Endangered Nectar-Feeding Bat Detected by Environmental DNA on Flowers
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement and Permits
2.2. Field Methods
2.3. DNA Extraction
2.4. DNA Metabarcoding
2.4.1. Library Preparation
2.4.2. Sequence Processing and Taxonomic Classification
2.4.3. qPCR Detection
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Darling, J.A. How to learn to stop worrying and love environmental DNA monitoring. Aquat. Ecosyst. Health Manag. 2020, 22, 440–451. [Google Scholar] [CrossRef]
- Ficetola, G.F.; Miaud, C.; Pompanon, F.; Taberlet, P. Species detection using environmental DNA from water samples. Biol. Lett. 2008, 4, 423–425. [Google Scholar] [CrossRef]
- Padgett-Stewart, T.M.; Wilcox, T.M.; Carim, K.J.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K. An eDNA assay for river otter detection: A tool for surveying a semi-aquatic mammal. Conserv. Genet. Resour. 2016, 8, 5–7. [Google Scholar] [CrossRef]
- Gregorič, M.; Kutnjak, D.; Bačnik, K.; Gostinčar, C.; Pecman, A.; Ravnikar, M.; Kuntner, M. Spider webs as eDNA samplers: Biodiversity assessment across the tree of life. Mol. Ecol. Resour. 2022, 22, 2534–2545. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Willerslev, E. Environmental DNA—An emerging tool in conservation for monitoring past and present biodiversity. Biol. Conserv. 2015, 183, 4–18. [Google Scholar] [CrossRef]
- Barnes, M.A.; Turner, C.R. The ecology of environmental DNA and implications for conservation genetics. Conserv. Genet. 2016, 17, 1–17. [Google Scholar] [CrossRef]
- Goldberg, C.S.; Turner, C.R.; Deiner, K.; Klymus, K.E.; Thomsen, P.F.; Murphy, M.A.; Spear, S.F.; McKee, A.; Oyler-McCance, S.J.; Cornman, R.S.; et al. Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol. Evol. 2016, 7, 1299–1307. [Google Scholar] [CrossRef]
- Hassan, S.; Sabreena; Poczai, P.; Ganai, B.A.; Almalki, W.H.; Gafur, A.; Sayyed, R.Z. Environmental DNA Metabarcoding: A Novel Contrivance for Documenting Terrestrial Biodiversity. Biology 2022, 11, 1297. [Google Scholar] [CrossRef]
- Klymus, K.E.; Richter, C.A.; Thompson, N.; Hinck, J.E. Metabarcoding of environmental DNA samples to explore the use of uranium mine containment ponds as a water source for wildlife. Diversity 2017, 9, 54. [Google Scholar] [CrossRef]
- Piaggio, A.J.; Engeman, R.M.; Hopken, M.W.; Humphrey, J.S.; Keacher, K.L.; Bruce, W.E.; Avery, M.L. Detecting an elusive invasive species: A diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA. Mol. Ecol. Resour. 2014, 14, 374–380. [Google Scholar] [CrossRef]
- Lyman, J.A.; Sanchez, D.E.; Hershauer, S.N.; Sobek, C.J.; Chambers, C.L.; Zahratka, J.; Walker, F.M. Mammalian eDNA on herbaceous vegetation? Validating a qPCR assay for detection of an endangered rodent. Environ. DNA 2022, 4, 1187–1197. [Google Scholar] [CrossRef]
- Thomsen, P.F.; Sigsgaard, E.E. Environmental DNA metabarcoding of wild flowers reveals diverse communities of terrestrial arthropods. Ecol. Evol. 2019, 9, 1665–1679. [Google Scholar] [CrossRef] [PubMed]
- USFWS. Endangered and threatened wildlife and plants; determination of endangered status for two long-nosed bats. Fed. Regist. 1988, 53, 38456–38460. [Google Scholar]
- Arroyo-Cabrales, J.; Miller, B.; Reid, F.; Cuarón, A.D.; Grammont, P.C. Leptonycteris nivalis. In The IUCN Red List of Threatened Species 2008; IUCN: Grand, Switzerland, 2008. [Google Scholar]
- Medellín, R. Leptonycteris nivalis. In The IUCN Red List of Threatened Species 2016: E.T11697A22126172; IUCN: Grand, Switzerland, 2016. [Google Scholar] [CrossRef]
- SEMARNAT. Norma Oficial Mexicana NOM-059-SEMARNAT-2010, Proteccion Ambiental-Especies Nativas de Mexico de Flora y Fauna Silvestres—Categorias de Riesgo y Especificaciones Para su Inclusion, Exclusion o Cambio—Lista de Especies en Riesgo. Diario Oficial, Mexico D.F. 2010. Available online: https://dof.gob.mx/nota_detalle_popup.php?codigo=5173091 (accessed on 15 September 2022).
