Effect of Acute and Cumulative Stress on Gene Expression in Mammary Tissue and Their Interactions with Physiological Responses and Milk Yield in Saanen Goats
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Procedures
2.2. Environmental Conditions and Treatment Imposition
2.3. Physiological Data and Milk and Blood Sampling and Analyses
2.4. Biopsy and Gene Expression
2.5. Statistical Analysis
3. Results
3.1. Physiological Data, Cortisol, and Metabolites
3.2. Milk Yield and Quality
3.3. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Hamzaoui, S.; Salama, A.A.K.; Albanell, E.; Such, X.; Caja, G. Physiological Responses and Lactational Performances of Late-Lactation Dairy Goats under Heat Stress Conditions. J. Dairy Sci. 2013, 96, 6355–6365. [Google Scholar] [CrossRef]
- Kruger, L.P.; Nedambale, T.L.; Scholtz, M.M.; Webb, E.C. The Effect of Environmental Factors and Husbandry Practices on Stress in Goats. Small Rumin. Res. 2016, 141, 1–4. [Google Scholar] [CrossRef]
- Gupta, D.; Kashyap, G.; Ashutosh, M. Ashutosh Ameliorative Effect of Vitamin C, Electrolyte and Jaggery on Transportation Stress at Different Flocking Densities in Hot Humid and Winter Seasons on Hormonal Parameters of Goats. Livest. Sci. 2020, 242, 104271. [Google Scholar] [CrossRef]
- Kannan, G.; Batchu, P.; Kouakou, B.; Terrill, T.H.; Estrada-Reyes, Z. PSX-4 Behavior of Goats Subjected to Different Social Isolation Treatments. J. Anim. Sci. 2020, 98, 458. [Google Scholar] [CrossRef]
- Collier, R.J.; Renquist, B.J.; Xiao, Y. A 100-Year Review: Stress Physiology Including Heat Stress. J. Dairy Sci. 2017, 100, 10367–10380. [Google Scholar] [CrossRef]
- Tao, S.; Orellana, R.M.; Weng, X.; Marins, T.N.; Dahl, G.E.; Bernard, J.K. Symposium Review: The Influences of Heat Stress on Bovine Mammary Gland Function. J. Dairy Sci. 2018, 101, 5642–5654. [Google Scholar] [CrossRef]
- Hooper, H.B.; dos Santos Silva, P.; de Oliveira, S.A.; Merighe, G.K.F.; Titto, C.G.; Negrão, J.A. Long-Term Heat Stress at Final Gestation: Physiological and Heat Shock Responses of Saanen Goats. Int. J. Biometeorol. 2021, 65, 2123–2135. [Google Scholar] [CrossRef]
- Van Hertem, T.; Parmet, Y.; Steensels, M.; Maltz, E.; Antler, A.; Schlageter-Tello, A.A.; Lokhorst, C.; Romanini, C.E.B.; Viazzi, S.; Bahr, C.; et al. The Effect of Routine Hoof Trimming on Locomotion Score, Ruminating Time, Activity, and Milk Yield of Dairy Cows. J. Dairy Sci. 2014, 97, 4852–4863. [Google Scholar] [CrossRef]
- Bomfim, G.F.; Merighe, G.K.F.; de Oliveira, S.A.; Negrao, J.A. Effect of Acute Stressors, Adrenocorticotropic Hormone Administration, and Cortisol Release on Milk Yield, the Expression of Key Genes, Proliferation, and Apoptosis in Goat Mammary Epithelial Cells. J. Dairy Sci. 2018, 101, 6486–6496. [Google Scholar] [CrossRef]
- Trevisi, E.; Bertoni, G. Some Physiological and Biochemical Methods for Acute and Chronic Stress Evaluationin Dairy Cows. Ital. J. Anim. Sci. 2009, 8, 265–286. [Google Scholar] [CrossRef]
