Dietary Theabrownin Supplementation Improves Production Performance and Egg Quality by Promoting Intestinal Health and Antioxidant Capacity in Laying Hens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Extraction of Theabrownin
2.2. Birds, Diets, and Management
2.3. Sample Collection and Measurements
2.4. Egg Quality
2.5. Serum Characteristic Analysis
2.6. RT-PCR Expression Analysis of Inflammatory Cytokines and Intestinal Barrier-Related Genes
2.7. Antioxidant Parameters in Ovary and Magnum
2.8. Statistical Analysis
3. Results
3.1. Production Performance
3.2. Fresh and Storage Egg Quality
3.3. Serum Biochemistry Parameters
3.4. Level of Intestinal Barrier-Related Genes and Inflammatory Cytokines
3.5. Antioxidant Capacities of Ovary and Magnum Tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kovacs-Nolan, J.; Phillips, M.; Mine, Y. Advances in the value of eggs and egg components for human health. J. Agric. Food Chem. 2005, 53, 8421–8431. [Google Scholar] [CrossRef] [PubMed]
- Al-Batshan, H.A.; Scheideler, S.E.; Black, B.L.; Garlich, J.D.; Anderson, K.E. Duodenal calcium uptake, femur ash, and eggshell quality decline with age and increase following molt. Poult. Sci. 1994, 73, 1590–1596. [Google Scholar] [CrossRef]
- Yuan, Z.H.; Zhang, K.Y.; Ding, X.M.; Luo, Y.H.; Bai, S.P.; Zeng, Q.F.; Wang, J.P. Effect of tea polyphenols on production performance, egg quality, and hepatic antioxidant status of laying hens in vanadium-containing diets. Poult. Sci. 2016, 95, 1709–1717. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yuan, Z.; Zhang, K.; Ding, X.; Bai, S.; Zeng, Q.; Peng, H.; Celi, P. Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via P38MAPK-Nrf2/HO-1 signaling pathway in laying hens. Poult. Sci. 2018, 97, 3109–3118. [Google Scholar] [CrossRef]
- Wang, J.; Jia, R.; Celi, P.; Ding, X.; Bai, S.; Zeng, Q.; Mao, X.; Xu, S.; Zhang, K. Green tea polyphenol epigallocatechin-3-gallate improves the antioxidant capacity of eggs. Food Funct. 2020, 11, 534–543. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Shi, Y.; Wu, Q.; Ma, W. Epigallocatechin-3-gallate Alleviates Vanadium-Induced Reduction of Antioxidant Capacity via Keap1-Nrf2-sMaf Pathway in the Liver, Kidney, and Ovary of Laying Hens. Biol. Trace Elem. Res. 2021, 199, 2707–2716. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, Z.; Zhou, Y.; Ling, T.; Wan, X. Chinese dark teas: Postfermentation, chemistry and biological activities. Food Res. Int. 2013, 53, 600–607. [Google Scholar] [CrossRef]
- Gong, J.S.; Tang, C.; Peng, C.X. Characterization of the chemical differences between solvent extracts from Pu-erh tea and Dian Hong black tea by CP–Py–GC/MS. J. Anal. Appl. Pyrolysis 2012, 95, 189–197. [Google Scholar] [CrossRef]
