A Novel A > G Polymorphism in the Intron 1 of LCORL Gene Is Significantly Associated with Hide Weight and Body Size in Dezhou Donkey
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Moral Statement
2.2. Animals and Phenotypes
2.3. DNA Extraction
2.4. SNP Detection and Genotyping
2.5. SNPs Validation
2.6. Statistical Analysis
3. Results and Discussion
3.1. Genetic Polymorphism of LCORL Gene in Dezhou Donkey
3.2. Genetic Parameters Analysis
3.3. Association Analysis of LCORL Gene g.112558859 A > G Locus with Hide Weight and Body Size
3.4. The Additive Effect, Dominant Effect and Substitution Effect
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
References
- Seyiti, S.; Kelimu, A. Donkey Industry in China: Current Aspects, Suggestions and Future Challenges. J. Equine Vet. Sci. 2021, 102, 103642. [Google Scholar] [CrossRef] [PubMed]
- Bennett, R.; Pfuderer, S. The Potential for New Donkey Farming Systems to Supply the Growing Demand for Hides. Animals 2020, 10, 718. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Guo, S.; Hao, X.; Ma, H.; Bai, Y.; Huang, Y. Improving antioxidant and antiproliferative activities of colla corii asini hydrolysates using ginkgo biloba extracts. Food Sci. Nutr. 2018, 6, 765–772. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Li, H.; Zhang, X.; Yang, L.; Liu, Y.; Liu, S.; Sun, Y.; Zhao, C. An analysis of skin thickness in the Dezhou donkey population and identification of candidate genes by RNA-seq. Anim. Genet. 2022, 53, 368–379. [Google Scholar] [CrossRef]
- Lai, Z.; Wu, F.; Li, M.; Bai, F.; Gao, Y.; Yu, J.; Li, H.; Lei, C.; Dang, R. Tissue expression profile, polymorphism of IGF1 gene and its effect on body size traits of Dezhou donkey. Gene 2021, 766, 145118. [Google Scholar] [CrossRef]
- Chang, T.; Li, M.; An, X.; Bai, F.; Wang, F.; Yu, J.; Lei, C.; Dang, R. Association analysis of IGF2 gene polymorphisms with growth traits of Dezhou donkey. Anim. Biotechnol. 2021. [Google Scholar] [CrossRef]
- Lai, Z.; Wu, F.; Zhou, Z.; Li, M.; Gao, Y.; Yin, G.; Yu, J.; Lei, C.; Dang, R. Expression profiles and polymorphic identification of the ACSL1 gene and their association with body size traits in Dezhou donkeys. Arch. Anim. Breed. 2020, 63, 377–386. [Google Scholar] [CrossRef]
- Lai, Z.; Li, S.; Wu, F.; Zhou, Z.; Gao, Y.; Yu, J.; Lei, C.; Dang, R. Genotypes and haplotype combination of ACSL3 gene sequence variants is associated with growth traits in Dezhou donkey. Gene 2020, 743, 144600. [Google Scholar] [CrossRef]
- Wang, F.; Wang, G.; Dalielihan, B.; Wang, Z.; Chang, T.; Yang, G.; Lei, C.; Dang, R. A novel 31 bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey. Anim. Biotechnol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Li, M.; Zhou, J.; An, X.; Bai, F.; Gao, Y.; Yu, J.; Li, H.; Lei, C.; Dang, R. A novel A > G polymorphism in the intron 2 of TBX3 gene is significantly associated with body size in donkeys. Gene 2021, 785, 145602. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, Y.; Liu, W.; Li, Y.; Pan, J.; Pu, Y.; Han, J.; Orlando, L.; Ma, Y.; Jiang, L. A single-nucleotide mutation within the TBX3 enhancer increased body size in Chinese horses. Curr. Biol. 2022, 32, 480–487.e6. [Google Scholar] [CrossRef] [PubMed]
