The g.4290 C>G Polymorphism in the FADS2 Gene Modifies the Fatty Acid Profile of the Pectoralis Superficialis Muscle of Ross 308 Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval
2.2. Materials
2.3. Methods
2.3.1. Blood Sample Collection
2.3.2. Evaluation of Dressing Percentage and Carcass Quality
2.3.3. Evaluation of the Quality Parameters of the Pectoralis Superficialis Muscle
2.3.4. Fatty Acid Profile Determination
2.3.5. Genotyping
2.4. Statistical Analysis
3. Results
3.1. Analysis of FADS2 and FABP4 Gene Polymorphisms
3.2. Influence of the FADS2 and FABP4 Gene Polymorphisms on Carcass and Meat Quality
3.2.1. FADS2
3.2.2. FABP4
3.3. Effect of Polymorphism in the FADS2 and FABP4 Genes on the Fatty Acid Profile in Pectoralis Superficialis Muscle
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Boschetti, E.; Bordoni, A.; Meluzzi, A.; Castellini, C.; Dal Bosco, A.; Sirri, F. Fatty acid composition of chicken breast meat is dependent on genotype-related variation of FADS1 and FADS2 gene expression and desaturating activity. Animal 2016, 10, 700–708. [Google Scholar] [CrossRef] [PubMed]
- Jing, M.; Gakhar, N.; Gibson, R.A.; House, J.D. Dietary and ontogenic regulation of fatty acid desaturase and elongase expression in broiler chicken. Prostsglandins Leukot. Essent. Fat Acids 2013, 89, 107–113. [Google Scholar] [CrossRef] [PubMed]
- Kaczor, U.; Borys, B.; Pustkowiak, H. Effect of intensive fattening of lambs with forages on the fatty acid profile of intramuscular and subcutaneous fat. Czech J. Anim. Sci. 2010, 55, 408–419. [Google Scholar] [CrossRef] [Green Version]
- Rikimaru, K.; Egawa, Y.; Yamaguchi, S.; Takahashi, H. Association of chicken fatty acid desaturase 1 and 2 gene single-nucleotide polymorphisms with the fatty acid composition of thigh meat in Japanese Hinai-dori crossbred chickens. J. Fish. Livest. Prod. 2016, 4, 202. [Google Scholar] [CrossRef] [Green Version]
- Zhu, S.K.; Tian, Y.D.; Zhang, S.; Chen, Q.X.; Wang, Q.Y.; Han, R.L.; Kang, X.T. Adjacent SNPs in the transcriptional regulatory region of the FADS2 gene associated with fatty acid and growth traits in chickens. Genet. Mol. Res. 2014, 13, 3329–3336. [Google Scholar] [CrossRef]
- Burdge, G. Is essential fatty acid inconversion an important source of PUFA in humans? Br. J. Nutr. 2019, 121, 615–624. [Google Scholar] [CrossRef]
- Cho, H.P.; Nakamura, M.T.; Clark, S.D. Cloning, expression, and nutritional regulation of the mammalian Delta -6 desaturase. J. Biol. Chem. 1999, 274, 471–477. [Google Scholar] [CrossRef] [Green Version]