- USFWS. Species Status Assessment Report for the Mexican Long-Nosed Bat (Leptonycteris nivalis); Version 1.1. December 2018; USFWS: Albuquerque, NM, USA, 2018. [Google Scholar]
- Fleming, T.H.; Nuñez, R.A.; Sternberg, L.S.L. Seasonal changes in the diets of migrant and non-migrant nectarivorous bats as revealed by carbon stable isotope analysis. Oecologia 1993, 94, 72–75. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Ruiz, E.P.; Lacher, T.E. Modelling the potential geographic distribution of an endangered pollination corridor in Mexico and the United States. Divers. Distrib. 2017, 23, 67–78. [Google Scholar]
- Moreno-Valdez, A.; Grant, W.E.; Honeycutt, R.L. A simulation model of Mexican long-nosed bat (Leptonycteris nivalis) migration. Ecol. Model. 2000, 134, 117–127. [Google Scholar]
- England, A. Pollination Ecology of Agave palmeri in New Mexico, and landscape use of Leptonycteris nivalis in relation to agaves. Ph.D. Dissertation, The University of New Mexico, Albuquerque, NM, USA, 2012. [Google Scholar]
- Kuban, J.F.J. The Pollination Biology of Two Populations of the Big Bend Century Plant, Agave Havardiana Trel.: A Multiple Pollinator Syndrome with Floral Specialization for Large Vertebrate Pollinators. Ph.D. Dissertation, Syracuse University, Syracuse, NY, USA, 1989. [Google Scholar]
- Moreno-Valdez, A.; Honeycutt, R.; Grant, W. Colony dynamics of Leptonycteris nivalis (Mexican long-nosed bat) related to flowering Agave in northern Mexico. J. Mammal. 2004, 85, 453–459. [Google Scholar] [CrossRef]
- USFWS. Mexican Long-Nosed Bat (Leptonycteris nivalis) Recovery Plan; U.S. Fish and Wildlife Service: Albuquerque, NM, USA, 1994. [Google Scholar]
- Bat Conservation International. Agave Restoration. Available online: http://www.batcon.org/our-work/initiatives/agave-restoration (accessed on 15 September 2022).
- Cappelli, M.P.; Blakey, R.V.; Taylor, D.; Flanders, J.; Badeen, T.; Butts, S.; Frick, W.; Rebelo, H. Limited refugia and high velocity range-shifts predicted for bat communities in drought-risk areas of the Northern Hemisphere. Glob. Ecol. Conserv. 2021, 28, e01608. [Google Scholar] [CrossRef]
- Gómez-Ruiz, E.P.; Lacher, T.E. Climate change, range shifts, and the disruption of a pollinator-plant complex. Sci. Rep. 2019, 9, 14048. [Google Scholar]
- Simmons, J.; Fenton, M.B.; Ferguson, W.R.; Jutting, M. Neotropical leaf-nosed bats (Phyllostomidae): “Whispering” bats or candidates for acoustic survey? Bat Echolocation Res. Tools Tech. Anal. 2004, 203, 63. [Google Scholar]
- Medellín, R. Leptonycteris yerbabuenae. In The IUCN Red List of Threatened Species 2016: E.T136659A21988965; IUCN: Grand, Switzerland, 2016. [Google Scholar] [CrossRef]
- Walker, F.M.; Williamson, C.H.D.; Sanchez, D.E.; Sobek, C.J.; Chambers, C.L. Species from Feces: Order-wide identification of Chiroptera from guano and other non-invasive genetic samples. PLoS ONE 2016, 11, e0162342. [Google Scholar] [CrossRef]
- Jusino, M.A.; Banik, M.T.; Palmer, J.M.; Wray, A.K.; Xiao, L.; Pelton, E.; Barber, J.R.; Kawahara, A.Y.; Gratton, C.; Peery, M.Z.; et al. An improved method for utilizing high-throughput amplicon sequencing to determine the diets of insectivorous animals. Mol. Ecol. Resour. 2019, 19, 176–190. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.L.; Yao, H.; Han, J.P.; Liu, C.; Song, J.Y.; Shi, L.C.; Zhu, Y.J.; Ma, X.Y.; Gao, T.; Pang, X.H.; et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [PubMed]