- Peng, C.X.; Wang, Q.P.; Liu, H.R.; Gao, B.; Sheng, J.; Gong, J. Effects of Zijuan pu-erh tea theabrownin on metabolites in hyperlipidemic rat feces by Py-GC/MS. J. Anal. Appl. Pyrolysis 2013, 104, 226–233. [Google Scholar] [CrossRef]
- Kondo, M.; Nishi, K.; Sugahara, T. Ishizuchi dark tea suppresses IgE-mediated degranulation of RBL-2H3 cells and nasal rubbing behavior of pollinosis in mice. J. Funct. Foods. 2015, 14, 659–669. [Google Scholar] [CrossRef]
- Liu, J.; Peng, C.X.; Gao, B.; Gong, J.S. Serum metabolomics analysis of rat after intragastric infusion of Pu-erh theabrownin. J. Sci. Food Agric. 2016, 96, 3708–3716. [Google Scholar] [CrossRef] [PubMed]
- Huang, F.; Zheng, X.; Ma, X.; Jiang, R.; Zhou, W.; Zhou, S.; Zhang, Y.; Lei, S.; Wang, S.; Kuang, J.; et al. Theabrownin from Pu-erh tea attenuates hypercholesterolemia via modulation of gut microbiota and bile acid metabolism. Nat. Commun. 2019, 10, 4971. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.P.; Peng, C.X.; Gong, J.S. Effects of enzymatic action on the formation of theabrownin during solid state fermentation of Pu-erh tea. J. Sci. Food Agric. 2011, 91, 2412–2418. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.; Qi, G.N.; Xu, T.; Chen, S.X.; Liu, T.T.; Huang, Y.F. Optimal extraction parameters of theabrownins from Sichuan dark tea. Afr. J. Tradit. Complement. Altern. Med. 2016, 13, 191–196. [Google Scholar] [CrossRef]
- Xu, Y.; Zhao, H.; Zhang, M.; Li, C.J.; Lin, X.Z.; Sheng, J.; Shi, W. Variations of antioxidant properties and NO scavenging abilities during fermentation of tea. Int. J. Mol. Sci. 2011, 12, 4574–4590. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-Delta Delta C(T) method. Method 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ariana, M.; Samie, A.; Edriss, M.A.; Jahanian, R. Effects of powder and extract form of green tea and marigold, and α-tocopheryl acetate on performance, egg quality and egg yolk cholesterol levels of laying hens in late phase of production. J. Med. Plants Res. 2011, 5, 2710–2716. [Google Scholar]
- Sahin, K.; Orhan, C.; Tuzcu, M.; Ali, S.; Sahin, N.; Hayirli, A. Epigallocatechin-3-gallate prevents lipid peroxidation and enhances antioxidant defense system via modulating hepatic nuclear transcription factors in heat-stressed quails. Poult. Sci. 2010, 89, 2251–2258. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.C.; Wang, X.H.; Wang, J.; Wang, H.; Zhang, H.J.; Wu, S.G.; Qi, G.H. Dietary tea polyphenol supplementation improved egg production performance, albumen quality, and magnum morphology of Hy-Line Brown hens during the late laying period. J. Anim. Sci. 2018, 96, 225–235. [Google Scholar] [CrossRef]
- Xia, B.; Liu, Y.; Sun, D.; Liu, J.; Zhu, Y.; Lu, L. Effects of green tea powder supplementation on egg production and egg quality in laying hens. J. Appl. Anim. Res. 2018, 46, 927–931. [Google Scholar] [CrossRef] [Green Version]