- Chen, Y.; Arsenault, R.; Napper, S.; Griebel, P. Models and Methods to Investigate Acute Stress Responses in Cattle. Animals 2015, 5, 1268–1295. [Google Scholar] [CrossRef]
- Mehdid, A.; Martí-De Olives, A.; Fernández, N.; Rodríguez, M.; Peris, C. Effect of Stress on Somatic Cell Count and Milk Yield and Composition in Goats. Res. Vet. Sci. 2019, 125, 61–70. [Google Scholar] [CrossRef]
- Caroprese, M.; Albenzio, M.; Marzano, A.; Schena, L.; Annicchiarico, G.; Sevi, A. Relationship between Cortisol Response to Stress and Behavior, Immune Profile, and Production Performance of Dairy Ewes. J. Dairy Sci. 2010, 93, 2395–2403. [Google Scholar] [CrossRef]
- Belhadj Slimen, I.; Najar, T.; Ghram, A.; Abdrrabba, M. Heat Stress Effects on Livestock: Molecular, Cellular and Metabolic Aspects, a Review. J. Anim. Physiol. Anim. Nutr. 2016, 100, 401–412. [Google Scholar] [CrossRef]
- Baumgard, L.H.; Rhoads, R.P. Effects of Heat Stress on Postabsorptive Metabolism and Energetics. Annu. Rev. Anim. Biosci. 2013, 1, 311–337. [Google Scholar] [CrossRef]
- Polycarp, T.N.; Obukowho, E.B.; Yusoff, S.M. Changes in Haematological Parameters and Oxidative Stress Response of Goats Subjected to Road Transport Stress in a Hot Humid Tropical Environment. Comp. Clin. Path. 2016, 25, 285–293. [Google Scholar] [CrossRef]
- Bernabucci, U.; Ronchi, B.; Lacetera, N.; Nardone, A. Markers of Oxidative Status in Plasma and Erythrocytes of Transition Dairy Cows During Hot Season. J. Dairy Sci. 2002, 85, 2173–2179. [Google Scholar] [CrossRef]
- Hou, Q.; Cymbalyuk, E.; Hsu, S.-C.; Xu, M.; Hsu, Y.-T. Apoptosis Modulatory Activities of Transiently Expressed Bcl-2: Roles in Cytochrome c Release and Bax Regulation. Apoptosis 2003, 8, 617–629. [Google Scholar] [CrossRef]
- National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids; National Research Council: Washington, DC, USA, 2007. [Google Scholar]
- Buffington, D.E.; Collazo-Arocho, A.; Canton, G.H.; Pitt, D.; Thatcher, W.W.; Collier, R.J. Black Globe-Humidity Index (BGHI) as Comfort Equation for Dairy Cows. Trans. ASAE 1981, 24, 0711–0714. [Google Scholar] [CrossRef]
- Silanikove, N.; Koluman, N. Impact of Climate Change on the Dairy Industry in Temperate Zones: Predications on the Overall Negative Impact and on the Positive Role of Dairy Goats in Adaptation to Earth Warming. Small Rumin. Res. 2015, 123, 27–34. [Google Scholar] [CrossRef]
- de Almeida, A.M.; Zachut, M.; Hernández-Castellano, L.E.; Šperanda, M.; Gabai, G.; Mobasheri, A. Biomarkers of Fitness and Welfare in Dairy Animals: Healthy Living. J. Dairy Res. 2019, 86, 379–387. [Google Scholar] [CrossRef] [PubMed]
- Raynal-Ljutovac, K.; Pirisi, A.; de Crémoux, R.; Gonzalo, C. Somatic Cells of Goat and Sheep Milk: Analytical, Sanitary, Productive and Technological Aspects. Small Rumin. Res. 2007, 68, 126–144. [Google Scholar] [CrossRef]
