Next Article in Journal
Extraction and Elevation of Cell-Free DNA under Mastitis and Heat Stress in Dairy Cattle
Previous Article in Journal
COVID-19’s Impact on the Pan African Sanctuary Alliance: Challenging Times and Resilience from Its Members
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 9
10.3390/ani13091485
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Insertion/Deletion (InDel) Variants within the Sheep Fat-Deposition-Related PDGFD Gene Strongly Affect Morphological Traits

by
Yunyun Luo
1,
Mengyang Zhang
1,
Zhengang Guo
1,2,
Dwi Wijayanti
1,
Hongwei Xu
3,*,
Fugui Jiang
4 and
Xianyong Lan
1,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China
2
Bijie Animal Husbandry and Veterinary Science Research Institute, Bijie 551700, China
3
College of Life Science and Engineering, Northwest Minzu University, Lanzhou 730030, China
4
Shandong Key Lab of Animal Disease Control and Breeding, Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Jinan 250100, China
*
Authors to whom correspondence should be addressed.
Animals 2023, 13(9), 1485; https://doi.org/10.3390/ani13091485
Submission received: 30 December 2022 / Revised: 20 April 2023 / Accepted: 23 April 2023 / Published: 27 April 2023
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Among the most important factors in the production of livestock are morphological traits, such as body weight, body length, chest depth, chest width, cannon circumference, and the body index. Platelet-derived growth factor D (PDGFD) is a candidate gene that has the potential to affect fat deposition and body size in sheep. In this study, we discovered two intronic InDels (13 bp deletion, 14 bp insertion) with the potential to significantly affect the morphological traits of three different indigenous Chinese sheep breeds. These InDels can be used as DNA markers for sheep marker-assisted selection (MAS) breeding.

Abstract

Platelet-derived growth factor D (PDGFD) is a member of the PDGF gene family, and it plays an important role in the regulation of adipocyte development in mammals. Furthermore, genome-wide association studies (GWAS) have previously identified it as a candidate gene associated with fleece fiber variation, body size, and the fat-tail phenotype in domestic Chinese sheep. In this study, a total of 1919 indigenous Chinese sheep were genotyped to examine the association between nucleotide sequence variations in PDGFD and body morphology. Our results detected both a 14 bp insertion in intron 2 and a 13 bp deletion in intron 4 of PDGFD. Moreover, these two InDel loci had low to moderate polymorphism. Notably, the 13 bp deletion mutation of PDGFD was found to significantly affect sheep body size. Yearling rams in the Luxi black-headed sheep (LXBH) containing a heterozygous genotype (insertion/deletion, ID) were found to have larger body length, chest depth, and body weight than those with wild genotypes. Furthermore, adult ewes in the Guiqian semi-fine wool sheep (GSFW) containing a homozygous mutation (deletion/deletion, DD) were found to have smaller chest width than their peers. Moreover, yearling ewes in this group with the same homozygous mutation were found to have lower body weight, chest width, and cannon circumference compared to those of other individuals. This study demonstrates that PDGFD InDel polymorphisms have the potential to be effective molecular markers to improve morphological traits in domestic Chinese sheep.

1. Introduction

China has many extensive and genetically diverse types of sheep that are well adapted to local agricultural and climate conditions, being resistant to common diseases [1]. Lanzhou fat-tailed sheep (LFT) have long tails and deposit the majority of their adipose tissue within them, thus allowing them to adapt well to harsh climates and environmental conditions [2,3]. Luxi black-headed sheep (LXBH) have short tails with plenty of fat, as well as a high fertility rate and excellent meat production capacity [4,5]. Furthermore, Guiqian semi-fine wool sheep (GSFW) are selected for their dual purpose of high mutton and wool production [6]. Increasing sheep productivity and improving meat quality are consistent priorities necessary for the continuous development of the Chinese sheep breeding industry. Livestock growth and carcass traits belong to the medium heritability range (0.20–0.35); thus, the accuracy of sheep selection and breeding can be improved by gene marker-assisted and genomic selection of candidate genes related to the above traits [7,8].
Previous selective sweep analyses and genome-wide association studies (GWAS) identified several key candidate genes functionally associated with growth, body size, and tail morphology in sheep, such as platelet derived growth factor D (PDGFD), bone morphogenetic protein 2 (BMP2), thyroid-stimulating hormone receptor (TSHR), xylulokinase (XYLB), and fibroblast growth factor 7 (FGF7) [9,10]. In recent years, the PDGFD gene was discovered to belong to the PDGF family, which encodes for a mitogenic factor used by mesenchymal cells and is located in the blood serum [11]. Moreover, PDGFD contains a tissue-specific expression pattern. It is expressed more abundantly in the pancreas, pituitary gland, ovaries, and adipose tissue than in other tissues in humans [12]. Studies have shown that PDGFD is involved in various intracellular signaling pathways, (PI3K/Akt, MAPK, mTOR, and Notch signaling) and regulates IGF1R, VEGF, and Snail, among other proteins. By affecting these pathways, PDGFD has the potential to regulate multiple-organ fibrosis, atherosclerosis, tissue repair, and cancer in humans, as well as fleece fiber diameter in domestic sheep [13,14,15,16].
Furthermore, PDGFD is highly conserved amongst different species [17]. In a recent study, one cattle nonreference sequence (NRS) variant overlapping with the intergenic region between the protein-coding genes PDGFD and DYNC2H1 (dynein cytoplasmic 2 heavy chain 1) was identified by multiple de novo assemblies, which may have biological significance [18]. PDGFD was also shown to affect intermuscular fat deposition in Dianzhong cattle [19]. Furthermore, PDGFD plays a critical role with regard to adipocyte proliferation and differentiation, and it is directly and indirectly involved in fat metabolism as it relates to the tails of sheep [10]. There are two single-nucleotide polymorphisms (SNPs) within the PDGFD gene that have been shown to significantly affect the size of sheep tails [20]. These studies suggest that PDGFD is closely related to sheep growth and development. However, it is notable that the functional role of PDGFD polymorphisms in relation to morphological traits of sheep is still poorly understood. Therefore, we aimed to characterize InDel variations of PDGFD in three different Chinese sheep breeds to validate the association between InDel polymorphisms and morphological traits, as well as provide fundamental reference data for use of PDGFD in domestic sheep breeding.

