Effects of Dietary Polyphenols from Olive Mill Waste Waters on Inflammatory and Apoptotic Effectors in Rabbit Ovary
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals and Treatments
2.3. Morphometric and Histological Analysis of Ovaries
2.4. Immunohistochemistry
2.5. Protein Analysis of BAX, COX2 by Western Blotting
2.6. RNA Extraction and RT-qPCR
2.7. Statistical Analysis
3. Results
3.1. Morphological and Histological Analysis of Ovaries
3.2. Immunohistochemistry
3.3. Western Blotting
3.4. RT-qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Duque-Acevedo, M.; Belmonte-Ureña, L.J.; Cortés-García, F.J. Camacho-Ferre, F. Agricultural waste: Review of the evolution, approaches and perspectives on alternative uses. Glob. Ecol. Conserv. 2020, 22, e00902. [Google Scholar] [CrossRef]
- European Parliament. Circular economy: Definition, importance and benefits. Available online: https://www.europarl.europa.eu/news/en/headlines/economy/20151201STO05603/circular-economy-definition-importance-and-benefits (accessed on 18 May 2021).
- San Martin, D.; Ramos, S.; Zufía, J. Valorisation of food waste to produce new raw materials for animal feed. Food Chem. 2016, 198, 68–74. [Google Scholar] [CrossRef] [PubMed]
- Kasapidou, E.; Sossidou, E.; Mitlianga, P. Fruit and vegetable co-products as functional feed ingredients in farm animal nutrition for improved product quality. Agriculture 2015, 5, 1020–1034. [Google Scholar] [CrossRef] [Green Version]
- Al-Harthi, M.A.; Attia, Y.A. Effect of citric acid on the utilization of olive cake diets by laying hens. Ital. J. Anim. Sci. 2015, 14, 3. [Google Scholar] [CrossRef]
- Al-Harthi, M.A.; Attia, Y.A. Effect of citric acid on the nutritive value of olive cake in broiler diets. Europ. Poult. Sci. 2016, 80, 1–14. [Google Scholar]
- European Union [EU]. Overview Report—Commercial Rabbit Farming in the European Union; Publications Office of the European Union: Luxembour, 2017. [Google Scholar]
- Trocino, A.; Cotozzolo, E.; Zomeño, C.; Petracci, M.; Xiccato, G.; Castellini, C. Rabbit production and science: The world and Italian scenarios from 1998 to 2018. Ital. J. Anim. Sci. 2019, 18, 1361–1371. [Google Scholar] [CrossRef] [Green Version]
- Shahidi, F.; Varatharajan, V.; Oh, W.Y.; Peng, H. Phenolic compounds in agri-food by-products, their bioavailability and health effects. J. Food Bioact. 2019, 5, 57–119. [Google Scholar] [CrossRef] [Green Version]
- Ghanbari, R.; Anwar, F.; Alkharfy, K.M.; Gilani, A.H.; Saari, N. Valuable nutrients and functional bioactives in different parts of olive (Olea europaea L.): A review. Int. J. Mol. Sci. 2012, 13, 3291–3340. [Google Scholar] [CrossRef] [PubMed]
- Sabino, M.; Cappelli, K.; Capomaccio, S.; Pascucci, L.; Biasato, I.; Verini-Supplizi, A.; Valiani, A.; Trabalza-Marinucci, M. Dietary supplementation with olive mill wastewaters induces modifications on chicken jejunum epithelial cell transcriptome and modulates jejunum morphology. BMC Genom. 2018, 19, 576. [Google Scholar] [CrossRef] [Green Version]
- Branciari, R.; Galarini, R.; Giusepponi, D.; Trabalza-Marinucci, M.; Forte, C.; Roila, R.; Miraglia, D.; Servili, M.; Acuti, G.; Valiani, A. Oxidative status and presence of bioactive compounds in meat from chickens fed polyphenols extracted from olive oil industry waste. Sustainability 2017, 9, 1566. [Google Scholar] [CrossRef] [Green Version]