- Rubin, C.J.; Megens, H.J.; Martinez Barrio, A.; Maqbool, K.; Sayyab, S.; Schwochow, D.; Wang, C.; Carlborg, Ö.; Jern, P.; Jørgensen, C.B.; et al. Strong signatures of selection in the domestic pig genome. Proc. Natl. Acad. Sci. USA 2012, 109, 19529–19536. [Google Scholar] [CrossRef] [PubMed]
- Graber, J.K.; Signer-Hasler, H.; Burren, A.; Drögemüller, C. Evaluation of truncating variants in the LCORL gene in relation to body size of goats from Switzerland. Anim. Genet. 2022, 53, 237–239. [Google Scholar] [CrossRef] [PubMed]
- Tozaki, T.; Sato, F.; Ishimaru, M.; Kikuchi, M.; Kakoi, H.; Hirota, K.; Nagata, S. Sequence variants of BIEC2-808543 near LCORL are associated with body composition in Thoroughbreds under training. J. Equine Sci. 2016, 27, 107–114. [Google Scholar] [CrossRef]
- Shen, J.; Yu, J.; Dai, X.; Li, M.; Wang, G.; Chen, N.; Chen, H.; Lei, C.; Dang, R. Genomic analyses reveal distinct genetic architectures and selective pressures in Chinese donkeys. J. Genet. Genom. 2021, 48, 737–745. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, X.; Jiang, E.; Yan, H.; Zhu, H.; Chen, H.; Liu, J.; Qu, L.; Pan, C.; Lan, X. InDels within caprine IGF2BP1 intron 2 and the 3′-untranslated regions are associated with goat growth traits. Anim. Genet. 2020, 51, 117–121. [Google Scholar] [CrossRef]
- Liu, Z.; Gao, Q.; Wang, T.; Chai, W.; Zhan, Y.; Akhtar, F.; Zhang, Z.; Li, Y.; Shi, X.; Wang, C. Multi-Thoracolumbar Variations and NR6A1 Gene Polymorphisms Potentially Associated with Body Size and Carcass Traits of Dezhou Donkey. Animals 2022, 12, 1349. [Google Scholar] [CrossRef]
- Zheng, L.; Zhang, G.M.; Dong, Y.P.; Wen, Y.F.; Dong, D.; Lei, C.Z.; Qi, X.L.; Chen, H.; Huo, L.J.; Huang, Y.Z. Genetic Variant of MYLK4 Gene and its Association with Growth Traits in Chinese Cattle. Anim. Biotechnol. 2019, 30, 30–35. [Google Scholar] [CrossRef]
- Chen, N.; Wang, F.; Yu, N.; Gao, Y.; Huang, J.; Dang, R.; Huang, Y.; Lan, X.; Lei, C.; Chen, H. Polymorphisms in MX2 Gene Are Related with SCS in Chinese Dairy Cows. Anim. Biotechnol. 2018, 29, 81–89. [Google Scholar] [CrossRef]
- Masatoshi, N.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar]
- Gao, Y.; Huang, B.; Bai, F.; Wu, F.; Zhou, Z.; Lai, Z.; Li, S.; Qu, K.; Jia, Y.; Lei, C. Two Novel SNPs in RET Gene Are Associated with Cattle Body Measurement Traits. Animals 2019, 9, 836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, X.; Lai, Z.; Liu, J.; Zhang, C.; Li, S.; Wu, F.; Zhou, Z.; Lei, C.; Dang, R. A Novel 13 bp Deletion within the NR6A1 Gene Is Significantly Associated with Growth Traits in Donkeys. Animals 2019, 9, 681. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Li, M.; Lan, X.; Li, M.; Lei, C.; Chen, H. Tetra-primer ARMS-PCR identifies the novel genetic variations of bovine HNF-4alpha gene associating with growth traits. Gene 2014, 546, 206–213. [Google Scholar] [CrossRef]
- Han, Y.; Chen, Y.; Liu, Y.; Liu, X. Sequence variants of the LCORL gene and its association with growth and carcass traits in Qinchuan cattle in China. J. Genet. 2017, 96, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Purfield, D.C.; Evans, R.D.; Berry, D.P. Reaffirmation of known major genes and the identification of novel candidate genes associated with carcass-related metrics based on whole genome sequence within a large multi-breed cattle population. BMC Genom. 2019, 20, 720. [Google Scholar] [CrossRef] [PubMed]
