals. 2021; 11(12):3528. https://doi.org/10.3390/ani11123528
Chicago/Turabian StyleDi, Ran, Fengyan Wang, Ping Yu, Xiangyu Wang, Xiaoyun He, Joram Mwashigadi Mwacharo, Linxiang Pan, and Mingxing Chu. 2021. "Detection of Novel Variations Related to Litter Size in BMP15 Gene of Luzhong Mutton Sheep (Ovis aries)" Animals 11, no. 12: 3528. https://doi.org/10.3390/ani11123528