- Celi, P.; Cowieson, A.J.; Fru-Nji, F.; Steinert, R.E.; Kluenter, A.M.; Verlhac, V. Gastrointestinal functionality in animal nutrition and health: New opportunities for sustainable animal production. Anim. Feed Sci. Technol. 2017, 234, 88–110. [Google Scholar] [CrossRef]
- Zhang, Z.; He, F.; Yang, W.; Yang, L.; Huang, S.; Mao, H.; Hou, Y.; Xiao, R. Pu-erh tea extraction alleviates intestinal inflammation in mice with flora disorder by regulating gut microbiota. Food Sci. Nutr. 2021, 9, 4883–4892. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Jiang, Q. Roles of the polyphenol-gut microbiota interaction in alleviating colitis and preventing colitis-associated colorectal cancer. Adv. Nutr. 2021, 12, 546–565. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Zhong, H.; Zhang, X.; Huang, X.; Wang, J.; Li, Z.; Chen, M.; Xiao, Z. EGCG promotes PRKCA expression to alleviate LPS-induced acute lung injury and inflammatory response. Sci. Rep. 2021, 11, 11014. [Google Scholar] [CrossRef] [PubMed]
- Wan, M.L.; Ling, K.H.; Wang, M.F.; El-Nezami, H. Green tea polyphenol epigallocatechin-3-gallate improves epithelial barrier function by inducing the production of antimicrobial peptide pBD-1 and pBD-2 in monolayers of porcine intestinal epithelial IPEC-J2 cells. Mol. Nutr. Food Res. 2016, 60, 1048–1058. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Gui, S.; Wang, J.; Chen, Q.; Zeng, J.; Liu, A.; Chen, Z.; Lu, X. Oral administration of green tea polyphenols (TP) improves ileal injury and intestinal flora disorder in mice with Salmonella typhimurium infection via resisting inflammation, enhancing antioxidant action and preserving tight junction. J. Funct. Food 2020, 64, 103654. [Google Scholar] [CrossRef]
- Cao, Z.H.; Gu, D.H.; Lin, Q.Y.; Xu, Z.Q.; Huang, Q.C.; Rao, H.; Liu, E.W.; Jia, J.J.; Ge, C.R. Effect of pu-erh tea on body fat and lipid profiles in rats with diet-induced obesity. Phytother. Res. 2011, 25, 234–238. [Google Scholar] [CrossRef]
Item, % | Amount |
---|---|
Corn | 61.27 |
Soybean oil Rapeseed meal | 2.14 5.00 |
Soybean meal (CP, 48%) | 20.70 |
Calcium carbonate (granular) | 4.47 |
Calcium carbonate (powder) | 4.47 |
Calcium hydrophosphate | 0.59 |
NaCl | 0.21 |
NaHCO3 | 0.20 |
L-lysine | 0.08 |
DL-methionine | 0.24 |
Choline chloride | 0.10 |
Vitamin premix 1 | 0.03 |
Mineral premix 2 | 0.50 |
Total | 100.00 |
Calculated nutrient content, % | |
ME 3, kcal/kg | 2770 |
Analyzed nutrient levels, % | |
Crude protein | 16.55 |
Calcium | 3.53 |
Total phosphate | 0.59 |
Total lysine | 0.80 |
Total methionine | 0.42 |
Genes | Orientation | Primer Sequences (5′-3′) | Accession Number | Product Size (bp) |
---|---|---|---|---|
β-actin | Forward | ATCCGGACCCTCCATTGTC | NM_205518.1 | 152 |
Reverse | AGCCATGCCAATCTCGTCTT | |||