- Wehr, H.M.; Frank, F.F. Standard Methods for the Examination of Dairy Products; American Public Health Association: Washington, DC, USA, 2004. [Google Scholar]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Maia, A.S.C.; da Silva, R.G.; Nascimento, S.T.; Nascimento, C.C.N.; Pedroza, H.P.; Domingos, H.G.T. Thermoregulatory Responses of Goats in Hot Environments. Int. J. Biometeorol. 2015, 59, 1025–1033. [Google Scholar] [CrossRef] [PubMed]
- Sejian, V.; Maurya, V.P.; Naqvi, S.M.K. Adaptive Capability as Indicated by Endocrine and Biochemical Responses of Malpura Ewes Subjected to Combined Stresses (Thermal and Nutritional) in a Semi-Arid Tropical Environment. Int. J. Biometeorol. 2010, 54, 653–661. [Google Scholar] [CrossRef] [PubMed]
- Hooper, H.B.; Silva, P.d.S.; de Oliveira, S.A.; Meringhe, G.K.F.; Lacasse, P.; Negrão, J.A. Effect of Heat Stress in Late Gestation on Subsequent Lactation Performance and Mammary Cell Gene Expression of Saanen Goats. J. Dairy Sci. 2020, 103, 1982–1992. [Google Scholar] [CrossRef] [PubMed]
- Fulkerson, W.; A Jamieson, P. Pattern of Cortisol Release in Sheep Following Administration of Synthetic ACTH or Imposition of Various Stressor Agents. Aust. J. Biol. Sci. 1982, 35, 215. [Google Scholar] [CrossRef]
- Verkerk, G.A.; Macmillan, K.L.; McLeay, L.M. Adrenal Cortex Response to Adrenocorticotropic Hormone in Dairy Cattle. Domest. Anim. Endocrinol. 1994, 11, 115–123. [Google Scholar] [CrossRef]
- Bomfim, G.F.; Merighe, G.K.F.; de Oliveira, S.A.; Negrao, J.A. Acute and Chronic Effects of Cortisol on Milk Yield, the Expression of Key Receptors, and Apoptosis of Mammary Epithelial Cells in Saanen Goats. J. Dairy Sci. 2022, 105, 818–830. [Google Scholar] [CrossRef]
- Maurya, V.P.; Sejian, V.; Kumar, D.; Naqvi, S.M.K. Impact of Heat Stress, Nutritional Restriction and Combined Stresses (Heat and Nutritional) on Growth and Reproductive Performance of Malpura Rams under Semi-Arid Tropical Environment. J. Anim. Physiol. Anim. Nutr. 2016, 100, 938–946. [Google Scholar] [CrossRef]
- Celi, P. The Role of Oxidative Stress in Small Ruminants’ Health and Production. Rev. Bras. Zootec. 2010, 39, 348–363. [Google Scholar] [CrossRef]
- Paape, M.J.; Wiggans, G.R.; Bannerman, D.D.; Thomas, D.L.; Sanders, A.H.; Contreras, A.; Moroni, P.; Miller, R.H. Monitoring Goat and Sheep Milk Somatic Cell Counts. Small Rumin. Res. 2007, 68, 114–125. [Google Scholar] [CrossRef]
- Barrón-Bravo, O.G.; Gutiérrez-Chávez, A.J.; Ángel-Sahagún, C.A.; Montaldo, H.H.; Shepard, L.; Valencia-Posadas, M. Losses in Milk Yield, Fat and Protein Contents According to Different Levels of Somatic Cell Count in Dairy Goats. Small Rumin. Res. 2013, 113, 421–431. [Google Scholar] [CrossRef]
- Boutinaud, M.; Herve, L.; Quesnel, H.; Lollivier, V.; Finot, L.; Dessauge, F.; Chanat, E.; Lacasse, P.; Charton, C.; Guinard-Flament, J. Review: The Cellular Mechanisms Underlying Mammary Tissue Plasticity during Lactation in Ruminants. Animal 2019, 13, s52–s64. [Google Scholar] [CrossRef]