- Lindholm-Perry, A.K.; Sexte, A.K.; Kuehn, L.A.; Smith, T.P.L.; King, D.; Shackelford, S.D.; Wheeler, T.L.; Ferrell, C.L.; Jenkins, T.G.; Snelling, W.M.; et al. Association, effects and validation of polymorphisms within the NCAPG-LCORL locus located on BTA6 with feed intake, gain, meat and carcass traits in beef cattle. BMC Genet. 2011, 12, 103. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Li, M.; Wang, S.; Xu, Y.; Lan, X.; Li, Z.; Lei, C.; Yang, D.; Jia, Y.; Chen, H. Association analysis of bovine Foxa2 gene single sequence variant and haplotype combinations with growth traits in Chinese cattle. Gene 2014, 536, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Guo, F.; Luo, G.; Ju, Z.; Wang, X.; Huang, J.; Xu, Y. Association of SPEF2 gene splices variant and functional SNP with semen quality traits in Chinese Holstein bulls. J. Nanjing Agric. Univ. 2014, 37, 119–125. [Google Scholar]
- Dai, J. Application of additive and dominant effect models of genes to argue for Two basic formulas for relative heritability. Hereditas 1981, 3, 34–35. [Google Scholar]
Primer | Location | Primer Sequences (5′–3′) | Tm (°C) | Product Size (bp) |
---|---|---|---|---|
1 | Intron 1 | F:CCCTGATTACTCTTTCTTTG | 58 | 600 |
R: CCTTTGGTTGGCTTGATGAAT |
Samples | Genotypic Frequencies | Allelic Frequencies | HWE | Ho | He | Ne | PIC | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
GG | AG | AA | G | A | |||||||
g.112558859 A > G | 396 | 0.4015 (159) | 0.4419 (175) | 0.1566 (62) | 0.6225 | 0.3775 | 0.2350 | 0.5300 | 0.4700 | 1.8867 | 0.3595 |
SNP | Genotypes | Individual Number | Hide Weight | Carcass Weight | Body Height | Body Length | Chest Circumference |
---|---|---|---|---|---|---|---|
(kg) | (kg) | (cm) | (cm) | (cm) | |||
g.112558859 A > G | AA/62 | 62 | 23.45 ± 3.07 b | 148.38 ± 16.31 | 133.37 ± 4.90 b | 130.80 ± 6.84 b | 143.27 ± 4.77 b |
AG/175 | 175 | 24.08 ± 2.80 | 151.43 ± 19.65 | 134.97 ± 4.77 | 132.58 ± 5.80 | 144.90 ± 5.17 | |
GG/159 | 159 | 24.52 ± 2.77 a | 152.64 ± 19.59 | 135.31 ± 5.27 a | 133.15 ± 6.11 a | 145.51 ± 5.01 a | |
p-value | 0.038 | 0.333 | 0.033 | 0.037 | 0.013 | ||
α | 0.56 | 2.36 | 1.12 | 1.32 | 1.24 | ||
a | 0.54 | 2.13 | 0.97 | 1.18 | 1.12 | ||
d | 0.10 | 0.92 | 0.63 | 0.61 | 0.51 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Shi, X.; Liu, Z.; Ren, W.; Wang, X.; Huang, B.; Kou, X.; Liang, H.; Wang, C.; Chai, W. A Novel A > G Polymorphism in the Intron 1 of LCORL Gene Is Significantly Associated with Hide Weight and Body Size in Dezhou Donkey. Animals 2022, 12, 2581. https://doi.org/10.3390/ani12192581
Wang T, Shi X, Liu Z, Ren W, Wang X, Huang B, Kou X, Liang H, Wang C, Chai W. A Novel A > G Polymorphism in the Intron 1 of LCORL Gene Is Significantly Associated with Hide Weight and Body Size in Dezhou Donkey. Animals. 2022; 12(19):2581. https://doi.org/10.3390/ani12192581
Chicago/Turabian StyleWang, Tianqi, Xiaoyuan Shi, Ziwen Liu, Wei Ren, Xinrui Wang, Bingjian Huang, Xiyan Kou, Huili Liang, Changfa Wang, and Wenqiong Chai. 2022. "A Novel A > G Polymorphism in the Intron 1 of LCORL Gene Is Significantly Associated with Hide Weight and Body Size in Dezhou Donkey" Animals 12, no. 19: 2581. https://doi.org/10.3390/ani12192581