2. Materials and Methods

2.1. Animals, Phenotypic Data, and DNA Extraction

A total of 1919 sheep of three breeds were chosen for this study: Guiqian semi-fine wool sheep (GSFW, n = 1243, Bijie, China), Luxi black-headed sheep (LXBH, n = 618, Liaocheng, China), and Lanzhou fat-tailed sheep (LFT, n = 65, Lanzhou, China). Of the 618 LXBH sheep, 37.2% (n = 230) were lambs (≤3 months), 44.3% (n = 274) were yearlings (4–18 months old), and 18.5% (n = 114) were adults (>18 months). Among the GSFW group, 477 animals already had body size records (yearling rams, n = 143; yearling ewes, n = 155; adult ewes, n = 179). Within each sheep breed, healthy sheep individuals raised under similar feeding and management conditions were selected as tested sheep in this study. Morphological characteristics, i.e., body weight, body height, body length, chest circumference, chest depth, chest width, and cannon circumference, were recorded for each sheep in the study [21,22]. On the basis of prior established formulas, body size indices, such as body trunk index (the ratio of chest circumference to body length), body length index (the ratio of body length to body height), chest width index (the ratio of chest width to chest depth), chest circumference index (the ratio of chest circumference to body height), cannon circumference index (the ratio of cannon circumference to body height), and limb length index (the ratio of the difference between body height and chest depth to body height), were also calculated [23,24]. Furthermore, genomic DNA was extracted from ear tissues using standard phenol/chloroform extraction procedures as described previously and diluted to 20 ng/μL with ddH2O after determination of concentration [25]. To study genetic differences in the PDGFD gene, 30 DNA samples from each sheep breed were chosen at random and placed into three different DNA pools [26,27,28].

2.2. InDel Detection and Genotyping

The Ensembl database was used to find six possible InDel sites within sheep PDGFD gene. NCBI Primer-Blast was subsequently used to design six pairs of primers (Table 1) based on the PDGFD reference sequence for sheep (NC_056068.1). These primers were synthesized via Sangon Biotech (Xi’an, Shaanxi, China). PCR was performed using a 13 μL reaction volume and Touchdown program described previously [25,26]. PCR products were then directly examined via electrophoresis with a 3% agarose gel for confirmation.

2.3. Statistical Analyses

Genotype frequency, allele frequency, and population indices (heterozygosity, He; the number of effective alleles, Ne; polymorphism information content, PIC) were all calculated using Microsoft Excel (2019). Population indices were calculated following Nei’s methods [29]. In order to check whether the polymorphisms deviated from the Hardy–Weinberg equilibrium (HWE), the chi-square test (χ2) was carried out. Differences in allele frequencies, as well as the genotypic distribution, for each sheep population were assessed using the χ2 test or Fisher’s exact test. If all expected counts were greater than 5, the Pearson chi-square test was used. If there was a certain expected count <5, the Fisher exact test was used. The SHEsis online platform (http://analysis.bio-x.cn, accessed on 4 October 2022) was used for linkage disequilibrium (LD) analysis. The association between different genotypes of InDels and morphological traits of each sheep breed was evaluated using the Student’s t-test (only two genotypes) or one-way ANOVA (three genotypes) via SPSS 25 software. The statistical model used was as follows: Yijk = µ + Gi + Sj + Ak + eijk, in which Yijk represents the phenotypic value for morphological traits, μ represents the population mean, Gi represents the fixed PDGFD genotype effect for each group of sheep, Sj represents the fixed effect of gender, Ak represents the fixed effect of the age, and eijk represents the random error.

3. Results

3.1. InDel Genotyping and Sequencing

On the basis of the combined results of gel electrophoresis, as well as sequencing profiles, two noncoding InDel mutation sites within PDGFD gene were detected: a 14 bp insertion (rs590816164) in intron 2, and a 13 bp deletion in intron 4 (rs1092650847) (Figure 1). Genotyping analysis showed that there were two genotypes at the P4-ins-14bp site (insertion/deletion, ID, 312 bp/298 bp; deletion/deletion, DD, 298 bp) (Figure 2), and three genotypes at P5-del-13bp site (insertion/insertion, II, 185 bp; ID, 185 bp/172 bp; DD, 172 bp) (Figure 3). The P4-ins-14bp locus was polymorphic for both LFT and GSFW sheep, whereas the P5-del-13bp showed genetic polymorphisms amongst all three sheep breeds.