- Saibandith, B.; Spencer, J.P.; Rowland, I.R.; Commane, D.M. Olive polyphenols and the metabolic syndrome. Molecules 2017, 22, 1082. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Branciari, R.; Ranucci, D.; Ortenzi, R.; Ortenzi, R.; Roila, R.; Trabalza-Marinucci, M.; Servili, M.; Papa, P.; Galarini, R.; Valiani, A. Dietary administration of olive mill waste water extract reduces campylobacter spp. prevalence in broiler chickens. Sustainability 2016, 8, 837. [Google Scholar] [CrossRef] [Green Version]
- Rigacci, S.; Stefani, M. Nutraceutical properties of olive oil polyphenols. An itinerary from cultured cells through animal models to humans. Int. J. Mol. Sci. 2016, 17, 843. [Google Scholar] [CrossRef] [Green Version]
- Ly, C.; Yockell-Lelievre, J.; Ferraro, Z.M.; Arnason, J.T.; Ferrier, J.; Gruslin, A. The effects of dietary polyphenols on reproductive health and early development. Hum. Reprod. Update 2015, 21, 228–248. [Google Scholar] [CrossRef] [Green Version]
- Santana-Méridas, O.; González-Coloma, A.; Sánchez-Vioque, R. Agricultural residues as a source of bioactive natural products. Phytochem. Rev. 2012, 11, 447–466. [Google Scholar] [CrossRef]
- Owczarek, K.; Lewandowska, U. The impact of dietary polyphenols on COX-2 expression in colorectal cancer. Nutr. Cancer 2017, 69, 1105–1118. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.J.; Kang, J.S.; Park, J.H.; Lee, Y.J.; Choi, J.S.; Kang, Y.H. Polyphenolic flavonoids differ in their antiapoptotic efficacy in hydrogen peroxide-treated human vascular endothelial cells. J. Nutr. 2003, 133, 985–991. [Google Scholar] [CrossRef] [Green Version]
- King, R.E.; Kent, K.D.; Bomser, J.A. Resveratrol reduces oxidation and proliferation of human retinal pigment epithelial cells via extracellular signal-regulated kinase inhibition. Chem. Biol. Interact. 2005, 151, 143–149. [Google Scholar] [CrossRef]
- Dudley, J.; Das, S.; Mukherjee, S.; Das, D.K. Resveratrol, a unique phytoalexin present in red wine, delivers either survival signal or death signal to the ischemic myocardium depending on dose. J. Nutr. Biochem. 2009, 20, 443–452. [Google Scholar] [CrossRef]
- Thichanpiang, P.; Wongprasert, K. Green tea polyphenol epigallocatechin-3-gallate attenuates TNF-α-induced intercellular adhesion molecule-1 expression and monocyte adhesion to retinal pigment epithelial cells. Am. J. Chin. Med. 2015, 43, 103–119. [Google Scholar] [CrossRef]
- Ortega, I.; Duleba, A.J. Ovarian actions of resveratrol. Ann. N. Y. Acad Sci. 2015, 1348, 86–96. [Google Scholar] [CrossRef]
- Pasquariello, R.; Verdile, N.; Brevini, T.A.L.; Gandolfi, F.; Boiti, C.; Zerani, M.; Maranesi, M. The Role of Resveratrol in Mammalian Reproduction. Molecules 2020, 25, 4554. [Google Scholar] [CrossRef]
- Balazi, A.; Sirotkin, A.V.; Foldesiova, M.; Makovický, P.; Chrastinova, L.; Makovický, P.; Chrenek, P. Green tea can supress rabbit ovarian functions in vitro and in vivo. Theriogenology 2019, 127, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Petracci, M.; Soglia, F.; Leroy, F. Rabbit meat in need of a hat-trick: From tradition to innovation (and back). Meat Sci. 2018, 146, 93–100. [Google Scholar] [CrossRef]
- Kauffman, A.S.; Rissman, E.F. Neuroendocrine control of mating induced ovulation. In Physiology of Reproduction; Neill, J.D., Ed.; Elsevier: San Diego, CA, USA, 2006; pp. 2283–2326. [Google Scholar]