Claudin-1 | Forward | GTCTTTGGTGGCGTGATCTT | NM_001013611.2 | 117 |
Reverse | TCTGGTGTTAACGGGGTGTGA | |||
Claudin-2 | Forward | CTTTGCTTCATCCCACTGGT | NM_001277622.1 | 86 |
Reverse | TCAAATTTGGTGCTGTCAGG | |||
ZO-1 | Forward | GGCAAGTTGAAGATGGTGGT | XM_015278981.2 | 135 |
Reverse | ATGCCAGCGACTGAATTTCT | |||
ZO-2 | Forward | AGCAGACCCTGCTCAACATT | NM_204918.1 | 124 |
Reverse | GGGGAGAACGATCTGTTTGA | |||
Mucin-2 | Forward | ACCAAGCAGAAAAGCTGGAA | NM_001318434.1 | 80 |
Reverse | AAATGGGCCCTCTGAGTTTT | |||
Occludin | Forward | GCTGAGATGGACAGCATCAA | NM_205128.1 | 97 |
Reverse | TGCCACATCCTGGTATTGAG | |||
TNF-α | Forward | AGATGGGAAGGGAATGAACC | XM_040647309.1 | 139 |
Reverse | GGAAGGGCAACTCATCTGAA | |||
IL-1β | Forward | ACTGGGCATCAAGGGCTA | NM_205518.9 | 117 |
Reverse | GGTAGAAGATGAAGCGGGTC | |||
IL-6 | Forward | AGGACGAGATGTGCAAGAAGT | NM_205518.10 | 98 |
Reverse | TTGGGCAGGTTGAGGTTGTT |
Group | Laying Rate, % | Egg Weight, g | ADFI, g | FCR | Dirty Egg, % | Broken Egg, % | Misshapen Egg, % |
---|---|---|---|---|---|---|---|
1–4 wk | |||||||
CONT | 99.01 | 56.77 | 113.24 | 2.04 | 2.43 | 0.46 | 1.08 |
TB1 | 99.50 | 57.68 | 113.63 | 1.99 | 1.79 | 0.41 | 1.6 |
TB2 | 99.11 | 56.91 | 115.64 | 2.05 | 2.15 | 0.63 | 1.35 |
TB4 | 99.11 | 57.35 | 114.50 | 2.03 | 2.24 | 1.35 | 1.18 |
SEM | 0.43 | 1.31 | 1.68 | 0.03 | 0.86 | 0.51 | 0.64 |
p-Value | 0.691 | 0.255 | 0.496 | 0.062 | 0.903 | 0.231 | 0.870 |
5–8 wk | |||||||
CONT | 99.55 | 59.28 b | 113.23 | 1.92 | 3.40 | 0.27 | 0.72 |
TB1 | 99.41 | 60.54 a | 113.73 | 1.91 | 1.69 | 0.79 | 1.12 |
TB2 | 99.64 | 59.47 ab | 114.51 | 1.93 | 2.41 | 0.27 | 0.8 |
TB4 | 99.02 | 60.29 ab | 114.22 | 1.91 | 1.81 | 0.63 | 0.81 |
SEM | 0.35 | 0.55 | 1.18 | 0.02 | 1.16 | 0.43 | 0.55 |
p-Value | 0.290 | 0.028 | 0.721 | 0.454 | 0.455 | 0.531 | 0.905 |
9–12 wk | |||||||
CONT | 96.54 b | 60.52 | 113.49 | 1.93 | 2.56 | 0.28 | 0.40 |
TB1 | 98.81 a | 61.86 | 115.66 | 1.91 | 2.63 | 0.20 | 0.01 |
TB2 | 97.12 ab | 60.74 | 113.89 | 1.95 | 2.45 | 0.47 | 0.45 |
TB4 | 97.86 ab | 61.79 | 114.31 | 1.90 | 1.55 | 0.37 | 0.38 |
SEM | 0.97 | 0.67 | 1.23 | 0.03 | 1.49 | 0.29 | 0.27 |
p-Value | 0.028 | 0.109 | 0.328 | 0.261 | 0.874 | 0.802 | 0.381 |
1–12 wk | |||||||
CONT | 98.45 | 58.85 b | 113.32 | 1.96 ab | 2.79 | 0.34 | 0.74 |
TB1 | 99.24 | 60.41 a | 114.34 | 1.92 c | 2.03 | 0.46 | 0.91 |
TB2 | 98.64 | 59.68 ab | 114.68 | 1.99 a | 2.34 | 0.46 | 0.87 |
TB4 | 98.66 | 59.81 ab | 114.34 | 1.94 bc | 1.87 | 0.79 | 0.79 |
SEM | 0.49 | 0.64 | 1.24 | 0.02 | 0.77 | 0.28 | 0.35 |
p-Value | 0.080 | 0.017 | 0.712 | 0.010 | 0.649 | 0.453 | 0.964 |
Group | Eggshell Strength, kg/cm3 | Eggshell Thickness, mm | Relative Eggshell Weight, % | Albumen Height, mm | Yolk Color | Haugh Unit | Relative Albumen Weight, % | Relative Yolk Weight, % | Eggshell Color | ||