3.2. Genetic Parameters and Linkage Disequilibrium Analysis

Genotypes, allele frequencies, and population genetics analyses are shown in Table 2. Amongst all sheep breeds, the frequency of the wild genotype was greater than 0.6 at both InDel loci. Furthermore, wildtype frequency was found to be greater than the frequency for both homozygous mutants and heterozygotes. Population genetic analyses indicated that the P4-ins-14bp locus demonstrated low levels of polymorphism (PIC < 0.25) amongst all tested sheep breeds. Furthermore, the P5-del-13bp demonstrated low levels of polymorphism (PIC < 0.25) for Luxi black-headed sheep and Lanzhou fat-tailed sheep, and moderate levels of polymorphism (0.25 < PIC < 0.5) for Guiqian semi-fine wool sheep. Furthermore, in GSFW populations, the P4-ins-14bp locus was found to deviate from the Hardy–Weinberg equilibrium (p < 0.05). No significant deviations from HWE were identified for the P5-del-13bp locus in all tested sheep breeds (p > 0.05).
Chi-square test results pertaining to the allelic frequency distribution of both InDel mutation sites amongst all three sheep breeds showed that the allele and genotype frequencies of the P4-ins-14bp locus were significantly different amongst all three breeds (p < 0.05) (Table 3). Furthermore, at the P5-del-13bp locus, the frequencies for both genotype and allele were considered statistically different amongst all three breeds (Table 4). According to linkage disequilibrium analysis (Figure 4), both P4-ins-14bp and P5-del-13bp loci showed a strong LD state within the LFT (D′ = 1, r2 = 0) population, and a weak linkage state in the GSFW (D′ = 0.060, r2 = 0.001) population.

3.3. Association Analysis of PDGFD InDel and Body Morphometric Traits

The association between genotype and phenotypic traits (seven body size traits and six body size indices) was analyzed. Significant deviations from HWE were identified for the P4-ins-14bp locus (p = 0.001142); thus, this site was not used for association analysis [30]. For the P5-del-13bp locus, significant differences were observed in chest depth, body length, and body weight amongst LXBH yearling rams (p < 0.05), and individuals with wild genotype had a smaller overall body size than individuals with a heterozygous genotype. Furthermore, a homozygous mutation (DD) at the P5-del-13bp locus showed a strong, negative influence on body weight, chest width, and cannon circumference in the GSFW sheep (p < 0.05). The body weight, chest width, and cannon circumference of yearling ewes with DD genotypes were significantly smaller than those of other individuals (p < 0.05). The chest width of adult ewes with a homozygous mutation was significantly smaller compared to other individuals (p < 0.05) (Table 5). Some traits did not differ significantly amongst individuals with different genotypes, and these results are not shown in the results table.

4. Discussion

The PDGF family includes proteins that are both proangiogenic and regulatory factors stimulating connective tissue growth [31]. PDGF comprises four subtypes: PDGFA, PDGFB, PDGFC, and PDGFD [32]. A prior study suggested that PDGFC is involved in adipose expansion [33]. The protein coded for by PDGFD mediates PDGF receptor chain tyrosine kinase (PDGFR-β) dimer formation and activation [34]. PDGFD is associated with angiogenesis required for tissue development and growth due to the inclusion of PDGF receptors on the surface of adipocytes and pre-adipocytes [35]. Furthermore, PDGFD has been shown to play a key role in the formation and development of pre-adipocytes, which can be seen in all species of mammals [27].
Adipose tissue is the main means of caloric storage in the body and plays a crucial role in the regulation of metabolism and body shape [36]. The large amount of tail fat in fat-tailed sheep was shown to have a significant influence on fat deposition in other parts of their bodies [37]. Thus, elucidating genetic variations of genes related to fat metabolism and deposition, as well as analyzing how these variations associate with morphological traits may provide more information about useful molecular markers to genetically improve sheep morphology [38]. For example, the gene encoding for cyclic AMP response element-binding protein 1 (CREB1) regulates fat metabolism in sheep adipose tissue, with one mutation within its first intron region strongly associated with differences in body measurement traits [39,40]. PDGFD, which is located on chromosome 15, has also been identified as a candidate gene for the phenotypic traits of sheep (i.e., fat tail and body size) [5,10].
Related studies have shown that genes affecting animal reproductive traits may also affect animal morphological and growth-related traits. Recently, Kang et al. discovered that a 7 bp InDel variation in intron 8 of lysine demethylase 3B (KDM3B) not only affected the litter size of Australian white sheep, but was also significantly associated with the body size traits of Lanzhou fat-tailed sheep and Luxi black-headed sheep [41,42]. Previously, Su et al. discovered that an 18 bp deletion in intron 2 of PDGFD was associated with litter size for Australian white sheep [25]. Data from the Ruminant Genome and NCBI databases showed that PDGFD is highly expressed in the reproductive system (i.e., ovary) [25]. These results imply that PDGFD may control multiple traits simultaneously (i.e., gene pleiotropism).
With these studies in mind, PDGFD was considered as a potential candidate gene for our study. In this study, we detected two InDel mutations, P4-ins-14bp and P5-del-13bp, both of which were found to be in Hardy–Weinberg equilibrium (p > 0.05) for Lanzhou fat-tailed sheep and Luxi black-headed sheep. These results indicate that no large-scale migration or mutations occurred in the tested population. It is worth noting that the P4-ins-14bp InDel existed in both Lanzhou fat-tailed sheep (2.59%) and Guiqian semi-fine wool sheep (8.31%) populations with relatively low frequency; however, Luxi black-headed sheep populations did not have this InDel. This may be due to different breeding requirements for those sheep varieties or the relatively conservative nucleotide sequence of PDGFD, as its genetic variation has been shown to be species-specific and vary on the basis of population size with regard to analysis and testing [43]. The P5-del-13bp locus showed moderate polymorphism in Guiqian semi-fine wool sheep, indicating that this population has rich genetic diversity.
Furthermore, both P4-ins-14bp and P5-del-13bp loci were located in the intronic regions of PDGFD. Studies have shown that intronic mutations may function to regulate transcriptional activity by preventing or increasing transcription factor binding, thus influencing gene expression via splicing, which leads to phenotypic variation [44,45,46,47]. Wang et al. found an intron mutation at the seventh intron of human transcription factor hepatocyte nuclear factor 1A (HNF-1A) that caused abnormal mRNA splicing and impaired its activity as a transcription factor [48]. Li et al. identified nucleotide mutations within a cis-regulatory element in the bone morphogenetic protein receptor type-1B (BMPR1B) intron 1, which could control pig prolificacy via the cis-regulation of BMPR1B expression [49]. Therefore, we further investigated the effect of these two intronic mutations on the phenotypic variation of tested sheep. A strong genotype–phenotype association between the P5-del-13bp polymorphism and morphological traits of local sheep was observed. For Guiqian semi-fine wool sheep, the P5-del-13bp locus was found to negatively influence body weight, which is associated with negative responses in fleece production [50]. In the future, further studies are needed to explore the mechanism of phenotypic change caused by noncoding genetic variants. Overall, our findings indicate that PDGFD is a critical gene related to morphological traits in sheep.