- Harris, W.S.; Lemke, S.L.; Hansen, S.N.; Goldstein, D.A.; DiRienzo, M.A.; Su, H.; Nemeth, M.A.; Taylor, M.L.; Ahmed, G.; George, C. Stearidonic acid-enriched soybean oil increased the omega-3 index, an emerging cardiovascular risk marker. Lipids 2008, 43, 805–811. [Google Scholar] [CrossRef]
- Simopoulos, A.P. Importance of the omega-6/omega-3 balance in health and disease: Evolutionary aspects of diet. World Rev. Nutr. Diet. 2011, 102, 10–21. [Google Scholar] [CrossRef]
- Zimmerman, A.W.; Veerkamp, J.H. New insights into the structure and function of fatty acid-binding proteins. Cell Mol. Life Sci. 2002, 59, 1096–1116. [Google Scholar] [CrossRef]
- Kucharski, M.; Kaczor, U. Fatty acid binding protein 4 (FABP4) and the body lipid balance. Folia Biol. 2017, 65, 181–186. [Google Scholar] [CrossRef]
- Hertzel, A.V.; Bernlohr, D.A. The mammalian fatty acid-binding protein multigene family: Molecular and genetic insights into function. Trends Endocrinol. Metab. 2010, 11, 175–180. [Google Scholar] [CrossRef]
- Furuhashi, M.; Saitoh, S.; Shimamoto, K.; Miura, T. Fatty Acid-Binding Protein 4 (FABP4): Pathophysiological Insights and Potent Clinical Biomarker of Metabolic and Cardiovascular Diseases. Clin. Med. Insights Cardiol. 2014, 8, 23–33. [Google Scholar] [CrossRef] [Green Version]
- Ibeagha-Awemu, E.M.; Akwanji, K.A.; Beaudoin, F.; Zhao, X. Associations between variants of FADS genes and omega-3 and omega-6 milk fatty acids of Canadian Holstein cows. BMC Genet. 2014, 15, 25. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto, H.; Nogi, T.; Tabuchi, I.; Oyama, K.; Mannen, H.; Sasazaki, S. The SNPs in the promoter regions of the bovine FADS2 and FABP4 genes are associated with beef quality traits. Livest. Sci. 2014, 163, 34–40. [Google Scholar] [CrossRef]
- Blecha, I.M.Z.; Siqueira, F.; Ferreira, A.B.R.; Feijó, G.L.D.; Torres Junior, R.A.A.; Medeiros, S.R.; Sousa, I.I.; Santiago, G.G.; Ferraz, A.L.J. Identification and evaluation of polymorphisms in FABP3 and FABP4 in beef cattle. Genet. Mol. Res. 2015, 14, 16353–16363. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Zhang, Y.H.; Zhang, S.; Li, F.; Wang, S.; Dai, L.; Zhang, J.B. Association of A-FABP gene polymorphism in intron 1 with meat quality traits in Junmu No. 1 white swine. Gene 2011, 487, 170–173. [Google Scholar] [CrossRef]
- Goszczynski, D.E.; Papaleo-Mazzucco, J.; Ripolia, M.V.; Villarreal, E.L.; Rogberg-Muñoz, A.; Mezzadra, C.A.; Melucci, L.M.; Giovambattista, G. Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content. Anim. Biotech. 2017, 28, 211–219. [Google Scholar] [CrossRef]
- Połtowicz, K.; Nowak, J.; Wojtysiak, D. Effect of feed restriction on performance, carcass composition and physicochemical properties of the m. pectoralis superficialis of broiler chickens. Ann. Anim. Sci. 2015, 15, 1019–1029. [Google Scholar] [CrossRef] [Green Version]
