1. Introduction
Growth hormone (
GH) is a critical hormone in growth regulation, by modulating the growth hormone insulin-like growth factor (
GH-IGF) axis and promoting cellular protein synthesis, cell division, and proliferation. Hence, it can accelerate the growth of muscle, bone, and other animal tissues [
1]. Studies have shown that somatostatin (SS) has a wide range of inhibitory effects on
GH, prolactin (
PRL), thyroid-stimulating hormone (
TSH), glucagon and insulin [
2]. In addition, SS also inhibits digestive system functions, including digestive juice secretion, intestinal motility and blood flow in the small intestine [
3,
4,
5]. SS exerts its biological effects mainly by binding to somatostatin receptors (
SSTRs), which are widely expressed in the body’s tissues [
6]. Passive [
7] or active [
8,
9] immunisation against somatostatin through immunological methods using specific antibodies to neutralise endogenous somatostatin to block somatostatin-somatostatin receptor binding and promote the release of growth hormones and other hormones to improve the efficiency of nutrient uptake in animals to promote growth. The current study evaluated the effect of the SS DNA vaccine (pVGS/2SS-asd) on growth traits in fattening pigs through nasal immunisation.
It is well known that somatostatin has an inhibitory effect on animal growth. A previous study demonstrated that the production of antibodies to SS by the body exposed to active immunisation releases their growth inhibitory effect [
10] and promote the growth of animals such as sheep [
11,
12] and heifer [
8]. All of the above evidence suggests that SS-active immunisation is an effective method to promote animal growth. However, due to their high preparation costs, the promotion of synthetic peptides and recombinant protein and their application in livestock production is limited.
The advent of genetically engineered vaccines has brought new ideas to active immunisation with somatostatin. DNA vaccines have many advantages compared to conventional vaccines, including straightforward design, low production costs, ease of transport, no unsafe infectious agents involved, and encoding of multiple immunogenic epitopes [
13,
14]. However, DNA vaccines also have some disadvantages, such as having relatively poor immunogenicity [
15], and the insertion of foreign DNA into the host genome may cause the cell to become cancerous [
16]. In addition, the live attenuated Salmonella strain has the potential to spread across the natural environment through faeces; this could lead to contamination of the environment and a virulent reversion through the process of survival ex vivo [
17,
18]. Therefore, the objective of this study was to (1) evaluate the effects of the bacteria-delivered SS DNA vaccine on the growth of fattening pigs and (2) to evaluate the safety of SS DNA vaccine, including the surrounding environment and insertion of foreign DNA into the host genome.
2. Materials and Methods
2.1. Preparation of Bacterial Vaccine
The SS DNA vaccine (pGS/2SS-asd) was constructed previously in our laboratory using the pVAX-asd eukaryotic expression plasmid [
19]. Before immunisation, bacteria were plated on LB agar in triplicate to determine the number of colony-forming units (CFU) and were adjusted approximately 3 × 10
9 CFU/mL by PBS.
2.2. Animals and Immunisation Protocol
A total of 147 cross-bred starter pigs (Duroc-Landrace-Yorkshire), around 50 days old, were selected from a pig farm in Hubei, China (Hubei Jinlin Original Breed Livestock Co., Ltd.). All the animals were in good general health, and their physical condition was nearly the same size in each group. During the test period, the animals were fed and watered ad libitum. The barns were equipped with ventilation, pens were cleaned twice daily and animal behavioral observations were made daily. The animal handling procedures and all experimental protocols were approved by the Huazhong Agricultural University Animal Care and Use Committee (HZAUSW-2018-029).
All animals were divided into four groups: groups T1 (3 × 10
9 CFU/mL,
n = 39), T2 (3 × 10
8 CFU/mL,
n = 35) and T3 (3 × 10
7 CFU/mL,
n = 35) were nasally immunised twice (09:00 and 15:00) a day with 15 mL of the SS DNA vaccine for 3 days, respectively. The control group (
n = 38) was nasally immunised twice daily with 15 mL of PBS for 3 days. All animals were immunised twice with an interval of 45 days (
Figure 1).
2.3. Blood Collection and Antibody Titre Detection
The blood samples of pigs were collected from the jugular vein on days 110 and 185 of the experiment. The serum was separated by centrifugation and stored at −80 °C until further analysis.