- Palmieri, L.; Bozza, E.; Giongo, L. Soft fruit traceability in food matrices using real-time PCR. Nutrients 2009, 1, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Colman, R.E.; Schupp, J.M.; Hicks, N.D.; Smith, D.E.; Buchhagen, J.L.; Valafar, F.; Crudu, V.; Romancenco, E.; Noroc, E.; Jackson, L.; et al. Detection of low-level mixed-population drug resistance in Mycobacterium tuberculosis using high fidelity amplicon sequencing. PLoS ONE 2015, 10, e0126626. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable, and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 8, 852–857. [Google Scholar]
- Wickham, H.; Mara Averick, M.; Jennifer Bryan, J.; Chang, W.; McGowan, L.D.A.; François, R.; Grolemund, G.; Hayes, A.; Henry, L.; Hester, J.; et al. Welcome to the Tidyverse. J. Open Source Softw. 2019, 4, 1686. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing. Available online: https://www.R-project.org/ (accessed on 15 August 2022).
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Frøslev, T.G.; Kjøller, R.; Bruun, H.H.; Ejrnæs, R.; Brunbjerg, A.K.; Pietroni, C.; Hansen, A.J. Algorithm for post-clustering curation of DNA amplicon data yields reliable biodiversity estimates. Nat. Commun. 2017, 8, 1188. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahe, F. VSEARCH: A versatile open source tool for metagenomics. Peerj 2016, 4, 22. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, D.E. Hierarchical Assessments of Gene Flow for Cryptic and Endangered Mammals. Doctoral Dissertation, Northern Arizona University, Flagstaff, AZ, USA, 2021. [Google Scholar]
- Bengtsson-Palme, J.; Ryberg, M.; Hartmann, M.; Branco, S.; Wang, Z.; Godhe, A.; De Wit, P.; Sánchez-García, M.; Ebersberger, I.; de Sousa, F.; et al. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Methods Ecol. Evol. 2013, 4, 914–919. [Google Scholar] [CrossRef]
- Huson, D.H.; Auch, A.F.; Qi, J.; Schuster, S.C. MEGAN analysis of metagenomic data. Genome Res. 2007, 17, 377–386. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [PubMed]
- Benson, D.A.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2008, 37, D26–D31. [Google Scholar] [CrossRef] [PubMed]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Gregory Caporaso, J. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef]
- Banchi, E.; Ametrano, C.G.; Greco, S.; Stanković, D.; Muggia, L.; Pallavicini, A. PLANiTS: A curated sequence reference dataset for plant ITS DNA metabarcoding. Database 2020, 2020, baz155. [Google Scholar] [CrossRef]
- Bell, K.L.; Loeffler, V.M.; Brosi, B.J. An rbcL reference library to aid in the identification of plant species mixtures by DNA metabarcoding. Appl. Plant Sci. 2017, 5, apps.1600110. [Google Scholar] [CrossRef]
- O’Rourke, D.R.; Bokulich, N.A.; Jusino, M.A.; MacManes, M.D.; Foster, J.T. A total crapshoot? Evaluating bioinformatic decisions in animal diet metabarcoding analyses. Ecol. Evol. 2020, 10, 9721–9739. [Google Scholar] [CrossRef]
- Ratnasingham, S.; Hebert, P.D.N. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Mol. Ecol. Notes 2007, 7, 355–364. [Google Scholar] [CrossRef]
- Robeson, M.S., II; O’Rourke, D.R.; Kaehler, B.D.; Ziemski, M.; Dillon, M.R.; Foster, J.T.; Bokulich, N.A. RESCRIPt: Reproducible sequence taxonomy reference database management. PLOS Comput. Biol. 2021, 17, e1009581. [Google Scholar] [CrossRef] [PubMed]
- USDA; NRCS. The PLANTS Database. 2021. Available online: https://plants.usda.gov/home (accessed on 1 August 2022).