5. Conclusions

In this study, a 14 bp insertion in intron 2 and a 13 bp deletion in intron 4 within the PDGFD gene were detected in multiple breeds of sheep. Additionally, the 13 bp noncoding genetic variation had a significant effect on morphological traits (body weight, body length, chest depth, chest width, cannon circumference, etc.) of Luxi black-headed sheep and Guiqian semi-fine wool sheep, indicating the possibility of using these InDel mutation sites as DNA markers to increase the growth and development of indigenous Chinese sheep. However, the concrete mechanisms via which PDGFD gene and the 13 bp deletion affect morphological traits are still indistinct.

Author Contributions

Resources, F.J., H.X. and Z.G.; data curation, F.J., H.X. and Z.G.; methodology, M.Z.; formal analysis, D.W.; writing—original draft preparation, Y.L.; writing—review and editing, X.L. and H.X.; project administration, X.L. and H.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Natural and Science Foundation of China (No.32060741).

Institutional Review Board Statement

All animal tests performed in this study were conducted under the supervision and guidance of the Animal Welfare Committee of Northwest Agriculture and Forestry University (NWAFU-314020038), and all procedures were in accordance with their specifications.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available upon request from corresponding author.

Acknowledgments

The authors are grateful to Shaanxi Key Laboratory of Molecular Biology for Agriculture and The Life Science Research Core Services (LSRCS) of Northwest A&F University (Northern Campus) for their cooperation and support. The authors would like to thank the staff of Shandong Academy of Agricultural Sciences, Guizhou Xinwumeng Ecological Animal Husbandry Development Co., Ltd., and Gansu Ruilin Science and Technology Breeding company for collecting samples.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Wei, C.; Wang, H.; Liu, G.; Wu, M.; Cao, J.; Liu, Z.; Liu, R.; Zhao, F.; Zhang, L.; Lu, J.; et al. Genome-wide analysis reveals population structure and selection in Chinese indigenous sheep breeds. BMC Genom. 2015, 16, 194. [Google Scholar] [CrossRef] [PubMed]
  2. Yue, Y.; Cheng, X.; Zhao, S.G.; Liu, Z.; Liu, L.S.; Zhou, R.; Wu, J.P.; Brown, M.A. Effects of tail docking on the expression of genes related to lipid metabolism in Lanzhou fat-tailed sheep. Genet. Mol. Res. 2016, 15, gmr7323. [Google Scholar] [CrossRef] [PubMed]
  3. Li, J.; Xu, H.; Liu, X.; Xu, H.; Cai, Y.; Lan, X. Insight into the possible formation mechanism of the intersex phenotype of Lanzhou Fat-Tailed sheep using whole-genome resequencing. Animals 2020, 10, 944. [Google Scholar] [CrossRef]
  4. Akhatayeva, Z.; Li, H.; Mao, C.; Cheng, H.; Zhang, G.; Jiang, F.; Meng, X.; Yao, Y.; Lan, X.; Song, E.; et al. Detecting novel Indel variants within the GHR gene and their associations with growth traits in Luxi Blackhead sheep. Anim. Biotechnol. 2022, 33, 214–222. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, Z.; Tan, X.; Wang, J.; Jin, Q.; Meng, X.; Cai, Z.; Cui, X.; Wang, K. Whole genome sequencing of Luxi Black Head sheep for screening selection signatures associated with important traits. Anim. Biosci. 2022, 35, 1340–1350. [Google Scholar] [CrossRef]
  6. Li, Y.; Wang, Y.; Shen, X.; Liu, F. The combinations of sulfur and molybdenum fertilizations improved antioxidant capacity of grazing Guiqian semi-fine wool sheep under copper and cadmium stress. Ecotoxicol. Environ. Saf. 2021, 222, 112520. [Google Scholar] [CrossRef]
  7. Raza, S.; Khan, S.; Amjadi, M.; Abdelnour, S.A.; Ohran, H.; Alanazi, K.M.; Abd El-Hack, M.E.; Taha, A.E.; Khan, R.; Gong, C.; et al. Genome-wide association studies reveal novel loci associated with carcass and body measures in beef cattle. Arch. Biochem. Biophys. 2020, 694, 108543. [Google Scholar] [CrossRef]
  8. Chauhan, A.; Dahiya, S.P.; Bangar, C.; Magotra, A. The estimation of (co)variance components and genetic parameters for growth and wool traits in Harnali sheep. Small Rumin. Res. 2021, 203, 106485. [Google Scholar] [CrossRef]