Indirect ELISA was used to detect SS antibody titres in pig plasma. For detailed steps refer to the previous study [
20]; those that differ from them include (1) each well of the 96-well micro titre plate was coated 100 ng/100 μL of SS antigen (Sangon Biotech (Shanghai) Co., Ltd.; Shanghai, China); (2) serum samples (100 μL) diluted with PBS (1:25, 1:50, 1:100, 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400). Finally, under the same dilution factor, if the OD 450 value of the experimental group was greater than the mean of OD 450 value in the control group + 2SD (standard deviation), then it was judged as positive [
21,
22].
2.4. Detections of Hormones
ELISA Kit (MLBIO Biotechnology Co., Ltd.; Shanghai, China) specific to porcine was used to measure IL-4 (mL002314), IFN-γ (mL002333), GH (mL002349) and IGF-1 (mL002344) concentrations. For specific operation methods, refer to the product manual. The intra- and inter-assay coefficients of variation were less than 10.0% and 10.0% for IL-4, IFN-γ, GH, and IGF-1. The assay sensitivity were 0.75 ng/mL for GH, 5 ng/mL for IGF-1 and 4 ng/mL for IL-4, 2.5 ng/mL for IFN-γ.
2.5. Meat Quality and Backfat Thickness Analysis
The experimental pigs were slaughtered on day 185, and the longissimus dorsi was collected and stored on ice for meat quality analysis. Backfat thickness was tested with ultrasonography before slaughter. Subsequently, ten pigs were randomly selected from each antibody-positive and -negative groups for meat quality determination. Each indicator was measured as follows: The pH value was measured at the center of the longissimus dorsi after 1 h of slaughter (pH1 value) and again after 24 h of refrigeration at 4 °C (pH24 value), and the meat was taken for pH measurement on three different sides using a pH meter; meat samples from the longissimus dorsi cross-section within 2 h of slaughter were visually inspected and scored on a 5-point scale for colour and marbling using the National Pork Producers Council’s (NPPC) Meat Colour Scale and Marbling Scale; The sample is cut into 1 cm3 squares and the cut resistance is measured along the vertical direction of the muscle fibres using a mass spectrometer; moisture, ash, crude protein and intramuscular fat were determined according to the method of the national standard GB5009.3-2016 “National Standard for Food Safety Determination of Moisture in Food”.
2.6. Environmental Safety Testing
Fusion gene GS/2SS in bacteria from faecal, water, and soil samples was detected by a PCR method to evaluate the safety of the SS DNA vaccine for the surrounding environment. The faecal, water and soil samples were collected from immunised pigs on days 3, 5, 7, 10, 15 and 30 after immunisation. Faecal (1 g) and soil aliquots (1 g) were placed into 9 mL of sterile PBS, respectively. These samples were serially diluted in a 10-fold series with sterile PBS, up to a dilution of 103-fold. The 10-fold dilution series (200 µL of each dilution) were plated onto MacConkey agar (Tianhe, Hangzhou, China) and incubated at 37 °C for 24 h. Water samples (200 µL) were also plated onto MacConkey agar for incubation. All suspect colonies were picked and the target fragment GS/2SS of the vaccine plasmid DNA was detected by PCR (Primer: F: GCTGTGATGAATGAAACCGTAGA; R: GCAACAGGAGGGATACATAGAGG). Amplification was carried out under the following conditions: Pre-denaturing at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 40 s, annealing at 58 °C for 60 s, and extension at 72 °C for 40 s in a total volume of 20 µL of mixed liquids, including DNA (1 µL), RNase-free water (8 µL), sense and antisense (1 µL) and TaqMix (10 µL).
2.7. Data Statistics
The data were analysed using the MIXED procedure of SAS 9.4 software (SAS Institute, Inc., Cary, NC, USA). The mean values were compared using Tukey’ multiple range test with a significance level of p < 0.05. Nonparametric data were analysed using the chi-squared test. A bivariate analysis of Pearson correlation was performed. Variability in the data was expressed as the standard error of means (SEM), and p < 0.05 was considered statistically significant.