- Klymus, K.E.; Merkes, C.M.; Allison, M.J.; Goldberg, C.S.; Helbing, C.C.; Hunter, M.E.; Jackson, C.A.; Lance, R.F.; Mangan, A.M.; Monroe, E.M.; et al. Reporting the limits of detection and quantification for environmental DNA assays. Environ. DNA 2020, 2, 271–282. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Walters, W.A.; Caporaso, J.G.; Lauber, C.L.; Berg-Lyons, D.; Fierer, N.; Knight, R. PrimerProspector: De novo design and taxonomic analysis of barcoded polymerase chain reaction primers. Bioinformatics 2011, 27, 1159–1161. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Slauson, L.A. Pollination biology of two chiropterophilous agaves in Arizona. Am. J. Bot. 2000, 87, 825–836. [Google Scholar] [CrossRef]
- Serrao, N.R.; Weckworth, J.K.; McKelvey, K.S.; Dysthe, J.C.; Schwartz, M.K. Molecular genetic analysis of air, water, and soil to detect big brown bats in North America. Biol. Conserv. 2021, 261, 109252. [Google Scholar] [CrossRef]
- Wilcox, T.M.; Carim, K.J.; McKelvey, K.S.; Young, M.K.; Schwartz, M.K. The Dual Challenges of Generality and Specificity When Developing Environmental DNA Markers for Species and Subspecies of Oncorhynchus. PLoS ONE 2015, 10, e0142008. [Google Scholar] [CrossRef]
- Frick, W.F.; Price, R.D.; Heady, P.A., III; Kay, K.M. Insectivorous Bat Pollinates Columnar Cactus More Effectively per Visit than Specialized Nectar Bat. Am. Nat. 2013, 181, 137–144. [Google Scholar] [CrossRef]
- Bylemans, J.; Gleeson, D.M.; Duncan, R.P.; Hardy, C.M.; Furlan, E.M. A performance evaluation of targeted eDNA and eDNA metabarcoding analyses for freshwater fishes. Environ. DNA 2019, 1, 402–414. [Google Scholar] [CrossRef]
- Tschapka, M.; Gonzalez-Terrazas, T.P.; Knörnschild, M. Nectar uptake in bats using a pumping-tongue mechanism. Sci. Adv. 2015, 1, e1500525. [Google Scholar] [CrossRef] [PubMed]
- Ghosh-Harihar, M.; Gurung, N.; Shukla, H.; Sinha, I.; Pandit, A.; Prakash, V.; Green, R.E.; Ramakrishnan, U. Metabarcoding for parallel identification of species, sex and diet of obligate scavengers: An application to globally-threatened Gyps vultures. Conserv. Genet. Resour. 2021, 13, 61–77. [Google Scholar] [CrossRef]
- Swift, J.F.; Lance, R.F.; Guan, X.; Britzke, E.R.; Lindsay, D.L.; Edwards, C.E. Multifaceted DNA metabarcoding: Validation of a noninvasive, next-generation approach to studying bat populations. Evol. Appl. 2018, 11, 1120–1138. [Google Scholar] [CrossRef] [PubMed]
- Edwards, C.E.; Swift, J.F.; Lance, R.F.; Minckley, T.A.; Lindsay, D.L. Evaluating the efficacy of sample collection approaches and DNA metabarcoding for identifying the diversity of plants utilized by nectivorous bats. Genome 2019, 62, 19–29. [Google Scholar] [CrossRef] [PubMed]
- Johnson, M.D.; Fokar, M.; Cox, R.D.; Barnes, M.A. Airborne environmental DNA metabarcoding detects more diversity, with less sampling effort, than a traditional plant community survey. BMC Ecol. Evol. 2021, 21, 218. [Google Scholar] [CrossRef]