- Folch, J.; Lees, M.; Stanley, G.H.S. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Chen, X.; Wu, Y.; Zhang, Z.; Zheng, X.; Wang, Y.; Yu, M.; Liu, G. Effects of the rs3834458 Single Nucleotide Polymorphism in FADS2 on Levels of n-3 Long-chain Polyunsaturated Fatty Acids: A Meta-analysis. Prostaglandins Leukot. Essent. Fat Acids. 2019, 150, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Sirri, F.; Castellini, C.; Bianchi, M.; Petracci, M.; Meluzzi, A.; Franchini, A. Effect of Fast-, Medium- and Slow-Growing Strains on Meat Quality of Chickens Reared under the Organic Farming Method. Animal 2011, 5, 312–319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sirri, F.; Bianchi, M.; Petracci, M.; Meluzzi, A. Influence of Partial and Complete Caponization on Chicken Meat Quality. Poult. Sci. 2009, 88, 1466–1473. [Google Scholar] [CrossRef] [PubMed]
- Lagarde, M.; Guichardant, M.; Picq, M.; Michaud, S.; Doutheau, A. Method for Preparing Acetyl, Docosahexaenoyl-Glycerophosphocholine and Use Thereof for the Delivery of Polyunsaturated Fatty Acids. European Patent WO/2008/068413, 12 June 2008. [Google Scholar]
- Cha, Y.I.; Solnica-Krezel, R.N.; DuBois, R.N. Fishing for prostanoids: Deciphering the developmental functions of cyclooxygenase-derived prostaglandins. Dev. Biol. 2006, 289, 263–272. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, H.; Rikimaru, K.; Kiyohara, R.; Yamaguchi, S. Effect of Arachidonic Acid-Enriched Oil Diet Supplementation on the Taste of Broiler Meat. Asian Australas J. Anim. Sci. 2012, 25, 845–851. [Google Scholar] [CrossRef] [Green Version]
- Bartoň, L.; Marounek, M.; Kudrna, V.; Bureš, D.; Zahradová, R. Growth performance and fatty acid profiles of intramuscular and subcutaneous fat from Limousin and Charolais heifers fed extruded linseed. Meat Sci. 2007, 76, 517–523. [Google Scholar] [CrossRef]
- Wijendran, V.; Hayes, K.C. Dietary n-6 and n-3 fatty acid balance and cardiovascular health. Annu. Rev. Nutr. 2004, 24, 597–615. [Google Scholar] [CrossRef]
- Maharani, D.; Park, H.B.; Jung, Y.; Jung, S.; Jo, C.; Lee, J.H. Investigation of SNPs in FABP3 and FABP4 genes and their possible relationships with fatty acid composition in broiler. Korean J. Poult. Sci. 2011, 38, 231–237. [Google Scholar] [CrossRef] [Green Version]