---|---|---|---|---|---|---|---|---|---|---|---|
L* | a* | b* | |||||||||
4 wk | |||||||||||
CONT | 4.99 | 3.11 | 10.93 | 8.26 | 5.76 | 91.00 | 63.64 | 25.26 | 75.09 | 7.89 | 22.44 |
TB1 | 4.75 | 3.01 | 10.71 | 8.29 | 5.82 | 91.15 | 64.09 | 25.29 | 76.03 | 7.78 | 21.97 |
TB2 | 5.03 | 3.00 | 10.91 | 8.27 | 5.87 | 91.01 | 63.51 | 25.73 | 75.99 | 7.68 | 22.17 |
TB4 | 4.75 | 2.97 | 10.65 | 8.61 | 5.63 | 92.71 | 64.43 | 25.10 | 75.79 | 7.67 | 22.11 |
SEM | 0.18 | 0.07 | 0.14 | 0.24 | 0.24 | 1.11 | 0.44 | 0.39 | 0.86 | 0.45 | 0.74 |
p-value | 0.284 | 0.244 | 0.156 | 0.136 | 0.786 | 0.576 | 0.161 | 0.414 | 0.677 | 0.951 | 0.443 |
8 wk | |||||||||||
CONT | 4.65 | 0.33 | 10.79 | 6.78 b | 7.22 | 82.92 b | 62.54 | 26.64 | 72.48 | 8.36 | 22.46 |
TB1 | 4.71 | 0.32 | 10.72 | 7.16 b | 7.14 | 84.90 b | 63.17 | 26.10 | 74.13 | 7.84 | 21.56 |
TB2 | 4.35 | 0.34 | 10.86 | 7.18 b | 7.28 | 84.05 b | 63.10 | 26.02 | 74.29 | 8.34 | 21.65 |
TB4 | 4.32 | 0.34 | 10.56 | 8.04 a | 6.91 | 89.38 a | 63.47 | 25.94 | 72.77 | 8.89 | 23.28 |
SEM | 0.28 | 0.01 | 0.13 | 0.25 | 0.22 | 1.63 | 0.44 | 0.41 | 1.48 | 0.66 | 0.79 |
p-value | 0.066 | 0.284 | 0.174 | 0.022 | 0.172 | 0.002 | 0.259 | 0.346 | 0.415 | 0.323 | 0.177 |
12 wk | |||||||||||
CONT | 5.08 | 0.40 | 11.22 | 7.47 c | 7.03 | 86.39 c | 61.94 | 26.82 | 75.40 | 7.82 | 20.95 |
TB1 | 4.58 | 0.40 | 11.40 | 7.83 b | 7.06 | 88.41 bc | 62.01 | 26.58 | 76.41 | 7.21 | 20.42 |
TB2 | 5.04 | 0.40 | 11.89 | 7.87 b | 6.96 | 89.85 ab | 61.23 | 26.55 | 76.82 | 7.11 | 20.07 |
TB4 | 4.97 | 0.39 | 11.27 | 8.12 a | 6.77 | 90.84 a | 62.11 | 26.81 | 76.26 | 6.91 | 20.49 |
SEM | 0.20 | 0.01 | 0.31 | 0.16 | 0.15 | 0.99 | 0.58 | 0.41 | 0.89 | 0.52 | 0.91 |
p-value | 0.222 | 0.896 | 0.204 | 0.031 | 0.239 | 0.001 | 0.428 | 0.866 | 0.446 | 0.345 | 0.815 |
Group | Eggshell Strength, kg/cm3 | Eggshell Thickness, mm | Relative Eggshell Weight, % | Albumen Height, mm | Yolk Color | Haugh Unit | Relative Albumen Weight, % | Relative Yolk Weight, % | Eggshell Color | ||
---|---|---|---|---|---|---|---|---|---|---|---|
L* | a* | b* | |||||||||
14 d after storage | |||||||||||
CONT | 5.01 | 0.38 | 10.56 | 5.72 | 6.77 | 73.79 | 61.28 | 28.62 | 78.53 | 9.29 | 24.51 |
TB1 | 5.02 | 0.38 | 10.59 | 5.60 | 6.72 | 72.12 | 60.81 | 28.99 | 77.86 | 9.02 | 24.93 |
TB2 | 5.30 | 0.39 | 10.82 | 5.40 | 6.71 | 74.82 | 60.65 | 28.71 | 78.62 | 8.94 | 24.53 |
TB4 | 5.28 | 0.39 | 10.54 | 5.77 | 6.54 | 73.89 | 61.68 | 28.62 | 77.37 | 9.54 | 24.92 |
SEM | 0.14 | 0.01 | 0.13 | 0.17 | 0.21 | 1.07 | 0.63 | 0.43 | 0.96 | 0.58 | 0.85 |
p-value | 0.062 | 0.958 | 0.163 | 0.163 | 0.691 | 0.126 | 0.363 | 0.815 | 0.528 | 0.728 | 0.928 |
21 d after storage | |||||||||||
CONT | 4.97 | 0.37 | 10.66 | 4.07 b | 7.01 | 59.06 c | 60.79 | 28.73 | 78.94 | 7.07 | 23.16 |