- Kuban, J.F.; Schwartz, G.G. Nectar as a diet of the ring-tailed cat. Southwest. Nat. 1985, 30, 311–312. [Google Scholar] [CrossRef]
- Johnson, M.D.; Cox, R.D.; Barnes, M.A. The detection of a non-anemophilous plant species using airborne eDNA. PLoS ONE 2019, 14, e0225262. [Google Scholar] [CrossRef]
- Cruz-Neto, A.P.; Garland, T.; Abe, A.S. Diet, phylogeny, and basal metabolic rate in phyllostomid bats. Zoology 2001, 104, 49–58. [Google Scholar] [CrossRef]
- Gardner, A.L. Feeding habits. In Biology of Bats of the New World Family Phyllostomidae; Museum of Texas Tech University: Lubbock, TX, USA, 1977; pp. 293–351. [Google Scholar]
- Schondube, J.E.; Herrera, M.L.; Martínez del Rio, C. Diet and the evolution of digestion and renal function in phyllostomid bats. Zoology 2001, 104, 59–73. [Google Scholar] [CrossRef]
- Ingala, M.R.; Simmons, N.B.; Wultsch, C.; Krampis, K.; Provost, K.L.; Perkins, S.L. Molecular diet analysis of neotropical bats based on fecal DNA metabarcoding. Ecol. Evol. 2021, 11, 7474–7491. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Fonseca, J.G.; Mau, R.; Walker, F.M.; Medina-Fitoria, A.; Yasuda, K.; Chambers, C.L. Vampyrum spectrum (Phyllostomidae) movement and prey revealed by radio-telemetry and DNA metabarcoding. PLoS ONE 2022, 17, e0265968. [Google Scholar] [CrossRef] [PubMed]
- Thalinger, B.; Deiner, K.; Harper, L.; Rees, H.; Blackman, R.; Sint, D.; Traugott, M.; Goldberg, C.; Bruce, K. A validation scale to determine the readiness of environmental DNA assays for routine species monitoring. Environ. DNA 2021, 3, 823–836. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5’–3’) | Target Region | Target Taxa | Insert Size (bp) | Source |
---|---|---|---|---|---|
SFF145f (forward) | acccaactgaatggagcGTHACHGCYCAYGCHTTYGTAATAAT | COI | Bats | 202 | [30] |
SFF351r (reverse) | acgcacttgacttgtcttcCTCCWGCRTGDGCWAGRTTTCC | ||||
ITS2 (forward) | acccaactgaatggagcATGCGATACTTGGTGTGAAT | ITS2 | Plants | 100–480 | [32] |
ITS3 (reverse) | acgcacttgacttgtcttcGACGCTTCTCCAGACTACAAT | ||||
rbcl2 (forward) | acccaactgaatggagcTGGCAGCATTYCGAGTAACTC | rbcL | Plants | 96 | [33] |
rbclA (reverse) | acgcacttgacttgtcttcCCTTTRTAACGATCAAGRC | ||||
ANML-LCO1490 (forward) | acccaactgaatggagcGGTCAACAAATCATAAAGATATTGG | COI | Arthropods | ~185 | [31] |
ANML-CO1-CFMRa (reverse) | acgcacttgacttgtcttcGGWACTAATCAATTTCCAAATCC |
Assay Name | Sequence (5′ to 3′) | Tm (°C) | Amplicon Length (bp) | Optimal Conc. (nM) | Cycling Conditions | Mismatch (LEYE) | |
---|---|---|---|---|---|---|---|
LENIS1 | Forward | CATACTCCACACGTCCAAAC | 51.8 | 156 | 900 | 95 °C for 15 s | 3 |
Reverse | TAGGATGGATGCTACCTGTC | 51.8 | 900 | 54 °C for 30 s | 4 | ||
Probe | FAM-AGGGATGTTCGACTGGTTGGCCTC-ZEN/Iowa Black™ FQ | 60.8 | 250 | 72 °C for 30 s | 3 | ||
LENIS3 | Forward | TTGTAGCGACCCTGCTTAC | 51.1 | 88 | 600 | 95 °C for 15 s | 6 |
Reverse | TAGGATGGATGCTACCTGTC | 51.8 | 300 | 60 °C for 30 s | 4 | ||
Probe | FAM-AGGGATGTTCGACTGGTTGGCCTC-ZEN/Iowa Black™ FQ | 60.8 | 250 | 3 |