- Cahyadi, M.; Seo, D.; Choi, N.; Jin, S.; Maharani, D.; Heo, K.N.; Kang, B.S.; Jo, C.; Lee, J.H. FABP3 and FABP4 Genes Are the Potential Candidates for Body Weights in Korean Native Chicken. Korean J. Poult. Sci. 2013, 40, 091–096. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Guan, T.; Li, H.; Bernlohr, D.A. A Novel Polymorphism in the Chicken Adipocyte Fatty Acid- Binding Protein Gene (FABP4) That Alters Ligand-Binding and Correlates with Fatness. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 154, 298–302. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Li, H.; Li, N.; Leng, L.; Wang, Y.; Tang, Z. Identification of single nucleotide polymorphism of adipocyte fatty acid-binding protein gene and its association with fatness traits in the chicken. Poult. Sci. 2006, 85, 429–434. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, H.; Han, D.; Chen, Y.; Muhatai, G.; Kurban, T.J. Correlation of the A-FABP Gene Polymorphism and mRNA Expression with Intramuscular Fat Content in Three-Yellow Chicken and Hetian-Black Chicken. Anim. Biotech. 2016, 28, 37–43. [Google Scholar] [CrossRef]
- Storch, J.; Thumser, A.E. Tissue-specific functions in the fatty acid-binding protein family. J. Biol. Chem. 2008, 285, 32679–32683. [Google Scholar] [CrossRef] [Green Version]
- Makowski, L.; Brittingham, K.C.; Reynolds, J.M.; Suttles, J.; Hotamisligil, G.S. The fatty acid binding protein, aP2, coordinates macrophage cholesterol trafficking and inflammatory activity. J. Biol. Chem. 2005, 280, 12888–12895. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Furuhashi, M.; Hotamisligil, G.S. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 2008, 7, 489–503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ntambi, J.M. The regulation of stearoyl CoA desaturase (SCD). Prog. Lipid Res. 1995, 34, 139–150. [Google Scholar] [CrossRef]
- Horrocks, L.A.; Yeo, Y.K. Health benefits of docosahexaenoic acid (DHA). Pharmacol. Res. 1999, 40, 211–225. [Google Scholar] [CrossRef] [Green Version]
Gene | Chr | SNP | Primers (5′ to 3′) | Ta (°C) | Enzyme | Tt (°C) | Product PCR/Genotype |
---|---|---|---|---|---|---|---|
FADS2 | 5 | g.4290 C>G | F: TGAACTGAAGCGTTTGATGG R: TGGCTTTCTTGGCAATAGG | 57.5 | RsaI | 37 | 283 bp CG (283, 156, 127 bp) CC(156 i 127 bp) GG (283 bp) |
FABP4 | 2 | g.285 C>T | F: TGTGACTACTGGCAAAGGA R: TTCCTCCCAGTCAAGCTTTC | 63.5 | TaqI | 65 | 477 bp TT (477 bp) CT (477, 242, 235 bp) CC (242, 235 bp) |
Traits | FADS2 Genotype | FABP4 Genotype | ||||
---|---|---|---|---|---|---|
CC (0.55) * | CG (0.38) | GG (0.07) | CC (0.31) | CT (0.49) | TT (0.20) | |
Rearing performance, dressing percentage, and carcass quality | ||||||
BW (kg) | 3.44 ± 0.28 | 3.52 ± 0.27 | 3.56 ± 0.40 | 3.48 ± 0.34 | 3.50 ± 0.27 | 3.49 ± 0.43 |
DRP (%) | 77.99 ± 0.22 | 78.08 ± 0.26 | 78.59 ± 0.26 | 78.01 ± 0.23 | 77.83 ± 0.23 | 78.85 ± 0.40 |
Cr (kg) | 2.58 ± 0.22 A | 2.62 ± 0.21 | 2.69 ± 0.28 B | 2.61 ± 0.34 | 2.62 ± 0.26 | 2.65 ± 0.42 |
