Heat Shock Protein 70 Improves In Vitro Embryo Yield and Quality from Heat Stressed Bovine Oocytes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vitro Embryo Production
2.2. RNA Extraction and Reverse Transcription
2.3. Gene Expression Analysis
2.4. Statistical Analysis
- A Two-way ANOVA test among all the four groups was used to detect the possible effect of the two factors (Temperature, HSP addition) along with their interaction in the differential gene expression. Pairwise comparisons were conducted between pairs of groups (C39, H39, C41, H41). We focused on the differences between the H and C groups, since our major question is to address the effect of HSP addition to the medium. The significant differences (p-values < 0.05) are presented in Supplementary Tables S2–S4.
- Correlation coefficients were computed for each pair of genes in two groups (samples supplied with HSP70 and not supplied with HSP70) using the rcorr function, since correlated gene expression may be indicative of a similar regulation mechanism underlying gene expression. Coefficients were plotted using the corrplot function, where positive correlations are displayed in blue and negative correlations in red color. Color intensity and the size of the circle are proportional to the correlation coefficients.
3. Results
3.1. In Vitro Embryo Production
3.2. Gene Expression
3.2.1. Oocytes
3.2.2. Cumulus Cells
3.2.3. Blastocysts
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De Rensis, F.; Scaramuzzi, R.J. Heat stress and seasonal effects on reproduction in the dairy cow—A review. Theriogenology 2003, 60, 1139–1151. [Google Scholar] [CrossRef]
- West, J.W. Effects of Heat-Stress on Production in Dairy Cattle. J. Dairy Sci. 2003, 86, 2131–2144. [Google Scholar] [CrossRef]
- Wolfenson, D.; Roth, Z. Impact of heat stress on cow reproduction and fertility. Anim. Front. 2019, 9, 32–38. [Google Scholar] [CrossRef] [PubMed]
- Payton, R.R.; Romar, R.; Coy, P.; Saxton, A.M.; Lawrence, J.L.; Edwards, J.L. Susceptibility of Bovine Germinal Vesicle-Stage Oocytes from Antral Follicles to Direct Effects of Heat Stress In Vitro1. Biol. Reprod. 2004, 71, 1303–1308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roth, Z.; Hansen, P.J. Disruption of nuclear maturation and rearrangement of cytoskeletal elements in bovine oocytes ex-posed to heat shock during maturation. Reproduction 2005, 129, 235–244. [Google Scholar] [CrossRef] [Green Version]
- Soto, P.; Smith, L.C. BH4 peptide derived from Bcl-xL and Bax-inhibitor peptide suppresses apoptotic mitochondrial changes in heat stressed bovine oocytes. Mol. Reprod. Dev. 2009, 76, 637–646. [Google Scholar] [CrossRef]
- Souza-Càcares, M.B.; Fialho, A.L.L.; Silva, W.A.L.; Cardoso, C.J.T.; Pöhland, R.; Martins, M.I.M.; Melo-Sterza, F.A. Oocyte quality and heat shock proteins in oocytes from bovine breeds adapted to the tropics under different conditions of environ-mental thermal stress. Theriogenology 2019, 130, 103–110. [Google Scholar] [CrossRef]
- Ashburner, M. Patterns of puffing activity in the salivary gland chromosomes of Drosophila. Chromosoma 1970, 31, 356–376. [Google Scholar] [CrossRef]