Metabarcoding (SFF COI) | qPCR | |||
---|---|---|---|---|
Agave Plant | Multiplex | Singleplex | qPCR.LENIS1 | qPCR.LENIS3 |
CB: Cut1—DBT | 2|3 | 2|3 | 2|3 | 2|3 |
CB: Cut2—DBT | 1|3 | 0|3 | 1|3 | 2|3 |
CB: Cut3—DBT | 3|3 | 2|3 | 2|3 | 2|3 |
CB: Swab—DBT | 3|3 | 3|3 | 3|3 | 3|3 |
LS: Cut1—DBT | 3|4 | n/a | 4|4 | 4|4 |
LS: Cut1—DPT | 1|4 | n/a | 1|4 | 1|4 |
CB (all) | 8|9 | 7|9 | 7|9 | 8|9 |
LS (all) | 3|4 | n/a | 4|4 | 4|4 |
Total | 11|13 | 7|9 | 11|13 | 12|13 |
Metric | LENIS1 | LENIS3 |
---|---|---|
R2 | 0.99 | 0.98 |
Slope | −3.39 | −3.59 |
Y-intercept | 42.52 | 42.38 |
Efficiency (%) | 97.07 | 90.07 |
LOQ | 174 | 462 |
LOD | 57 | 84 |
LOD: 2 replicates | 25 | 30 |
LOD: 3 replicates | 15 | 20 |
LOD: 4 replicates | 11 | 16 |
LOD: 5 replicates | 8 | 13 |
LOD: 8 replicates | 5 | 9 |
Taxonomic Group | Order | Family | Species | Common Name |
---|---|---|---|---|
Bats | Chiroptera | Phyllostomidae | Leptonycteris nivalis ** | Mexican long-nosed bat |
Non-target vertebrates | Artiodactyla | Cervidae | Odocoileus hemionus or virginianus ** | Carmen whitetail deer or mule deer |
Carnivora | Canidae | Urocyon cinereoargenteu ** | gray fox | |
Carnivora | Procyonidae | Bassariscus astutus | ringtail cat | |
Plants | Asparagales | Agavaceae | Agave sp. ** | agave |
Gentianales | Rubiaceae | Bouvardia ternifolia ** | firecracker bush | |
Myrtales | Onagraceae | Onagraceae sp. ** | Evening Primrose family | |
Poales | Poaceae | Sporobolus airoides ** | alkali sacaton | |
Poales | Poaceae | Bouteloua curtipendula | sideoats grama | |
Lamiales | Oleaceae | Menodora sp. | menodora | |
Poales | Poaceae | Muhlenbergia sp. | muhly | |
Asterales | Asteraceae | Parthenium sp. | feverfew | |
Lamiales | Plantaginaceae | Plantaginaceae sp. | Plantain family | |
Sapindales | Anacardiaceae | Rhus virens | evergreen sumac | |
Gentianales | Rubiaceae | Rubiaceae sp. | madder family | |
Lamiales | Lamiaceae | Salvia sp. | sage | |
Malvales | Malvaceae | Sphaeralcea sp. | globemallow | |
Lamiales | Bignoniaceae | Tecoma stans | yellow trumpetbush | |
Malpighiales | Euphorbiaceae | Tragia sp. | noseburn | |
Arthropods | Hymenoptera | Apidae | Apis sp. ** | honey bee |
Diptera | Cecidomyiidae | Cecidomyiidae sp. ** | gall and wood midge | |
Coleoptera | Cerambycidae | Cerambycidae sp. ** | longhorn beetle | |
Diptera | Ceratopogonidae | Ceratopogonidae sp. ** | biting midge | |
Coleoptera | Cleridae | Cleridae sp. ** | checkered beetle | |
Coleoptera | Coleoptera sp. ** | beetle order | ||
Trombidiformes | Eupodidae | Eupodidae sp. ** | prostig mite | |
Thysanoptera | Thripidae | Frankliniella occidentalis ** | thrip | |
Hymenoptera | Colletidae | Hylaeus sp. ** | masked bee | |
Entomobryomorpha | Isotomidae | Isotomidae sp. ** | elongate-bodied springtail | |
Hymenoptera | Halictidae | Lasioglossum jubatum ** | sweat bee | |
Lepidoptera | Lepidoptera sp. ** | butterfly and moth order | ||