- Duffy, D.M.; Ko, C.; Jo, M.; Brannstrom, M.; Curry, T.E. Ovulation: Parallels with inflammatory processes. Endocr. Rev. 2019, 40, 369–416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DeWitt, D.L. Prostaglandin endoperoxide synthase—Regulation of enzyme expression. Biochim. Biophys. Acta 1991, 1083, 121–134. [Google Scholar] [CrossRef]
- Espey, L.L. Current status of the hypothesis that mammalian ovulation is comparable to an inflammatory reaction. Biol. Reprod. 1994, 50, 233–238. [Google Scholar] [CrossRef] [Green Version]
- Jabbour, H.N.; Sales, K.J.; Catalano, R.D.; Norman, J.E. Inflammatory pathways in female reproductive health and disease. Reproduction 2009, 138, 903–919. [Google Scholar] [CrossRef]
- Takehara, Y.; Dharmarajan, A.M.; Kaufman, G.; Wallach, E.E. Effect of interleukin 1beta on ovulation in the in vitro perfused rabbit ovary. Endocrinology 1994, 134, 1788–1793. [Google Scholar] [CrossRef]
- Bréard, E.; Delarue, B.; Benhaïm, A.; Féral, C.; Leymarie, P. Inhibition by gonadotropins of interleukin-1 production by rabbit granulosa and theca cells: Effects on gonadotropin-induced progesterone production. Eur. J. Endocrinol. 1998, 138, 328–336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terranova, P.F. Potential roles of tumor necrosis factor-alpha in follicular development, ovulation, and the life span of the corpus luteum. Dom. Anim. Endocrinol. 1997, 14, 1–15. [Google Scholar] [CrossRef]
- Maranesi, M.; Zerani, M.; Lilli, L.; Dall’Aglio, C.; Brecchia, G.; Gobbetti, A.; Boiti, C. Expression of luteal estrogen receptor, interleukin-1, and apoptosis-associated genes after PGF2alpha administration in rabbits at different stages of pseudopregnancy. Domest. Anim. Endocrinol. 2010, 39, 116–130. [Google Scholar] [CrossRef] [PubMed]
- Sirotkin, A.V.; Chrenek, P.; Chadio, S.; Xylouri, E.; Fotopouloy, H.; Makarevich, A.V. Phosphodiesterase inhibitor 3-isobutyl-methyl-xanthine affects rabbit ovaries and oviduct. Eur. J. Pharmacol. 2010, 643, 145–151. [Google Scholar] [CrossRef]
- Xie, S.; Zhang, X.; Chen, W.; Xie, C.; Chen, W.; Cheng, P.; Zhou, Y.; Chen, B. Developmental status: Impact of short-term ischemia on fol-licular survival of whole ovarian transplantation in a rabbit model. PLoS ONE 2015, 10, e0135049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zerani, M.; Polisca, A.; Boiti, C.; Maranesi, M. Current Knowledge on the Multifactorial Regulation of Corpora Lutea Lifespan: The Rabbit Model. Animals 2021, 25, 296. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Official Methods of Analyses, 17th ed.; William, H., Ed.; Association of Analytical Chemists Inc.: Arlington, VA, USA, 2000. [Google Scholar]
- Maertens, L.; Moermans, R.; De Groote, G. Prediction of apparent digestible energy content of commercial pelleted feeds for rabbits. J. Appl. Rabbit Res. 1988, 11, 60–67. [Google Scholar]
- Parillo, F.; Dall’Aglio, C.; Brecchia, G.; Maranesi, M.; Polisca, A.; Boiti, C.; Zerani, M. Aglepristone (RU534) effects on luteal function of pseudopregnant rabbits: Steroid receptors, enzymatic activities, and hormone productions in corpus luteum and uterus. Anim. Reprod. Sci. 2013, 138, 118–132. [Google Scholar] [CrossRef]
- Dall’Aglio, C.; Scocco, P.; Maranesi, M.; Petrucci, L.; Acuti, G.; De Felice, E.; Mercati, F. Immunohistochemical identification of resistin in the uterus of ewes subjected to different diets: Preliminary results. Eur. J. Histochem. 2019, 63, 3020. [Google Scholar] [CrossRef]