- Herve, L.; Quesnel, H.; Lollivier, V.; Boutinaud, M. Regulation of Cell Number in the Mammary Gland by Controlling the Exfoliation Process in Milk in Ruminants. J. Dairy Sci. 2016, 99, 854–863. [Google Scholar] [CrossRef]
Trait | 08:00 h | 12:00 h | 18:00 h | |
---|---|---|---|---|
1st day 190—lactation | AT * | 26.8 | 33.0 | 26.3 |
RH * | 71.2 | 54.9 | 51.6 | |
THI | 77 | 83 | 74 | |
BGHI | 31.8 | 39.2 | 31.3 | |
2nd day 191—lactation | AT | 26.0 | 28.0 | 25.5 |
RH | 54.1 | 59.9 | 66.2 | |
THI | 76 | 74 | 74 | |
BGHI | 33.3 | 30.9 | 30.3 | |
3rd day 192—lactation | AT | 26.8 | 27.5 | 24.4 |
RH | 67.5 | 64.5 | 59.1 | |
THI | 77 | 76 | 72 | |
BGHI | 32.7 | 31.8 | 29.0 | |
4th day 193—lactation | AT | 25.5 | 27.9 | 28.5 |
RH | 63.1 | 65.2 | 68.2 | |
THI | 74 | 78 | 79 | |
BGHI | 30.3 | 33.1 | 33.9 |
Gene 1 | Primer Sequences | GenBank Code | Amplicon |
---|---|---|---|
GR | 3′ CCATTTCTGTTCACGGTGTG 5′ | XM_005683087 | 132 |
5′ CTGAACCGACAGGAATTGGT 3′ | |||
SOD | 3′ TGTTGCCATCGTGGATATTGTAG 5′ | NM_001285550 | 102 |
5′ CCCAAGTCATCTGGTTTTTCATG 3′ | |||
GPX | 3′ GCAAGGTGCTGCTCATTGAG 5′ | XM_005695962 | 82 |
5′ CGCTGCAGGTCATTCATCTG 3′ | |||
CAT | 3′3′ GCTCCAAATTACTACCCCAATAGC 5′ | NM_001035386 | 104 |
5′ GCACTGTTGAAGCGCTGTACA 3′ | |||
GSH | 3′3′ GAGAACGCTGGCATTGAG 5′ | NM_001114190 | 143 |
5′ AGCAGGCAGTCAACATCT 3′ | |||
TRX | 3′ AGGAGAAAGCTGTGGAGAAA 5′ | NM_174625 | 94 |
5′ TTATCCCTTGATGGAATCGT 3′ | |||
TNF-α | 3′ TCTTCTCAAGCCTCAAGTAACAAGC 5′ | EU276079 | 103 |
5′ CCATGAGGGCATTGGCATAC 3′ | |||
IL-1β | 3′ TCCACCTCCTCTCACAGGAAA 5′ | NM_174093 | 99 |
5′ TACCCAAGGCCACAGGAA 3′ | |||
IL6 | 3′ TGCTGGTCTTCTGGAGTATC 5′ | NM_173923 | 153 |
5′ GTGGCTGGAGTGGTTATTAG 3′ | |||
IL8 | 3′ TGTGAAGCTGCAGTTCTGTCAA 5′ | AF232704 | 130 |
5´ TTTCACAGTGTGGCCCACTCT 3′ | |||
IFN-γ | 3′ TTCAGAGCCAAATTGTCTCC 5′ | NM_174086 | 205 |
5′ AGTTCATTTATGGCTTTGCGC 3′ | |||
ACACA | 3′ TGGTCTGGCCTTACACATGA 5′ | NM_174224 | 112 |
5′ TGCTGGAGAGGCTACAGTGA 3′ | |||
LPIN1 | 3′ GAGGGGAAGAAACACCACAA 5′ | NM_001206156 | 202 |
5′ GTAGCTGACGCTGGACAACA 3′ | |||
GAPDH | 3′ GGTGATGCTGGTGCTGAG 5′ | NM_001034034 | 181 |
5′ TGACAATCTTGAGGGTGTTG 3′ |
Physiological Data 1 | Heat Stress | Control | p-Value | ||
T 2 | H 2 | T*H 2 | |||
RT | 39.20 ± 0.10 | 38.97 ± 0.05 | 0.35 | 0.01 | 0.01 |
RR | 78.34 ± 3.90 | 74.41 ± 3.71 | 0.04 | 0.01 | 0.01 |
HR | 100.51 ± 1.30 | 98.95 ± 2.34 | 0.25 | 0.11 | 0.23 |
Physiological Data 1 | ACTH | Control | p-Value | ||
T | H | T*H | |||
RT | 38.91 ± 0.08 | 38.95 ± 0.06 | 0.15 | 0.01 | 0.10 |
RR | 52.50 ± 4.53 | 54.29 ± 3.72 | 0.40 | 0.01 | 0.21 |
HR | 98.04 ± 1.93 | 98.29 ± 1.77 | 0.23 | 0.01 | 0.16 |
Physiological Data 1 | Hoof Care | Control | p-Value | ||
T | H | T*H | |||
RT | 39.09 ± 0.05 | 39.02 ± 0.06 | 0.38 | 0.01 | 0.01 |
RR | 36.20 ± 2.64 | 38.90 ± 2.89 | 0.45 | 0.01 | 0.20 |
HR | 99.64 ± 1.56 | 101.10 ± 2.00 | 0.48 | 0.03 | 0.37 |
Physiological Data 1 | Rain | Control | p-Value | ||
T | H | T*H | |||
RT | 38.98 ± 0.07 | 38.52 ± 0.05 | 0.26 | 0.01 | 0.01 |