Hemiptera | Coreidae | Leptoglossus zonatus ** | leaf-footed bug | |
Lepidoptera | Erebidae | Melipotis indomita ** | underwing moth | |
Lepidoptera | Apatelodidae | Olceclostera seraphica ** | seraph moth | |
Coleoptera | Tenebrionidae | Tenebrionidae sp. ** | darkling beetle | |
Araneae | Thomisidae | Thomisidae sp. ** | crab spider | |
Orthoptera | Romaleidae | Brachystola magna | grassland lubber | |
Hemiptera | Pentatomidae | Brochymena hoppingi | rough stink bug | |
Diptera | Chloropidae | Chloropidae sp. | fruit fly | |
Diptera | Syrphidae | Copestylum sp. | hoverfly | |
Diptera | Culicidae | Culex pipiens | house mosquito | |
Lepidoptera | Notodontidae | Datana sp. | prominent moth | |
Phasmatodea | Diapheromeridae | Diapheromeridae sp. | walkingstick | |
Diptera | Diptera sp. | fly order | ||
Entomobryomorpha | Entomobryidae | Entomobryidae sp. | slender springtail | |
Lepidoptera | Pyralidae | Ephestiodes gilvescentella | pyralid moth | |
Lepidoptera | Erebidae | Erebidae sp. | Erebidae moth | |
Hymenoptera | Hymenoptera sp. | ant, bee, wasp, sawfly order | ||
Hymenoptera | Halictidae | Lasioglossum sp. | sweat bee | |
Uropygi | Thelyphonidae | Mastigoproctus giganteus | giant vinegarroon | |
Lepidoptera | Erebidae | Matigramma emmilta | owlet moth | |
Orthoptera | Acrididae | Melanoplus walshii | Walsh’s short-wing grasshopper | |
Mesostigmata | Melicharidae | Melicharidae sp. | melicharid mite | |
Hemiptera | Membracidae | Membracidae sp. | typical treehopper | |
Hemiptera | Aphididae | Myzus persicae | green peach aphid | |
Coleoptera | Nitidulidae | Nitops pallipennis | Nitops sap-feeding beetle | |
Diptera | Tachinidae | Prorhynchops sp. | Tachinid fly | |
Hemiptera | Miridae | Rhinacloa forticornis | western plant bug | |
Sarcoptiformes | Scheloribatidae | Scheloribatidae sp. | Acari mite | |
Mantodea | Mantidae | Stagmomantis californica | California mantis | |
Orthoptera | Tettigoniidae | Tettigoniidae sp. | katydid |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Walker, F.M.; Sanchez, D.E.; Froehlich, E.M.; Federman, E.L.; Lyman, J.A.; Owens, M.; Lear, K. Endangered Nectar-Feeding Bat Detected by Environmental DNA on Flowers. Animals 2022, 12, 3075. https://doi.org/10.3390/ani12223075
Walker FM, Sanchez DE, Froehlich EM, Federman EL, Lyman JA, Owens M, Lear K. Endangered Nectar-Feeding Bat Detected by Environmental DNA on Flowers. Animals. 2022; 12(22):3075. https://doi.org/10.3390/ani12223075
Chicago/Turabian StyleWalker, Faith M., Daniel E. Sanchez, Emma M. Froehlich, Emma L. Federman, Jacque A. Lyman, Meagan Owens, and Kristen Lear. 2022. "Endangered Nectar-Feeding Bat Detected by Environmental DNA on Flowers" Animals 12, no. 22: 3075. https://doi.org/10.3390/ani12223075
APA StyleWalker, F. M., Sanchez, D. E., Froehlich, E. M., Federman, E. L., Lyman, J. A., Owens, M., & Lear, K. (2022). Endangered Nectar-Feeding Bat Detected by Environmental DNA on Flowers. Animals, 12(22), 3075. https://doi.org/10.3390/ani12223075