- Maranesi, M.; Petrucci, L.; Leonardi, L.; Piro, F.; Rebollar, P.G.; Millán, P.; Cocci, P.; Vullo, C.; Parillo, F.; Moura, A.; et al. New insights on a NGF-mediated pathway to induce ovulation in rabbits (Oryctolagus cuniculus). Biol. Reprod. 2018, 98, 634–643. [Google Scholar] [CrossRef] [Green Version]
- Maranesi, M.; Bufalari, A.; Dall’Aglio, C.; Paoloni, D.; Moretti, G.; Crotti, S.; Manuali, E.; Stazi, M.; Bergamasco, F.; Cruciani, D.; et al. Reproductive Traits of an Invasive Alien Population of Grey Squirrel (Sciurus carolinensis) in Central Italy. Animals 2020, 10, 738. [Google Scholar] [CrossRef]
- Pedersen, T.; Peters, H. Proposal for a classification of oocytes and follicles in the mouse ovary. J. Reprod. Fert. 1968, 17, 555–557. [Google Scholar] [CrossRef]
- Myers, M.; Britt, K.L.; Wreford, N.G.; Ebling, F.J.; Kerr, J.B. Methods for quantifying follicular numbers within the mouse ovary. Reproduction 2004, 127, 569–580. [Google Scholar] [CrossRef]
- Zerani, M.; Parillo, F.; Brecchia, G.; Guelfi, G.; Dall’Aglio, C.; Lilli, L.; Maranesi, M.; Gobbetti, A.; Boiti, C. Expression of type I GNRH receptor and in vivo and in vitro GNRH-I effects in corpora lutea of pseudopregnant rabbits. J. Endocrinol. 2010, 207, 289–300. [Google Scholar] [CrossRef] [PubMed]
- Maranesi, M.; Parillo, F.; Leonardi, L.; Rebollar, P.G.; Alonso, B.; Petrucci, L.; Gobbetti, A.; Boiti, C.; Arruda-Alencar, J.; Moura, A.; et al. Expression of nerve growth factor and its receptors in the uterus of rabbits: Functional involvement in prostaglandin synthesis. Domest. Anim. Endocrinol. 2016, 56, 20–28. [Google Scholar] [CrossRef] [PubMed]
- Parillo, F.; Catone, G.; Maranesi, M.; Gobbetti, A.; Gasparrini, B.; Russo, M.; Boiti, C.; Zerani, M. Immunolocalization, gene expression, and enzymatic activity of cyclooxygenases, prostaglandin E2-9-ketoreductase, and nitric oxide synthases in Mediterranean buffalo (Bubalus bubalis) corpora lutea during diestrus. Microsc. Res. Tech. 2012, 75, 1682–1690. [Google Scholar] [CrossRef] [PubMed]
- Zerani, M.; Dall’Aglio, C.; Maranesi, M.; Gobbetti, A.; Brecchia, G.; Mercati, F.; Boiti, C. Intraluteal regulation of prostaglandin F2 alpha-induced prostaglandin biosynthesis in pseudopregnant rabbits. Reproduction 2007, 133, 1005–1016. [Google Scholar] [CrossRef]
- Parillo, F.; Maranesi, M.; Mignini, F.; Mignini, F.; Marinelli, L.; Di Stefano, A.; Boiti, C.; Zerani, M. Evidence for a dopamine intrinsic direct role in the regulation of the ovary reproductive function: In vitro study on rabbit corpora lutea. PLoS ONE 2014, 9, e104797. [Google Scholar] [CrossRef]
- Livak, M.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Santangelo, C.; Varì, R.; Scazzocchio, B.; Filesi, C.; Masella, R. Management of reproduction and pregnancy complications in maternal obesity: Which role for dietary polyphenols? Biofactors 2014, 40, 79–102. [Google Scholar] [CrossRef]
- Luo, L.L.; Huang, J.; Fu, Y.C.; Xu, J.J.; Qian, Y.S. Effects of tea polyphenols on ovarian development in rats. J. Endocrinol. Investig. 2008, 31, 1110–1118. [Google Scholar] [CrossRef]
- Kong, X.X.; Fu, Y.C.; Xu, J.J.; Zhuang, X.L.; Chen, Z.G.; Luo, L. Resveratrol, an effective regulator of ovarian development and oocyte apoptosis. J. Endocrinol. Investig. 2011, 34, e374–e381. [Google Scholar]