  9. Xu, S.S.; Li, M.H. Recent advances in understanding genetic variants associated with economically important traits in sheep (Ovis aries) revealed by high-throughput screening technologies. Front. Agric. Sci. Eng. 2017, 4, 279–288. [Google Scholar] [CrossRef]
  10. Li, X.; Yang, J.; Shen, M.; Xie, X.L.; Liu, G.J.; Xu, Y.X.; Lv, F.H.; Yang, H.; Yang, Y.L.; Liu, C.B.; et al. Whole-genome resequencing of wild and domestic sheep identifies genes associated with morphological and agronomic traits. Nat. Commun. 2020, 11, 2815. [Google Scholar] [CrossRef]
  11. LaRochelle, W.J.; Jeffers, M.; McDonald, W.F.; Chillakuru, R.A.; Giese, N.A.; Lokker, N.A.; Sullivan, C.; Boldog, F.L.; Yang, M.; Vernet, C.; et al. PDGF-D, a new protease-activated growth factor. Nat. Cell Biol. 2001, 3, 517–521. [Google Scholar] [CrossRef]
  12. Dong, K.; Yang, M.; Han, J.; Ma, Q.; Han, J.; Song, Z.; Luosang, C.; Gorkhali, N.A.; Yang, B.; He, X.; et al. Genomic analysis of worldwide sheep breeds reveals PDGFD as a major target of fat-tail selection in sheep. BMC Genom. 2020, 21, 800. [Google Scholar] [CrossRef]
  13. Lv, F.H.; Cao, Y.H.; Liu, G.J.; Luo, L.Y.; Lu, R.; Liu, M.J.; Li, W.R.; Zhou, P.; Wang, X.H.; Shen, M.; et al. Whole-genome resequencing of worldwide wild and domestic sheep elucidates genetic diversity, introgression, and agronomically important loci. Mol. Biol. Evol. 2022, 39, msab353. [Google Scholar] [CrossRef]
  14. Qin, Z.; Feng, J.; Liu, Y.; Deng, L.L.; Lu, C. PDGF-D promotes dermal fibroblast invasion in 3-dimensional extracellular matrix via Snail-mediated MT1-MMP upregulation. Tumour. Biol. 2016, 37, 591–599. [Google Scholar] [CrossRef]
  15. Wu, Q.; Hou, X.; Xia, J.; Qian, X.; Miele, L.; Sarkar, F.H.; Wang, Z. Emerging roles of PDGF-D in EMT progression during tumorigenesis. Cancer Treat. Rev. 2013, 39, 640–646. [Google Scholar] [CrossRef]
  16. Zhang, H.; Sun, J.D.; Yan, L.J.; Zhao, X.P. PDGF-D/PDGFRβ promotes tongue squamous carcinoma cell (TSCC) progression via activating p38/AKT/ERK/EMT signal pathway. Biochem. Biophys. Res. Commun. 2016, 478, 845–851. [Google Scholar] [CrossRef]
  17. Lu, Z.K.; Du, L.X.; Zhang, L.P.; Li, Q.; Chu, M.X.; Wei, C.H. Research advances in platelet-derived growth factor-D (PDGF-D) gene. J. Agric. Biotechnol. 2018, 26, 1970–1978. (In Chinese) [Google Scholar]
  18. Gong, M.; Yang, P.; Fang, W.; Li, R.; Jiang, Y. Building a cattle pan-genome using more de novo assemblies. J. Genet. Genom. 2022, 49, 906–908. [Google Scholar] [CrossRef]
  19. Zhang, X.; Qu, K.; Jia, P.; Zhang, J.; Liu, J.; Lei, C.; Huang, B. Assessing genomic diversity and productivity signatures in Dianzhong cattle by whole-genome scanning. Front. Genet. 2021, 12, 719215. [Google Scholar] [CrossRef]
  20. Li, Q.; Wang, H.; Lu, Z.; Jin, M.; Chu, M.; Wei, C. Association of the PDGF-D gene genetic variation with sheep tail traits. Chin. J. Anim. Vet. Sci. 2019, 50, 688–700. (In Chinese) [Google Scholar]
  21. Kandoussi, A.; Petit, D.; Boujenane, I. Morphologic characterization of the Blanche de Montagne, an endemic sheep of the Atlas Mountains. Trop. Anim. Health Prod. 2021, 53, 154. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, H.; Xu, H.; Lan, X.; Cao, X.; Pan, C. The InDel variants of sheep IGF2BP1 gene are associated with growth traits. Anim. Biotechnol. 2021, 34, 134–142. [Google Scholar] [CrossRef] [PubMed]
  23. Fang, X.; Xu, H.; Zhang, C.; Zhang, J.; Lan, X.; Gu, C.; Chen, H. Polymorphisms in BMP-2 gene and their associations with growth traits in goats. Genes Genom. 2010, 32, 29–35. [Google Scholar] [CrossRef]
  24. Jia, W.; Wu, X.; Li, X.; Xia, T.; Lei, C.; Chen, H.; Pan, C.; Lan, X. Novel genetic variants associated with mRNA expression of signal transducer and activator of transcription 3 (STAT3) gene significantly affected goat growth traits. Small Rumin. Res. 2015, 129, 25–36. [Google Scholar] [CrossRef]
  25. Li, X.; Jiang, E.; Zhang, K.; Zhang, S.; Jiang, F.; Song, E.; Chen, H.; Guo, P.; Lan, X. Genetic variations within the bovine CRY2 gene are significantly associated with carcass traits. Animals 2022, 12, 1616. [Google Scholar] [CrossRef]