- Edwards, J.L.; Ealy, A.D.; Monterroso, V.H.; Hansen, P.J. Ontogeny of temperature-regulated heat shock protein 70 synthesis in preimplantation bovine embryos. Mol. Reprod. Dev. 1997, 48, 25–33. [Google Scholar] [CrossRef]
- Wegele, H.; Müller, L.; Buchner, J. Hsp70 and Hsp90– a relay team for protein folding. Rev. Physiol. Biochem. Pharmacol. 2004, 151, 1–44. [Google Scholar]
- Ju, J.C. Cellular responses of oocyte and embryos under thermal stress: Hints to molecular signaling. Anim. Reprod. Sci. 2005, 2, 79–90. [Google Scholar]
- Zhang, B.; Peñagaricano, F.; Driver, A.; Chen, H.; Khatib, H. Differential expression of heat shock protein genes and their splice variants in bovine preimplantation embryos. J. Dairy Sci. 2011, 94, 4174–4182. [Google Scholar] [CrossRef] [Green Version]
- Neuer, A.; Mele, C.; Liu, H.C.; Rosenwaks, Z.; Witkin, S.S. Monoclonal antibodies to mammalian heat shock proteins impair mouse embryo development in vitro. Hum. Reprod. 1998, 13, 987–990. [Google Scholar] [CrossRef] [Green Version]
- Al-Katanani, Y.; Hansen, P. Induced thermotolerance in bovine two-cell embryos and the role of heat shock protein 70 in embryonic development. Mol. Reprod. Dev. 2002, 62, 174–180. [Google Scholar] [CrossRef]
- Hansen, P.J. Possible Roles for Heat Shock Protein 70 and Glutathione in Protection of the Mammalian Preimplantation Embryo from Heat Shock. Annu. Rev. Biomed. Sci. 1999, 1, 5–29. [Google Scholar] [CrossRef]
- Velazquez, M.M.; Alfaro, N.S.; Dupuy, C.R.; Salvetti, N.R.; Rey, F.; Ortega, H.H. Heat shock protein patterns in the bovine ovary and relation with cystic ovarian disease. Anim. Reprod. Sci. 2010, 118, 201–209. [Google Scholar] [CrossRef]
- Mambula, S.S.; Stevenson, M.A.; Ogawa, K.; Calderwood, S.K. Mechanisms for Hsp70 secretion: Crossing membranes without a leader. Methods 2007, 43, 168–175. [Google Scholar] [CrossRef] [Green Version]
- Asea, A.; Kraeft, S.-K.; Kurt-Jones, E.A.; Stevenson, M.A.; Chen, L.B.; Finberg, R.W.; Koo, G.C.; Calderwood, S.K. HSP70 stimulates cytokine production through a CD14-dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat. Med. 2000, 6, 435–442. [Google Scholar] [CrossRef]
- Srivastava, P.K. Roles of heat-shock proteins in innate and adaptive immunity. Nat. Rev. Immunol. 2002, 2, 185–194. [Google Scholar] [CrossRef]
- Andrei, C.; Dazzi, C.; Lotti, L.; Torrisi, M.R.; Chimini, G.; Rubartelli, A. The secretory route of the leaderless protein interleu-kin 1beta involves exocytosis of endolysosome-related vesicles. Mol. Biol. Cell 1999, 10, 1463–1475. [Google Scholar] [CrossRef]
- Calderwood, S.K.; Gong, J.; Emurshid, A. Extracellular HSPs: The Complicated Roles of Extracellular HSPs in Immunity. Front. Immunol. 2016, 7, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borges, T.J.; Wieten, L.; van Herwijnen, M.J.; Broere, F.; van der Zee, R.; Bonorino, C.; van Eden, W. The antiinflammatory mechanisms of Hsp70. Front. Immunol. 2012, 3, 95. [Google Scholar] [CrossRef] [Green Version]
- Spiering, R.; Van Der Zee, R.; Wagenaar, J.; Van Eden, W.; Broere, F. Mycobacterial and mouse HSP70 have immuno-modulatory effects on dendritic cells. Cell Stress Chaperon 2012, 18, 439–446. [Google Scholar] [CrossRef] [Green Version]
- Jayaprakash, P.; Dong, H.; Zou, M.; Bhatia, A.; O’Brien, K.; Chen, M.; Woodley, D.T.; Li, W. Hsp90alpha and Hsp90beta together operate a hypoxia and nutrient paucity stress-response mechanism during wound healing. J. Cell Sci. 2015, 128, 1475–1480. [Google Scholar]
- Stamperna, K.; Giannoulis, T.; Nanas, I.; Kalemkeridou, M.; Dadouli, K.; Moutou, K.; Amiridis, G.S.; Dovolou, E. Short term temperature elevation during IVM affects embryo yield and alters gene expression pattern in oocytes, cumulus cells and blastocysts in cattle. Theriogenology 2020, 156, 36–45. [Google Scholar] [CrossRef]
- Dovolou, E.; Clemente, M.; Amiridis, G.; Messinis, I.; Kallitsaris, A.; Rizos, D.; Gutierrez-Adan, A. Effects of Guaiazulene on In vitro Bovine Embryo Production and on mRNA Transcripts Related to Embryo Quality. Reprod. Domest. Anim. 2011, 46, 862–869. [Google Scholar] [CrossRef]
- Dovolou, E.; Periquesta, E.; Messinis, I.E.; Tsiligianni, T.; Dafopoulos, K.; Gutierrez-Adan, A.; Amiridis, G.S. Daily supple-mentation with ghrelin improves in vitro bovine blastocysts formation rate and alters gene expression related to embryo quality. Theriogenology 2014, 81, 565–571. [Google Scholar] [CrossRef]
- De Loos, F.; van Vliet, C.; van Maurik, P.; Kruip, T.A.M. Morphology of immature bovine oocytes. Gamete Res. 1989, 24, 197–204. [Google Scholar] [CrossRef]
- Nanas, I.; Chouzouris, T.; Dadouli, K.; Dovolou, E.; Stamperna, K.; Barbagianni, M.; Valasi, I.; Tsiaras, A.; Amiridis, G.S. A study on stress response and fertility parameters in phenotypically thermotolerant and thermosensitive dairy cows during summer heat stress. Reprod. Domest. Anim. 2020, 55, 1774–1783. [Google Scholar] [CrossRef]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, 71–74. [Google Scholar] [CrossRef] [Green Version]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034. [Google Scholar] [CrossRef] [Green Version]
- Jordan, E. Effects of Heat Stress on Reproduction. J. Dairy Sci. 2003, 86, E104–E114. [Google Scholar] [CrossRef]
- Hansen, P.J. To be or not to be—Determinants of embryonic survival following heat shock. Theriogenology 2007, 68, S40–S48. [Google Scholar] [CrossRef]
- Silva, C.F.; Sartorelli, E.S.; Castilho, A.C.S.; Satrapa, R.A.; Puelker, R.Z.; Razza, E.M.; Ticianelli, J.S.; Eduardo, H.P.; Loureiro, B.; Barros, C.M. Effects of heat stress on development, quality and survival of Bos indicus and Bos taurus embryos produced in vitro. Theriogenology 2013, 79, 351–357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Edwards, J.L.; Saxton, A.M.; Lawrence, J.L.; Payton, R.R.; Dunlap, J.R. Exposure to physiological relevant temperature has-tens in vitro maturation in bovine oocytes. J. Dairy Sci. 2005, 88, 4326–4333. [Google Scholar] [CrossRef]
- Gendelman, M.; Roth, Z. Seasonal Effect on Germinal Vesicle-Stage Bovine Oocytes Is Further Expressed by Alterations in Transcript Levels in the Developing Embryos Associated with Reduced Developmental Competence1. Biol. Reprod. 2012, 86, 1–9. [Google Scholar] [CrossRef]
- Maya-Soriano, M.; Lopez-Gatius, F.; Andreu-Vázquez, C.; Lopez-Bejar, M. Bovine oocytes show a higher tolerance to heat shock in the warm compared with the cold season of the year. Theriogenology 2013, 79, 299–305. [Google Scholar] [CrossRef]
- Brandvold, K.R.; Morimoto, R.I. The Chemical Biology of Molecular Chaperones—Implications for Modulation of Proteostasis. J. Mol. Biol. 2015, 427, 2931–2947. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Assidi, M.; Dufort, I.; Ali, A.; Hamel, M.; Algriany, O.; Dielemann, S.; Sirard, M.A. Identification of potential markers of oo-cyte competence expressed in bovine cumulus cells matured with follicle-stimulating hormone and/or phorbol myristate ace-tate in vitro. Biol. Reprod. 2008, 79, 209–222. [Google Scholar] [CrossRef] [Green Version]
- Gupta, S.; Deepti, A.; Deegan, S.; Lisbona, F.; Hetz, C.; Samali, A. HSP72 Protects Cells from ER Stress-induced Apoptosis via Enhancement of IRE1α-XBP1 Signaling through a Physical Interaction. PLoS Biol. 2010, 8, e1000410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellyei, S.; Szigeti, A.; Boronkai, A.; Pozsgai, E.; Gomori, E.; Melegh, B.; Janaky, T.; Bognar, Z.; Hocsak, E.; Sumegi, B.; et al. Inhibition of cell death by a novel 16.2 kD heat shock protein predominantly via Hsp90 mediated lipid rafts stabilization and Akt activation pathway. Apoptosis 2006, 12, 97–112. [Google Scholar] [CrossRef]
- Turi, Z.; Hocsák, E.; Racz, B.; Szabo, A.; Balogh, A.; Sumegi, B.; Gallyas, F. Role of Mitochondrial Network Stabilisation by a Human Small Heat Shock Protein in Tumour Malignancy. J. Cancer 2015, 6, 470–476. [Google Scholar] [CrossRef] [Green Version]
- Sakatani, M.; Bonilla, L.; Dobbs, K.B.; Block, J.; Ozawa, M.; Shanker, S.; Yao, J.; Hansen, P.J. Changes in the transcriptome of morula-stage bovine embryos caused by heat shock: Relationship to developmental acquisition of thermotolerance. Reprod. Biol. Endocrinol. 2013, 11, 3. [Google Scholar] [CrossRef] [Green Version]
- Fukai, T.; Ushio-Fukai, M. Superoxide Dismutases: Role in Redox Signaling, Vascular Function, and Diseases. Antioxid. Redox Signal. 2011, 15, 1583–1606. [Google Scholar] [CrossRef] [Green Version]
- Lubos, E.; Loscalzo, J.; Handy, D.E. Glutathione peroxidase-1 in health and disease: From molecular mechanisms to therapeu-tic opportunities. Antioxid. Redox Signal. 2011, 15, 1957–1997. [Google Scholar] [CrossRef] [Green Version]
- Somal, A.; Aggarwal, A.; Upadhyay, R.C. Effect of thermal stress on expression profile of apoptosis related genes in periph-eral blood mononuclear cells of transition Sahiwal cow. Iran. J. Vet. Res. 2015, 16, 137–143. [Google Scholar] [PubMed]
- Cory, S. Regulation of lymphocyte survival by the bcl-2 gene family. Annu. Rev. Immunol. 1995, 13, 513–543. [Google Scholar] [CrossRef]
- Pernice, M.; Dunn, S.R.; Miard, T.; Dufour, S.; Dove, S.; Hoegh-Guldberg, O. Regulation of apoptotic mediators reveals dy-namic responses to thermal stress in the reef building coral Acropora Millepora. PLoS ONE 2011, 6, e16095. [Google Scholar] [CrossRef] [PubMed]
- Yadav, A.; Singh, K.P.; Singh, M.K.; Saini, N.; Palta, P.; Manik, R.S.; Singla, S.K.; Upadhyay, R.C.; Chauhan, M.S. Effect of physiologically relevant heat shock on development, apoptosis and expression of some genes in buffalo (Bubalus bubalis) em-bryos produced in vitro. Reprod. Domest. Anim. 2013, 48, 858–865. [Google Scholar] [CrossRef]
- Filali, M.; Frydman, N.; Belot, M.; Hesters, L.; Gaudin, F.; Tachdjian, G.; Emilie, D.; Frydman, R.; Machelon, V. Oocyte in-vitro maturation: BCL2 mRNA content in cumulus cells reflects oocyte competency. Reprod. Biomed. Online 2009, 19, 71–84. [Google Scholar] [CrossRef]
- Gomez, E.; Gutierrez-Adan, A.; Díez, C.; Bermejo-Álvarez, P.; Muñoz, M.; Rodriguez, A.; Otero, J.; Alvarez-Viejo, M.; Martín, D.; Carrocera, S.; et al. Biological differences between in vitro produced bovine embryos and parthenotes. Reproduction 2009, 137, 285–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunning, K.R.; Cashman, K.; Russell, D.L.; Thompson, J.G.; Norman, R.J.; Robker, R.L. Beta-Oxidation Is Essential for Mouse Oocyte Developmental Competence and Early Embryo Development1. Biol. Reprod. 2010, 83, 909–918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsuchida, S.; Yamada, T. Glutathione Transferases. In Reference Module in Biomedical Science; Elsevier: Amsterdam, The Netherlands, 2014. [Google Scholar]
Gene Name | Gene Description | Forward Primer | Reverse Primer | Product Size (bp) |
---|---|---|---|---|
TLR2 | Toll like receptor 2 | GCTGCCATTCTGATTCTGCT | GCCACTCCAGGTAGGTCTTG | 103 |
BCL2 | BCL2 apoptosis regulator | CCCTGTTTGATTTCTCCTGGC | CTGTGGGCTTCACTTATGGC | 107 |
HSF1 | Heat shock transcription factor 1 | ATGAAGCACGAGAACGAGGC | GCACCAGCGAGATGAGGAACT | 112 |
ATP1A1 | ATPase Na+/K+ transporting subunit alpha 1 | CGCCAGGGTTTATCCAGTT | AGGGGAAGCCAGTTTTTGTT | 80 |
IGF1 | Insulin like growth factor 1 | TCACATCCTCCTCGCATCTCTT | AGCATCCACCAACTCAGCC | 107 |
BAX | BCL2 associated X, apoptosis regulator | TTTGCTTCAGGGTTTCATCC | CGCTTCAGACACTCGCTCAG | 120 |
Blastocysts | |||||
---|---|---|---|---|---|
Group | COCs | Cleaved (%) | Day 7 (%) | Day 8 (%) | Day 9 (%) |
C39 | 519 | 438 a (84.4 ± 4.5) | 154 a (29.7 ± 6.6) | 172 a (33.1 ± 6.0) | 179 a (34.5 ± 7.6) |
H39 | 353 | 286 a,b (81.0 ± 7.5) | 94 ab (26.6 ± 4.4) | 111 ab (31.4 ± 6.0) | 122 ab (34.5 ± 6.5) |
C41 | 508 | 401 b,c (78.8 ± 6.8) | 102 b (20.1 ± 3.7) | 123 b (24.2 ± 7.9) | 129 c (25.5 ± 9.0) |
H41 | 704 | 551 b,c (78.2 ± 7.4) | 186 ab (26.4 ± 10.4) | 226 ab (32.1 ± 11.2) | 235 abc (33.4 ± 11.4) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stamperna, K.; Giannoulis, T.; Dovolou, E.; Kalemkeridou, M.; Nanas, I.; Dadouli, K.; Moutou, K.; Mamuris, Z.; Amiridis, G.S. Heat Shock Protein 70 Improves In Vitro Embryo Yield and Quality from Heat Stressed Bovine Oocytes. Animals 2021, 11, 1794. https://doi.org/10.3390/ani11061794
Stamperna K, Giannoulis T, Dovolou E, Kalemkeridou M, Nanas I, Dadouli K, Moutou K, Mamuris Z, Amiridis GS. Heat Shock Protein 70 Improves In Vitro Embryo Yield and Quality from Heat Stressed Bovine Oocytes. Animals. 2021; 11(6):1794. https://doi.org/10.3390/ani11061794
Chicago/Turabian StyleStamperna, Konstantina, Themistoklis Giannoulis, Eleni Dovolou, Maria Kalemkeridou, Ioannis Nanas, Katerina Dadouli, Katerina Moutou, Zissis Mamuris, and Georgios S. Amiridis. 2021. "Heat Shock Protein 70 Improves In Vitro Embryo Yield and Quality from Heat Stressed Bovine Oocytes" Animals 11, no. 6: 1794. https://doi.org/10.3390/ani11061794