- Wang, Z.G.; Yu, S.D.; Xu, Z.R. Effect of supplementation of green tea polyphenols on the developmental competence of bovine oocytes in vitro. Braz. J. Med. Biol. Res. 2007, 40, 1079–1085. [Google Scholar] [CrossRef] [PubMed]
- Spinaci, M.; Bucci, D.; Muccilli, V.; Cardullo, N.; Nerozzi, C.; Galeati, G. A polyphenol-rich extract from an oenological oak-derived tannin influences in vitro maturation of porcine oocytes. Theriogenology 2019, 129, 82–89. [Google Scholar] [CrossRef]
- Chen, C.C.; Chan, W.H. Injurious effects of curcumin on maturation of mouse oocytes, fertilization and fetal development via apoptosis. Int. J. Mol. Sci. 2012, 13, 4655–4672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roychoudhury, S.; Halenar, M.; Michalcova, K.; Nath, S.; Kacaniova, M.; Kolesarova, A. Green tea extract affects porcine ovarian cell apoptosis. Reprod. Biol. 2018, 18, 94–98. [Google Scholar] [CrossRef]
- Basini, G.; Bianco, F.; Grasselli, F. Epigallocatechin-3-gallate from green tea negatively affects swine granulosa cell function Domest. Anim. Endocrinol. 2005, 28, 243–256. [Google Scholar] [CrossRef]
- Spinaci, M.; Volpe, S.; De Ambrogi, M.; Tamanini, C.; Galeati, G. Effects of epigallocatechin-3-gallate (EGCG) on in vitro maturation and fertilization of porcine oocytes. Theriogenology 2008, 69, 877–885. [Google Scholar] [CrossRef]
- Sánchez-Rodríguez, C.; Cuadrado, E.; Riestra-Ayora, J.; Sanz-Fernández, R. Polyphenols protect against age-associated apoptosis in female rat cochleae. Biogerontology 2018, 19, 159–169. [Google Scholar] [CrossRef]
- Zhao, Y.; Fan, C.; Zhang, A.; Zhang, Y.; Wang, F.; Weng, Q.; Xu, M. Walnut polyphenol extract protects against malathion- and chlorpyrifos-induced immunotoxicity by modulating TLRx-NOX-ROS. Nutrients 2020, 12, 616. [Google Scholar] [CrossRef] [Green Version]
- Nijveldt, R.J.; Van Nood, E.; Van Hoorn, D.E.; Boelens, P.G.; Van Norren, K.; Van Leeuwen, P.A. Flavonoids: A review of probable mechanisms of action and potential applications. Am. J. Clin. Nutr. 2001, 74, 418–425. [Google Scholar] [CrossRef]
- Chao, C.; Weng, S.; Chang, N.; Lin, J.; Kao, S.; Ho, F. Naringenin more effectively inhibits inducible nitric oxide synthase and cyclooxygenase-2 expression in macrophages than in microglia. Nutr. Res. 2010, 30, 858–864. [Google Scholar] [CrossRef] [PubMed]
- Scarpa, E.S.; Mari, M.; Antonini, E.; Palma, F.; Ninfali, P. Natural and synthetic avenanthramides activate caspases 2, 8, 3 and downregulate hTERT, MDR1 and COX-2 genes in CaCo-2 and Hep3B cancer cells. Food Funct. 2018, 9, 2913–2921. [Google Scholar] [CrossRef]
- Maghsoudi, H.; Hallajzadeh, J.; Rezaeipour, M. Evaluation of the effect of polyphenol of escin compared with ibuprofen and dexamethasone in synoviocyte model for osteoarthritis: An in vitro study. Clin. Rheumatol. 2018, 37, 2471–2478. [Google Scholar] [CrossRef]
- Mukherjee, D.; Ahmad, R. COX-2/iNOS regulation during experimental hepatic injury and its mitigation by cloudy apple juice. Int. J. Biol. Macromol. 2019, 140, 1006–1017. [Google Scholar] [CrossRef] [PubMed]