TB1 | 4.85 | 0.38 | 10.66 | 5.14 a | 6.76 | 70.09 a | 60.55 | 28.93 | 77.20 | 7.86 | 22.53 |
TB2 | 5.07 | 0.39 | 10.79 | 4.94 a | 6.87 | 66.92 b | 60.74 | 28.46 | 79.06 | 8.00 | 22.82 |
TB4 | 4.81 | 0.38 | 10.86 | 5.43 a | 6.60 | 69.41 a | 60.39 | 28.60 | 78.48 | 7.87 | 23.35 |
SEM | 0.18 | 0.01 | 0.17 | 0.27 | 0.20 | 1.18 | 0.73 | 0.66 | 1.21 | 0.64 | 1.14 |
p-value | 0.487 | 0.193 | 0.597 | 0.001 | 0.228 | 0.007 | 0.945 | 0.908 | 0.451 | 0.462 | 0.372 |
Item | Glucose | HDL-C | LDL-C | TC | TG | TP |
---|---|---|---|---|---|---|
CONT | 13.24 | 1.20 | 1.24 a | 5.89 a | 15.15 a | 39.21 b |
TB1 | 12.78 | 1.27 | 0.62 b | 4.24 b | 9.10 b | 39.48 b |
TB2 | 12.97 | 1.31 | 0.67 b | 4.95 b | 8.12 b | 41.77 ab |
TB4 | 13.03 | 1.52 | 0.94 b | 3.83 c | 7.46 b | 47.48 a |
SEM | 0.39 | 0.18 | 0.14 | 0.68 | 0.94 | 2.81 |
p-Value | 0.707 | 0.338 | 0.038 | 0.027 | 0.002 | 0.025 |
Item | Ovary | Magnum | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
GSH μmol/L Prot | GSH-PX U/mL Prot | SOD U/mL Prot | CAT U/mL Prot | MDA nmol/mL | 8-OHDG ng/mL | GSH μmol/L Prot | GSH-PX U/mL Prot | SOD U/mL Prot | CAT U/mL Prot | MDA nmol/mL | 8-OHDG ng/mL | |
CONT | 121.25 b | 334.17 | 95.91 | 7.96 | 1.48 | 3.91 | 82.88 b | 260.43 | 229.34 b | 95.02 b | 1.40 a | 17.43 a |
TB1 | 174.71 a | 336.84 | 108.99 | 10.57 | 1.25 | 5.73 | 98.38 b | 256.61 | 268.39 b | 112.57 b | 0.81 b | 17.10 a |
TB2 | 181.17 a | 290.15 | 99.01 | 7.64 | 1.24 | 5.16 | 105.32 a | 306.80 | 274.93 b | 124.05 b | 0.70 b | 15.18 a |
TB4 | 182.92 a | 289.93 | 106.48 | 9.78 | 1.18 | 3.51 | 115.66 a | 315.72 | 348.80 a | 166.44 a | 0.57 b | 11.47 b |
SEM | 23.83 | 26.46 | 6.95 | 1.41 | 0.15 | 0.96 | 8.66 | 36.75 | 30.81 | 17.80 | 0.12 | 1.15 |
p-Value | 0.050 | 0.150 | 0.213 | 0.151 | 0.265 | 0.121 | 0.001 | 0.265 | 0.001 | <0.001 | <0.001 | 0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, T.; Bai, S.; Ding, X.; Zeng, Q.; Zhang, K.; Lv, L.; Li, J.; Peng, H.; Xuan, Y.; Wang, J. Dietary Theabrownin Supplementation Improves Production Performance and Egg Quality by Promoting Intestinal Health and Antioxidant Capacity in Laying Hens. Animals 2022, 12, 2856. https://doi.org/10.3390/ani12202856
Zhang T, Bai S, Ding X, Zeng Q, Zhang K, Lv L, Li J, Peng H, Xuan Y, Wang J. Dietary Theabrownin Supplementation Improves Production Performance and Egg Quality by Promoting Intestinal Health and Antioxidant Capacity in Laying Hens. Animals. 2022; 12(20):2856. https://doi.org/10.3390/ani12202856
Chicago/Turabian StyleZhang, Tao, Shiping Bai, Xuemei Ding, Qiufeng Zeng, Keying Zhang, Li Lv, Jian Li, Huanwei Peng, Yue Xuan, and Jianping Wang. 2022. "Dietary Theabrownin Supplementation Improves Production Performance and Egg Quality by Promoting Intestinal Health and Antioxidant Capacity in Laying Hens" Animals 12, no. 20: 2856. https://doi.org/10.3390/ani12202856