  26. Su, P.; Luo, Y.; Huang, Y.; Akhatayeva, Z.; Xin, D.; Guo, Z.; Pan, C.; Zhang, Q.; Xu, H.; Lan, X. Short variation of the sheep PDGFD gene is correlated with litter size. Gene 2022, 844, 146797. [Google Scholar] [CrossRef]
  27. Huang, Y.; Ma, Z.; Wang, X.; Zhao, L.; Zhang, Y.; Yang, X.; Xu, D.; Cheng, J.; Li, X.; Zeng, X.; et al. Identification of TRAPPC9 and BAIAP2 gene polymorphisms and their association with fat deposition-related traits in Hu sheep. Front. Vet. Sci. 2022, 9, 928375. [Google Scholar]
  28. Li, Q.; Lu, Z.; Jin, M.; Fei, X.; Quan, K.; Liu, Y.; Ma, L.; Chu, M.; Wang, H.; Wei, C. Verification and analysis of sheep tail type-associated PDGF-D gene polymorphisms. Animals 2020, 10, 89. [Google Scholar] [CrossRef]
  29. Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef]
  30. Zhou, Q.; Chen, Y.; Lu, S.; Liu, Y.; Xu, W.; Li, Y.; Wang, L.; Wang, N.; Yang, Y.; Chen, S. Development of a 50K SNP array for Japanese flounder and its application in genomic selection for disease resistance. Engineering 2021, 7, 406–411. [Google Scholar] [CrossRef]
  31. Li, H.; Fredriksson, L.; Li, X.; Eriksson, U. PDGF-D is a potent transforming and angiogenic growth factor. Oncogene 2003, 22, 1501–1510. [Google Scholar] [CrossRef]
  32. Lokker, N.A.; Sullivan, C.M.; Hollenbach, S.J.; Israel, M.A.; Giese, N.A. Platelet-derived growth factor (PDGF) autocrine signaling regulates survival and mitogenic pathways in glioblastoma cells: Evidence that the novel PDGF-C and PDGF-D ligands may play a role in the development of brain tumors. Cancer Res. 2002, 62, 3729–3735. [Google Scholar]
  33. Chen, Z.; Yu, H.; Shi, X.; Warren, C.R.; Lotta, L.A.; Friesen, M.; Meissner, T.B.; Langenberg, C.; Wabitsch, M.; Wareham, N.; et al. Functional screening of candidate causal genes for insulin resistance in human preadipocytes and adipocytes. Circ. Res. 2020, 126, 330–346. [Google Scholar] [CrossRef]
  34. Dani, C.; Pfeifer, A. The complexity of PDGFR signaling: Regulation of adipose progenitor maintenance and adipocyte-myofibroblast transition. Stem Cell Investig. 2017, 4, 28. [Google Scholar] [CrossRef]
  35. Gao, Z.; Daquinag, A.C.; Su, F.; Snyder, B.; Kolonin, M.G. PDGFRα/PDGFRβ signaling balance modulates progenitor cell differentiation into white and beige adipocytes. Development 2018, 145, dev155861. [Google Scholar] [CrossRef]
  36. Zeng, J.; Zhou, S.W.; Zhao, J.; Jin, M.H.; Kang, D.J.; Yang, Y.X.; Wang, X.L.; Chen, Y.L. Role of OXCT1 in ovine adipose and preadipocyte differentiation. Biochem. Biophys. Res. Commun. 2019, 512, 779–785. [Google Scholar] [CrossRef]
  37. Kang, D.; Zhou, G.; Zhou, S.; Zeng, J.; Wang, X.; Jiang, Y.; Yang, Y.; Chen, Y. Comparative transcriptome analysis reveals potentially novel roles of Homeobox genes in adipose deposition in fat-tailed sheep. Sci. Rep. 2017, 7, 14491. [Google Scholar] [CrossRef]
  38. Wang, S.; Liu, S.; Yuan, T.; Sun, X. Genetic effects of FTO gene insertion/deletion (InDel) on fat-tail measurements and growth traits in Tong sheep. Anim. Biotechnol. 2021, 32, 229–239. [Google Scholar] [CrossRef]
  39. Ma, L.; Li, Z.; Cai, Y.; Xu, H.; Yang, R.; Lan, X. Genetic variants in fat- and short-tailed sheep from high-throughput RNA-sequencing data. Anim. Genet. 2018, 49, 483–487. [Google Scholar] [CrossRef]
  40. Erdenee, S.; Akhatayeva, Z.; Pan, C.; Cai, Y.; Xu, H.; Chen, H.; Lan, X. An insertion/deletion within the CREB1 gene identified using the RNA-sequencing is associated with sheep body morphometric traits. Gene 2021, 775, 145444. [Google Scholar] [CrossRef]
  41. Kang, Y.; Bi, Y.; Tang, Q.; Xu, H.; Lan, X.; Zhang, Q.; Pan, C. A 7-nt nucleotide sequence variant within the sheep KDM3B gene affects female reproduction traits. Anim. Biotechnol. 2022, 33, 1661–1667. [Google Scholar] [CrossRef] [PubMed]
  42. Kang, Y.; Zhu, Q.; Meng, F.; Xu, H.; Guo, Z.; Pan, C. Rapid detection of InDel within the KDM3B gene in five sheep breeds using the mathematical expectation (ME) method. Gene 2022, 834, 146598. [Google Scholar] [CrossRef] [PubMed]
  43. Pang, P.; Li, Z.; Hu, H.; Wang, L.; Sun, H.; Mei, S.; Li, F. Genetic effect and combined genotype effect of ESR, FSHβ, CTNNAL1 and miR-27a loci on litter size in a Large White population. Anim. Biotechnol. 2019, 30, 287–292. [Google Scholar] [CrossRef] [PubMed]