BRM (%) | 31.86 ± 0.24 | 32.23 ± 0.21 | 31.51 ± 0.77 | 32.02 ± 0.31 | 31.89 ± 0.25 | 32.10 ± 0.49 |
LGM (%) | 18.36 ± 0.11 | 19.23 ± 0.15 | 19.0 ± 0.14 | 19.88 ± 0.05 | 19.56 ± 0.05 | 19.75 ± 0.05 |
LGB (%) | 4.07 ± 0.26 | 4.37 ± 0.13 | 4.15 ± 0.30 | 4.55 ± 0.08 | 4.58 ± 0.07 | 4.45 ± 0.09 |
G (%) | 3.83 ± 0.05 | 3.78 ± 0.06 | 3.71 ± 0.08 | 3.76 ± 0.06 | 3.87 ± 0.06 | 3.73 ± 0.08 |
AF (%) | 1.34 ± 0.05 b | 1.13 ± 0.04 a | 1.28 ± 0.11 | 1.16 ± 0.06 | 1.37 ± 0.06 | 1.19 ± 0.08 |
Pectoralis superficialis muscle quality parameters | ||||||
pH 24 h | 5.80 ± 0.01 | 5.81 ± 0.01 | 5.77 ± 0.02 | 5.78 ± 0.02 | 5.80 ± 0.01 | 5.84 ± 0.02 |
Colour L* | 58.45 ± 0.39 | 59.32 ± 0.37 | 59.05 ± 0.47 | 58.76 ± 0.49 | 59.13 ± 0.34 | 58.72 ± 0.46 |
a* | 10.48 ± 0.23 | 10.15 ± 0.21 | 10.66 ± 0.36 | 10.38 ± 0.33 | 10.36 ± 0.20 | 10.37 ± 0.31 |
b* | 9.28 ± 0.18 | 9.56 ± 0.20 | 9.73 ± 0.32 | 9.64 ± 0.28 | 9.31 ± 0.16 | 9.75 ± 0.22 |
TL (%) | 24.74 ± 0.47 b | 26.51 ± 0.46 a | 25.32 ± 0.68 | 24.69 ± 0.59 a | 25.14 ± 0.40 ab | 27.46 ± 0.69 b |
WBS (N) | 18.33 ± 0.39 | 19.13 ± 0.63 | 18.55 ± 0.83 | 18.58 ± 0.66 | 18.04 ± 0.40 | 19.60 ± 0.69 |
Traits | FADS2 Genotype | FABP4 Genotype | ||||
---|---|---|---|---|---|---|
CC | CG | GG | CC | CT | TT | |
14:0 | 1.36 ± 0.01 A | 1.25 ± 0.02 B | 1.29 ± 0.02 | 1.32 ± 0.02 | 1.4 ± 0.2 | 1.40 ± 0.03 |
14:1 | 0.29 ± 0.01 A | 0.24 ± 0.01 B | 0.24 ± 0.01 B | 0.27 ± 0.01 | 0.29 ± 0.01 | 0.28 ± 0,02 |
15:0 | 0.21 ± 0.01 | 0.213 ± 0.00 | 0.22 ± 0.01 | 0.21 ± 0.01 | 0.23 ± 0.02 | 0.21 ± 0.01 |
16:0 | 24.39 ± 0.14 | 25.83 ± 0.69 | 26.18 ± 0.64 | 25.6 ± 0.5 | 24.0 ± 0.5 | 23.6 ± 0.3 |
16:1 | 5.14 ± 0.09 A | 4.42 ± 0.13 B | 4.17 ± 0.10 B | 4.70 ± 0.15 | 4.98 ± 0.12 | 5.06 ± 0.12 |
17:0 | 0.31 ± 0.01 | 0.34 ± 0.01 | 0.34 ± 0.01 | 0.32 ± 0.01 | 0.30 ± 0.01 | 0.31 ± 0.01 |
17:1 | 0.31 ± 0.01 A | 0.28 ± 0.01 B | 0.27 ± 0.01 B | 0.28 ± 0.01 | 0.29 ± 0.01 | 0.29 ± 0.01 |
18:0 | 8.36 ± 0.18 A | 9.59 ± 0.22 B | 10.16 ± 0.20 B | 9.43 ± 0.18 | 8.79 ± 0.20 | 8.81 ± 0.29 |
18:1 | 41.91 ± 0.37 A | 38.78 ± 0.62 B | 37.68 ± 0.43 B | 39.75 ± 0.34 | 40.9 ± 0.37 | 40.32 ± 0.47 |
18:2 | 13.89 ± 0.19 | 13.94 ± 0.22 | 13.72 ± 0.21 | 13.75 ± 0.16 a | 13.77 ± 0.20 b | 14.15 ± 0.17 ab |
18:3n-3 | 1.15 ± 0.06 a | 1.01 ± 0.04 | 0.95 ± 0.04 b | 1.15 ± 0.01 | 1.1 ± 0.03 | 1.23 ± 0.02 |
CLA | 0.21 ± 0.00 A | 0.21 ± 0.00 A | 0.18 ± 0.00 B | 0.19 ± 0.00 a | 0.20 ± 0.00 ab | 0.21 ± 0.00 b |
20:0 | 0.05 ± 0.00 a | 0.06 ± 0.01 | 0.06 ± 0.04 b | 0.06 ± 0.00 | 0.06 ± 0.00 | 0.05 ± 0.00 |
20:1 | 0.20 ± 0.00 | 0.21 ± 0.01 | 0.21 ± 0.01 | 0.20 ± 0,00 | 0.21 ± 0.00 | 0.20 ± 0.00 |