RR | 32.45 ± 2.40 | 49.40 ± 3.62 | 0.33 | 0.01 | 0.01 |
HR | 100.62 ± 1.84 | 98.67 ± 1.16 | 0.22 | 0.01 | 0.12 |
Measurements 1 Mg/dL | Stress | Control | p-Value | ||
---|---|---|---|---|---|
T 2 | H 2 | T*H 2 | |||
GLU | 75.80 a ± 3.01 | 72.40 b ± 3.77 | 0.04 | 0.01 | 0.09 |
UREA | 55.25 ± 2.13 | 56.33 ± 2.15 | 0.10 | 0.01 | 0.01 |
TP | 74.56 ± 1.86 | 73.90 ± 1.75 | 0.23 | 0.32 | 0.40 |
TG | 18.27 a ± 0.32 | 15.88 b ± 0.46 | 0.01 | 0.07 | 0.62 |
CHOL | 106.42 a ± 2.74 | 99.29 b ± 3.83 | 0.01 | 0.02 | 0.06 |
HDL | 32.45 a ± 0.51 | 30.87 b ± 0.51 | 0.02 | 0.40 | 0.73 |
LDL | 64.35 ± 4.19 | 69.78 ± 4.73 | 0.15 | 0.01 | 0.10 |
Milk Yield and Milk Quality 2 | Stress | Control | p-Value | ||
---|---|---|---|---|---|
T 1 | H 1 | T*H 1 | |||
Milk yield (kg) | 1.76 ± 0.15 | 2.09 ± 0.23 | 0.10 | 0.18 | 0.04 |
Fat (%) | 4.25 ± 0.40 | 4.60 ± 0.20 | 0.31 | 0.69 | 0.75 |
Protein (%) | 3.35 ± 0.36 | 3.40 ± 0.25 | 0.82 | 0.15 | 0.11 |
Lactose (%) | 4.04 ± 0.66 | 4.03 ± 0.60 | 0.81 | 0.14 | 0.13 |
SCC (cells/mL) | 1 660 a ± 203 | 1 215 b ± 119 | 0.05 | 0.15 | 0.01 |
Total bacterial count (CFU/mL) | 20.50 ± 10.86 | 14.26 ± 12.31 | 0.57 | 0.62 | 0.50 |
Enterobacteriaceae (CFU/mL) | |||||
Staphylococcus sp. (CFU/mL) | 10.4 ± 3.4 | 9.35 ± 4.40 | 0.21 | 0.25 | 0.33 |
Gene Expression 1 | Stress | Control | p-Value T 2 |
---|---|---|---|
GR | 1.34 a ± 0.09 | 1.02 b ± 0.02 | 0.03 |
SOD | 1.70 a ± 0.11 | 1.14 b ± 0.06 | 0.01 |
GSH | 0.99 ± 0.14 | 2.77 ± 1.41 | 0.39 |
GPX | 1.07 ± 0.31 | 1.00 ± 0.03 | 0.38 |
CAT | 1.33 a ± 0.08 | 1.00 b ± 0.04 | 0.02 |
TRX | 1.09 ± 0.12 | 1.33 ± 0.26 | 0.57 |
IFN-γ | 2.89 a ± 0.28 | 1.34 b ± 0.24 | 0.01 |
TNF-a | 2.21 ± 0.45 | 1.33 ± 0.27 | 0.25 |
IL-1 | 1.38 ± 0.16 | 1.21 ± 0.26 | 0.69 |
IL-6 | 4.14 ± 0.82 | 1.63 ± 0.48 | 0.17 |
IL-8 | 3.01 ± 0.50 | 2.76 ± 1.29 | 0.89 |
LPIN1 | 1.67 ± 0.33 | 1.50 ± 0.25 | 0.77 |
ACACA | 1.62 ± 0.23 | 1.09 ± 0.25 | 0.22 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vasconcelos, M.L.d.; Silva, P.d.S.; Hooper, H.B.; Merighe, G.K.F.; Oliveira, S.A.d.; Negrão, J.A. Effect of Acute and Cumulative Stress on Gene Expression in Mammary Tissue and Their Interactions with Physiological Responses and Milk Yield in Saanen Goats. Animals 2023, 13, 3740. https://doi.org/10.3390/ani13233740
Vasconcelos MLd, Silva PdS, Hooper HB, Merighe GKF, Oliveira SAd, Negrão JA. Effect of Acute and Cumulative Stress on Gene Expression in Mammary Tissue and Their Interactions with Physiological Responses and Milk Yield in Saanen Goats. Animals. 2023; 13(23):3740. https://doi.org/10.3390/ani13233740
Chicago/Turabian StyleVasconcelos, Marta Liliane de, Priscila dos Santos Silva, Henrique Barbosa Hooper, Giovana Krempel Fonseca Merighe, Sandra Aparecida de Oliveira, and João Alberto Negrão. 2023. "Effect of Acute and Cumulative Stress on Gene Expression in Mammary Tissue and Their Interactions with Physiological Responses and Milk Yield in Saanen Goats" Animals 13, no. 23: 3740. https://doi.org/10.3390/ani13233740