4. Discussion
Compared to standard protein vaccinations, the clinical benefits of DNA vaccines include low cost, vaccine durability, high productivity and facile antigen customisation. On the other hand, clinical investigations revealed that the immunogenicity of DNA vaccines was relatively low [
23]. In the present study, when we constructed a vaccine, the hepatitis B surface antigen gene (HBsAg-S) was inserted into the vector to address this problem. HBsAg-S can further improve immune response to DNA vaccines [
24]. HBsAg-S was inserted into a gene vaccine previously constructed in the laboratory, and antibody positivity rates in serum after 14 days of immunisation ranged between 40% and 100% [
25]. However, our results show antibody positivity rates between 30.77% and 40.00%. The relatively low antibody positivity rate after this study might be due to too long between immunisation and blood collection, which means our experimental design is imperfect. Wang et al. reported that antibody positivity rates were between 44.44% and 83.33% two weeks after immunisation, but between 33.33% and 61.11% four weeks after immunisation [
22], suggesting a gradual decrease in antibody positivity over time. On the other hand, the dose of vaccine may also be a significant contributor to this phenomenon. Han et al. reported that oral administration of a 5 × 10
10 CFU/mL concentration of SS DNA vaccine induced 100% antibody positivity in piglets, while 5 × 10
9 CFU/mL and 5 × 10
8 CFU/mL concentrations induced 30% and 20% antibody positivity, respectively [
20]. Furthermore, we examined the levels of cytokines in the serum, and the results showed that the concentrations of IL-4 and IFN-γ in the P group were not significantly different from those in the N group. On the one hand, this may be because of the long interval between immunisation and blood collection. On the other hand, it may be related to the physiological hormonal compensation of the animal organism. T helper (Th) cells play a key role in regulating immune response, including th1 and th2 cells. IFN-γ production by Th1 cells is associated with cell-mediated immune function, and IL-4 produced by Th2 cells assists in the humoral immune response [
26,
27]. Moreover, research reported that IFN-γ and IL-4 significantly enhanced specific Th1 and Th2 cell immune responses, respectively [
28]. In our study, although the insertion of HBsAg-S improved the immunogenicity of the SS DNA vaccine, a high antibody positivity rate was still not obtained. In addition to increasing the dose of the vaccine, the addition of immuno-adjuvant [
29,
30] is one of the important approaches to improve the antibody-positivity rate of the SS DNA vaccine.
Immunisation against SS has been reported to enhance growth in various species, including mice [
31], lambs [
9], rats [
22], and cattle [
8]. Previous studies in the laboratory have reported that the SS DNA vaccine is attributable to improving the growth performance of piglets through an influence on GH secretion [
20]. In this study, we evaluated the effect of the SS DNA vaccine on growth promotion in fattening pigs. We showed that the weight at slaughter and daily weight gain throughout the feeding period was significantly higher in the SS DNA vaccine immunised group than in the Ctrl group. Several studies have shown significant positive correlations between anti-SS antibodies and average daily gain [
20,
32], which is consistent with our results, suggesting that the specific antibodies produced by vaccination neutralised endogenous SS in pigs and promoted growth in fattening pigs. Furthermore, the results did not reveal a significant dose-dependence of daily weight gain in fattening pigs, which is the same as the previous results of Liang et al. [
33]. Because of the decrease in antibody positivity at higher doses, the loss of dose-dependence may be related to the immune stress induced by higher doses of vaccine [
34]. This study is the first to analyse the meat quality after SS immunisation. The results showed no significant changes in the P group compared to the N group, including pH
1, pH
24, meat colour, marbling, cut resistance, moisture, ash, intramuscular fat and crude protein. Immunisation promotes the secretion of GH, which causes a decrease in intramuscular fat by stimulating lipolysis and regulating lipid deposition in adipose tissue [
35], which may be an indirect cause of the significant negative correlation between backfat thickness and antibody titres.
DNA vaccine safety concerns are genetic, immunologic, toxic, and environmental [
13]. Regulatory agencies, such as the European Medicines Agency (EMA), the World Health Organisation (WHO) and the Food and Drug Administration (FDA), have published guidelines for DNA vaccines [
36]. Before any DNA vaccine can be submitted for regulatory approval, it needs to be tested for safety and performance [
37]. In this study, genomic DNA was collected from pig blood, lung liver, and muscle tissues. No fusion gene fragment GS/2SS was detected, which is consistent with the experimental results of Liang et al. [
33] and Han et al. [
20]. Gene integration in DNA vaccines has not been reported to date and is theoretically less likely than the natural mutation rate of the genome [
33]. However, the GS/2SS gene was observed in day 3 and 5 water samples and day 5 faecal samples. Since the study was conducted by nasal immunisation through aerosolising the bacteriological solution, it was difficult to avoid spreading in pen during the vaccination. Some studies have reported that the live attenuated Salmonella strain can spread in the natural environment by faecal [
17]. Importantly, No GS/2SS gene was detected between 5 and 30 days after immunisation, suggesting that the vaccine bacterium has a limited ability to survive in the natural environment and is not able to spread over a large, prolonged period of time. Finally, compared to antibody-negative pigs, no significant pathological toxicity changes were observed in pathological sections of lung, liver, and muscle tissues in antibody-positive pigs, indicating that the SS DNA vaccine does not produce toxicity while promoting growth in fattening pigs.