- Fabbri, R.; Macciocca, M.; Vicenti, R.; Caprara, G.; Piccinni, M.P.; Paradisi, R.; Terzano, P.; Papi, A.; Seracchioli, R. Epigallocatechin-3-gallate inhibits doxorubicin-induced inflammation on human ovarian tissue. Biosci. Rep. 2019, 39, BSR20181424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Pan, J.; Zhao, C.; Wang, Y.; Jia, Z.; Zheng, R. Non-enzymatic fast repair of DNA oxidative damage might also exist in cells. Cell Biol. Int. 2008, 32, 654–662. [Google Scholar] [CrossRef]
- Hwang, Y.H.; Park, H.; Ma, J.Y. In vitro and in vivo safety evaluation of Acer tegmentosum. J. Ethnopharmacol. 2013, 48, 99–105. [Google Scholar] [CrossRef]
- Sitarek, P.B.; Ba, E.S.; Nska, H.W.; Wielanek, M.; Szemraj, J.; Toma, M.; Nski, T.U. The effect of Leonurus sibiricus plant extracts on stimulating repair and protective activity against oxidative DNA damage in CHO cells and content of phenolic compounds. Oxid. Med. Cell Longev. 2016, 2016, 5738193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, S.C.; Tyagi, A.K.; Deshmukh-Taskar, P.; Hinojosa, M.; Prasad, S.; Aggarwal, B.B. Downregulation of tumor necrosis factor and other proinflammatory biomarkers by polyphenols. Arch. Biochem. Biophys. 2014, 559, 91–99. [Google Scholar] [CrossRef]
- Dias, M.K.H.M.; Madusanka, D.M.D.; Han, E.J.; Kim, H.S.; Jeon, Y.J.; Jee, Y.; Kim, K.N.; Lee, K.; Fernando, I.P.S.; Ahn, G. Sargassum horneri (Turner) C. Agardh ethanol extract attenuates fine dust-induced inflammatory responses and impaired skin barrier functions in HaCaT keratinocytes. J. Ethnopharmacol. 2021, 273, 114003. [Google Scholar] [CrossRef]
- Zhang, T.; Qiu, F.C.; Chen, L.; Liu, R.J.; Chang, M.; Wang, X.G. Identification and in vitro anti-inflammatory activity of different forms of phenolic compounds in Camellia oleifera oil. Food Chem. 2021, 344, 128660. [Google Scholar] [CrossRef] [PubMed]
Concentrate | Method LOD (µg/g) | ||
---|---|---|---|
CTR a | POL b | ||
Hydroxytyrosol | 0.4 | 182.0 | 0.05 |
Tyrosol | 2.6 | 30.0 | 0.25 |
Verbascoside | 2.5 | 70.0 | 0.05 |
Pinoresinol | 0.3 | 0.4 | 0.05 |
Total polyphenols | 5.8 | 282.4 |
Gene | NCBI Seq. Ref. | Primers | bp | |
---|---|---|---|---|
BAX [35] | XM_008252361.2 | F | CCTTTTGCTTCAGGGTTTCA | 165 |
R | ATCCTCTGCAGCTCCATGTT | |||
COX2 [50] | NM_001082388.1 | F | CCTCACTGATGGGCTGTTTT | 121 |
R | GGTGAAAGCAATGCCTGAAT | |||
IL1B [35] | NM_001082201.1 | F | TGAGGCCGATGGTCCCAATTA | 183 |
R | AAGGCCTGTGGGCAGGGAAC | |||
TNFA | NM_001082263.1 | F | TCCTACGTGCTCCTCACTCA | 170 |
R | GGCGTCTTCCAGTTGGAGAA | |||
18S [51] | X03205.1 | F | CGATCAGATACCGTCGTAGT | 148 |
R | TTCCTTTAAGTTTCAGCTTTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maranesi, M.; Dall’Aglio, C.; Acuti, G.; Cappelli, K.; Trabalza Marinucci, M.; Galarini, R.; Suvieri, C.; Zerani, M. Effects of Dietary Polyphenols from Olive Mill Waste Waters on Inflammatory and Apoptotic Effectors in Rabbit Ovary. Animals 2021, 11, 1727. https://doi.org/10.3390/ani11061727
Maranesi M, Dall’Aglio C, Acuti G, Cappelli K, Trabalza Marinucci M, Galarini R, Suvieri C, Zerani M. Effects of Dietary Polyphenols from Olive Mill Waste Waters on Inflammatory and Apoptotic Effectors in Rabbit Ovary. Animals. 2021; 11(6):1727. https://doi.org/10.3390/ani11061727
Chicago/Turabian StyleMaranesi, Margherita, Cecilia Dall’Aglio, Gabriele Acuti, Katia Cappelli, Massimo Trabalza Marinucci, Roberta Galarini, Chiara Suvieri, and Massimo Zerani. 2021. "Effects of Dietary Polyphenols from Olive Mill Waste Waters on Inflammatory and Apoptotic Effectors in Rabbit Ovary" Animals 11, no. 6: 1727. https://doi.org/10.3390/ani11061727