  44. Berulava, T.; Horsthemke, B. The obesity-associated SNPs in intron 1 of the FTO gene affect primary transcript levels. Eur. J. Hum. Genet. 2010, 18, 1054–1056. [Google Scholar] [CrossRef] [PubMed]
  45. Cui, Y.; Yan, H.; Wang, K.; Xu, H.; Zhang, X.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Insertion/Deletion within the KDM6A gene is significantly associated with litter size in goat. Front. Genet. 2018, 9, 91. [Google Scholar] [CrossRef]
  46. Shaul, O. How introns enhance gene expression. Int. J. Biochem. Cell Biol. 2017, 91 Pt B, 145–155. [Google Scholar] [CrossRef]
  47. Yang, H.; Zhang, H.; Luan, Y.; Liu, T.; Yang, W.; Roberts, K.G.; Qian, M.X.; Zhang, B.; Yang, W.; Perez-Andreu, V.; et al. Noncoding genetic variation in GATA3 increases acute lymphoblastic leukemia risk through local and global changes in chromatin conformation. Nat. Genet. 2022, 54, 170–179. [Google Scholar] [CrossRef]
  48. Wang, M.; Shu, H.; Xie, J.; Huang, Y.; Wang, K.; Feng, R.; Yu, X.; Guan, J.; Feng, W.; Liu, M. An intron mutation of HNF1A causes abnormal splicing and impairs its activity as a transcription factor. Mol. Cell Endocrinol. 2022, 545, 111575. [Google Scholar] [CrossRef]
  49. Li, W.; Zhang, M.; Li, Q.; Tang, H.; Zhang, L.; Wang, K.; Zhu, M.; Lu, Y.; Bao, H.; Zhang, Y.; et al. Whole-genome resequencing reveals candidate mutations for pig prolificacy. Proc. Biol. Sci. 2017, 284, 20172437. [Google Scholar] [CrossRef]
  50. Li, W.H.; Li, G.Y.; Zhang, J.; Wang, X.J.; Zhang, A.W.; Zhao, J.T.; Wang, L.J.; Yang, J.F.; Luo, T.Z.; Shen, K.Z. Estimates of (co)variance components and phenotypic and genetic parameters of growth traits and wool traits in Alpine Merino sheep. J. Anim. Breed Genet. 2022, 139, 351–365. [Google Scholar] [CrossRef]
Animals 13 01485 g001 550
Figure 1. Position of the InDel variations in the genomic structure of the ovine PDGFD gene. Note: E1–E8: Exon 1–Exon 8; rs1090505197, rs600150957, and rs1085712616: InDel variations within ovine PDGFD gene in the study of Su et al. [25]; P1–P6: six possible InDel sites within ovine PDGFD gene in this study.
Figure 1. Position of the InDel variations in the genomic structure of the ovine PDGFD gene. Note: E1–E8: Exon 1–Exon 8; rs1090505197, rs600150957, and rs1085712616: InDel variations within ovine PDGFD gene in the study of Su et al. [25]; P1–P6: six possible InDel sites within ovine PDGFD gene in this study.
Animals 13 01485 g001
Animals 13 01485 g002 550
Figure 2. Agarose gel electrophoresis and sequence chromatograms for the P4-ins-14bp InDel locus.
Figure 2. Agarose gel electrophoresis and sequence chromatograms for the P4-ins-14bp InDel locus.
Animals 13 01485 g002
Animals 13 01485 g003 550
Figure 3. Agarose gel electrophoresis and sequence chromatograms for the P5-del-13bp InDel locus.
Figure 3. Agarose gel electrophoresis and sequence chromatograms for the P5-del-13bp InDel locus.
Animals 13 01485 g003
Animals 13 01485 g004 550
Figure 4. Linkage disequilibrium analysis of both P4-ins-14bp and P5-del-13bp loci in sheep PDGFD gene: (a) Lanzhou fat-tailed sheep; (b) Luxi black-headed sheep; (c) Guiqian semi-fine wool sheep.
Figure 4. Linkage disequilibrium analysis of both P4-ins-14bp and P5-del-13bp loci in sheep PDGFD gene: (a) Lanzhou fat-tailed sheep; (b) Luxi black-headed sheep; (c) Guiqian semi-fine wool sheep.
Animals 13 01485 g004
Table
Table 1. Primers of the sheep PDGFD gene for genotyping.
Table 1. Primers of the sheep PDGFD gene for genotyping.
Variant IDNamesPrimer Sequences (5′ to 3′)Product Sizes (bp)Location
rs1093585007P1-del-39bpF: TCAGAGGCTTGACTGAGGTATGA
R: CAACATTCCACTCCGCAGTTT		378/339Intron 1
rs1094063906P2-del-18bpF: GAAAGTCTGAAGGTGCCA
R: CAGAGCTGATGCTGGAAT		150/132Intron 1
rs604168702P3-del-16bpF: CACATCACTACTCCTTCACACAAC
R: GCCTCATTCAAGAGTGGTCAGT		195/179Intron 2
rs590816164P4-ins-14bpF: ACCCAGATCTTGGCCATTTTCTAT
R: AGCCATGCTTTATTTCCAAAGTGG		312/298Intron 2
rs1092650847P5-del-13bpF: TCGTTGAAGAAGGCAGTG
R: GTGGAGGTGAATAAGTAAGTGA		185/172Intron 4
rs594600476P6-del-17bpF: CAGACTCTGGCTCTTCTACTGA