20:2 | 0.11 ± 0.01 Aa | 0.15 ± 0.01 b | 0.18 ± 0.01 B | 0.14 ± 0.01 | 0.13 ± 0.00 | 0.13 ± 0.00 |
20:3n-6 | 0.19 ± 0.01 Aa | 0.28 ± 0.03 b | 0.35 ± 0.02 B | 0.26 ± 0.01 | 0.23 ± 0.01 | 0.24 ± 0.01 |
20:4 | 0.98 ± 0.07 Aa | 1.69 ± 0.23 b | 2.02 ± 0.17 B | 1.43 ± 0.03 | 1.24 ± 0.02 | 1.34 ± 0.01 |
20:5n-3 | 0.06 ± 0.01 Aa | 0.10 ± 0.01 b | 0.12 ± 0.01 B | 0.08 ± 0.00 | 0.08 ± 0.00 | 0.07 ± 0.00 |
22:4n-6 | 0.22 ± 0.01 Aa | 0.40 ± 0.05 b | 0.50 ± 0.04 B | 0.35 ± 0.03 | 0.28 ± 0.02 | 0.33 ± 0.03 |
22:5 | 0.25 ± 0.01 Aa | 0.41 ± 0.05 b | 0.47 ± 0.04 B | 0.36 ± 0.04 | 0.33 ± 0.03 | 0.32 ± 0.4 |
22:6n-3 | 0.19 ± 0.01 Aa | 0.29 ± 0.03 b | 0.36 ± 0.03 B | 0.30 ± 0.02 | 0.26 ± 0.02 | 0.26 ± 0.02 |
Traits | FADS2 Genotype | FABP4 Genotype | ||||
---|---|---|---|---|---|---|
CC | CG | GG | CC | CT | TT | |
SFA | 34.75 ± 0.31 Aa | 37.35 ± 0.89 b | 38.34 ± 0.82 B | 36.58 ± 0.47 | 35.44 ± 0.56 | 35.42 ± 0.86 |
UFA | 65.14 ± 0.31 Aa | 62.50 ± 0.88 b | 61.49 ± 0.81 B | 63.28 ± 0.46 | 64.43 ± 0.66 | 64.46 ± 0.85 |
MUFA | 47.87 ± 0.40 A | 43.97 ± 0.62 B | 42.60 ± 0.42 B | 45.03 ± 0.407 | 46.53 ± 0.46 | 45.96 ± 0.62 |
PUFA | 17.27 ± 0.28 | 18.53 ± 0.54 | 18.89 ± 0.53 | 18.04 ± 0.37 | 17.69 ± 0.37 | 18.28 ± 0.33 |
n-6/n-3 | 9.76 ± 0.33 | 9.53 ± 0.35 | 9.51 ± 0.31 | 9.82 ± 1.26 | 9.95 ± 1.44 | 9.9 ± 1.33 |
DFA | 73.51 ± 0.14 | 72.09 ± 0.69 | 71.65 ± 0.64 | 72.72 ± 0.36 | 73.23 ± 0.39 | 73.27 ± 0.60 |
OFA | 26.39 ± 0.14 | 27.76 ± 0.71 | 28.17 ± 0.65 | 27.14 ± 0.36 | 26.65 ± 0.39 | 26.61 ± 0.60 |
Index IA | 0.39 ± 0.00 a | 0.44 ± 0.01 | 0.45 ± 0.01 b | 0.42 ± 0.01 | 0.41 ± 0.01 | 0.41 ± 0.01 |
LA/ALA | 14.84 ± 0.52 a | 14.25 ± 0.62 | 12.88 ± 0.57 b | 14.35 ± 2.42 | 13.89 ± 2.42 | 13.47 ± 2.53 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kaczor, U.; Sawicki, S.; Nowak, J.; Gabryś, J.; Jurczyk, J.; Wojtysiak, D.; Połtowicz, K. The g.4290 C>G Polymorphism in the FADS2 Gene Modifies the Fatty Acid Profile of the Pectoralis Superficialis Muscle of Ross 308 Broiler Chickens. Animals 2022, 12, 1882. https://doi.org/10.3390/ani12151882
Kaczor U, Sawicki S, Nowak J, Gabryś J, Jurczyk J, Wojtysiak D, Połtowicz K. The g.4290 C>G Polymorphism in the FADS2 Gene Modifies the Fatty Acid Profile of the Pectoralis Superficialis Muscle of Ross 308 Broiler Chickens. Animals. 2022; 12(15):1882. https://doi.org/10.3390/ani12151882
Chicago/Turabian StyleKaczor, Urszula, Sebastian Sawicki, Joanna Nowak, Julia Gabryś, Jakub Jurczyk, Dorota Wojtysiak, and Katarzyna Połtowicz. 2022. "The g.4290 C>G Polymorphism in the FADS2 Gene Modifies the Fatty Acid Profile of the Pectoralis Superficialis Muscle of Ross 308 Broiler Chickens" Animals 12, no. 15: 1882. https://doi.org/10.3390/ani12151882