R: TGTAAAGCAACGGGACGT		291/274Intron 6
Table
Table 2. Genetic parameters of InDels in three different sheep populations.
Table 2. Genetic parameters of InDels in three different sheep populations.
LociBreedsSample SizesGenotype and Allele FrequenciesHeNePICHWE
p-Value
IIIDDDID
P4-ins-14bpLFT6500.0620.9380.0310.9690.0601.0630.058p > 0.05
LXBH618001.00001.00001.0000p > 0.05
GSFW124300.1690.8310.0840.9160.1551.1830.143p < 0.05
P5-del-13bpLFT650.9540.04600.9770.0230.0451.0470.044p > 0.05
LXBH6180.8350.1600.0050.9150.0850.1551.1840.143p > 0.05
GSFW12430.6350.3220.0430.7960.2040.3251.4810.272p > 0.05
Note: LFT, Lanzhou fat-tailed sheep; LXBH, Luxi black-headed sheep; GSFW, Guiqian semi-fine wool sheep; II, insertion/insertion; ID, insertion/deletion; DD, deletion/deletion; He, heterozygosity; Ne, the effective allele numbers; PIC, polymorphism information content; HWE, Hardy–Weinberg equilibrium.
Table
Table 3. Chi-square testing of genotype frequency (below diagonal) and allele frequency (above diagonal) of the P4-ins-14bp locus in different sheep breeds.
Table 3. Chi-square testing of genotype frequency (below diagonal) and allele frequency (above diagonal) of the P4-ins-14bp locus in different sheep breeds.
BreedsLFTLXBHGSFW
LFT-7.9 × 10−5 **0.031 *
LXBH7.5 × 10−5 **-9.11 × 10−39 **
GSFW0.024 *2.73 × 10−40 **-
Note: * p < 0.05, ** p < 0.01.
Table
Table 4. Chi-square testing of genotype frequency (below diagonal) and allele frequency (above diagonal) of the P5-del-13bp locus in different sheep breeds.
Table 4. Chi-square testing of genotype frequency (below diagonal) and allele frequency (above diagonal) of the P5-del-13bp locus in different sheep breeds.
BreedsLFTLXBHGSFW
LFT-0.009 **2.45 × 10−9 **
LXBH0.035 *-9.41 × 10−20 **
GSFW4.48 × 10−8 **8.46 × 10−21 **-
Note: * p < 0.05, ** p < 0.01.
Table
Table 5. The genetic and phenotypic association of the P5-del-13bp locus of PDGFD with morphological traits in sheep.
Table 5. The genetic and phenotypic association of the P5-del-13bp locus of PDGFD with morphological traits in sheep.
TraitsObserved Genotypes (LSM a ± SE)p-Value
II (n)ID (n)DD (n)
LXBH yearling rams (77)
Body weight (kg)54.10 b ± 2.32 (60)64.18 a ± 3.84 (17)-0.040
Body length (cm)70.78 b ± 0.87 (60)75.82 a ± 1.84 (17)-0.010
Chest depth (cm)27.28 B ± 0.58 (60)30.76 A ± 0.98 (17)-0.005
GSFW yearling ewes (155)
Body weight (kg)40.11 a ± 0.55 (103)38.08 b ± 0.76 (48)35.35 c ± 1.21 (4)0.036
Chest width (cm)26.41 A ± 0.24 (103)25.14 B ± 0.26 (48)25.00 C ± 0.71 (4)0.005
Cannon circumference (cm)9.14 A ± 0.34 (103)9.23 A ± 0.06 (48)9.00 B ± 0.00 (4)3.53 × 10−4
Chest width index (%)77.21 A ± 0.62 (103)73.64 B ± 0.60 (48)74.24 AB ± 3.15 (4)4.98 × 10−4
GSFW adult ewes (179)
Chest width (cm)28.68 A ± 0.22 (126)28.50 A ± 0.35 (46)27.14 B ± 0.14 (7)8.67 × 10−7
Note: Values with different superscripts within the same line differ significantly at p < 0.01 (A, B, C) and p < 0.05 (a, b, c).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Luo, Y.; Zhang, M.; Guo, Z.; Wijayanti, D.; Xu, H.; Jiang, F.; Lan, X. Insertion/Deletion (InDel) Variants within the Sheep Fat-Deposition-Related PDGFD Gene Strongly Affect Morphological Traits. Animals 2023, 13, 1485. https://doi.org/10.3390/ani13091485

AMA Style

Luo Y, Zhang M, Guo Z, Wijayanti D, Xu H, Jiang F, Lan X. Insertion/Deletion (InDel) Variants within the Sheep Fat-Deposition-Related PDGFD Gene Strongly Affect Morphological Traits. Animals. 2023; 13(9):1485. https://doi.org/10.3390/ani13091485

Chicago/Turabian Style

Luo, Yunyun, Mengyang Zhang, Zhengang Guo, Dwi Wijayanti, Hongwei Xu, Fugui Jiang, and Xianyong Lan. 2023. "Insertion/Deletion (InDel) Variants within the Sheep Fat-Deposition-Related PDGFD Gene Strongly Affect Morphological Traits" Animals 13, no. 9: 1485. https://doi.org/10.3390/ani13091485

APA Style

Luo, Y., Zhang, M., Guo, Z., Wijayanti, D., Xu, H., Jiang, F., & Lan, X. (2023). Insertion/Deletion (InDel) Variants within the Sheep Fat-Deposition-Related PDGFD Gene Strongly Affect Morphological Traits. Animals, 13(9), 1485. https://doi.org/10.3390/ani13091485

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop