Weighted Gene Co-Expression Network Analysis Based on Stimulation by Lipopolysaccharides and Polyinosinic:polycytidylic Acid Provides a Core Set of Genes for Understanding Hemolymph Immune Response Mechanisms of Amphioctopus fangsiao
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Procedure
2.2. Identification of DEGs
2.3. Bioinformatics Analysis
2.4. Functional Analysis of Module Genes and Identification of Hub Genes
2.5. qPCR Validation
3. Results
3.1. Identification of DEGs
3.2. Weighted Gene Co-Expression Network Analysis
3.3. Screening and Functional Analysis of Key Modules
3.4. Construction of Key Networks and Identification of Hub Genes
3.5. Quantitative RT-PCR Validation of Hub Genes
4. Discussion
4.1. The Intention of this Study
4.2. Discussion of Key Modules and Hub Genes
4.2.1. Analysis of Hub Genes in the Brown Module Associated with 0 h Stimulation
4.2.2. Analysis of Hub Genes in the Pink Module Associated with 6 h LPS Stimulation
4.2.3. Analysis of Hub Genes in the Turquoise Module Associated with 24 h LPS Stimulation
4.2.4. Analysis of Hub Genes in the Blue Module Associated with 6 h Poly I:C Stimulation
4.2.5. Analysis of Hub Genes in the Black Module Associated with 24 h Poly I:C Stimulation
4.2.6. Protein–Protein Interaction Network Analyses
4.2.7. Summary of Immune Responses under the Two Forms of Stimulation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pang, Y.; Tian, Y.; Fu, C.; Ren, Y.; Wan, R. Growth and Distribution of Amphioctopus fangsiao (d’Orbigny, 1839–1841) in Haizhou Bay, Yellow Sea. J. Ocean Univ. China 2020, 19, 1125–1132. [Google Scholar] [CrossRef]
- Tanaka, K.; Sakai, T.; Ikeda, I.; Imaizumi, K.; Sugano, M. Effects of dietary shrimp, squid and octopus on serum and liver lipid levels in mice. Biosci. Biotechnol. Biochem. 1998, 62, 1369–1375. [Google Scholar] [CrossRef] [PubMed]
- Defoirdt, T.; Boon, N.; Bossier, P.; Verstraete, W. Disruption of bacterial quorum sensing: An unexplored strategy to fight infections in aquaculture. Aquaculture 2004, 240, 69–88. [Google Scholar] [CrossRef]
- Jones, M.K.; Oliver, J.D. Vibrio vulnificus: Disease and pathogenesis. Infect. Immun. 2009, 77, 1723–1733. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, K.; Larsen, L. rRNA gene restriction patterns of Vibrio anguillarum serogroup O 1. Dis. Aquat. Org. 1993, 16, 121–126. [Google Scholar] [CrossRef]
- Jung-Schroers, V.; Adamek, M.; Wohlsein, P.; Wolter, J.; Wedekind, H.; Steinhagen, D. First outbreak of an infection with infectious spleen and kidney necrosis virus (ISKNV) in ornamental fish in Germany. Dis. Aquat. Organ. 2016, 119, 239–244. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.-H.; Deng, M.-L.; Geng, Y.; Zhou, Y.; Wang, K.-Y.; Chen, D.-F.; Zhong, Z.-J.; Peng, X.; Huang, X.-L. An outbreak of infectious haematopoietic necrosis virus (IHNV) infection in cultured rainbow trout (Oncorhynchus mykiss) in Southwest China. Aquac. Res. 2016, 47, 2355–2362. [Google Scholar] [CrossRef]
- Morse, S.S. Factors in the emergence of infectious diseases. In Plagues and Politics; Palgrave Macmillan: London, UK, 2001; pp. 8–26. [Google Scholar]
- Chaplin, D.D. Overview of the immune response. J. Allergy Clin. Immunol. 2010, 125 (Suppl. S2), S3–S23. [Google Scholar] [CrossRef]
- Delves, P.J.; Roitt, I.M. The immune system. First of two parts. N. Engl. J. Med. 2000, 343, 37–49. [Google Scholar] [CrossRef]
- Zapata, A.; Diez, B.; Cejalvo, T.; Frias, C.G.-D.; Cortes, A. Ontogeny of the immune system of fish. Fish Shellfish. Immunol. 2006, 20, 126–136. [Google Scholar] [CrossRef]
- Furuta, E.; Yamaguchi, K. Haemolymph: Blood Cell Morphology and Function, The Biology of Terrestrial Molluscs; CABI Publishing: Wallingford, UK, 2001; pp. 289–306. [Google Scholar]
- Bao, X.; Wang, W.; Yuan, T.; Li, Y.; Chen, X.; Liu, X.; Xu, X.; Sun, G.; Li, B.; Yang, J.; et al. Transcriptome profiling based on larvae at different time points after hatching provides a core set of gene resource for understanding the immune response mechanisms of the egg-protecting behavior against Vibrio anguillarum infection in Amphioctopus fangsiao. Fish Shellfish. Immunol. 2022, 124, 430–441. [Google Scholar] [PubMed]
- Wang, J.; Feng, Y.; Li, Z.; Wang, W.; Sun, G.; Xu, X.; Yang, J. Pathology of Vibrio anguillarum and Vibrio Parahemolyticus infections in Amphioctopus fangsiao. J. Shandong Univ. 2020, 55, 9. [Google Scholar]
- Zhu, X.; Wang, J.; Yuan, T.; Feng, Y.; Li, Z.; Xu, X.; Wang, W.; Sun, G.; Yang, J. Influence of Vibrio anguillarum and Edwardsiella tarda on the liver flora structure of Amphioctopus fangsiao. Aquac. Sci. 2022, 41, 976–981. [Google Scholar]
- Freudenberg, M.A.; Tchaptchet, S.; Keck, S.; Fejer, G.; Huber, M.; Schutze, N.; Beutler, B.; Galanos, C. Lipopolysaccharide sensing an important factor in the innate immune response to Gram-negative bacterial infections: Benefits and hazards of LPS hypersensitivity. Immunobiology 2008, 213, 193–203. [Google Scholar] [CrossRef] [PubMed]
- Martins, K.A.; Bavari, S.; Salazar, A.M. Vaccine adjuvant uses of poly-IC and derivatives. Expert Rev. Vaccines 2015, 14, 447–459. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.L.; Liu, M.; Jiang, K.Y.; Wang, B.J.; Tian, X.; Sun, S.J.; Luo, Z.Y.; Qiu, C.W.; Wang, L. De novo characterization of Japanese scallop Mizuhopecten yessoensis transcriptome and analysis of its gene expression following cadmium exposure. PLoS ONE 2013, 8, e64485. [Google Scholar] [CrossRef]
- Zhang, M.; Qiao, G.; Li, Q.; Xu, D.H.; Qi, Z.; Wang, A.; Xu, M.; Huang, J. Transcriptome analysis and discovery of genes involved in immune pathways from coelomocytes of Onchidium struma after bacterial challenge. Fish Shellfish. Immunol. 2018, 72, 528–543. [Google Scholar] [CrossRef]
- Xu, Z.; Li, T.; Li, E.; Chen, K.; Ding, Z.; Qin, J.G.; Chen, L.; Ye, J. Comparative transcriptome analysis reveals molecular strategies of oriental river prawn Macrobrachium nipponense in response to acute and chronic nitrite stress. Fish Shellfish. Immunol. 2016, 48, 254–265. [Google Scholar] [CrossRef]
- Liang, W.; Sun, F.; Zhao, Y.; Shan, L.; Lou, H. Identification of Susceptibility Modules and Genes for Cardiovascular Disease in Diabetic Patients Using WGCNA Analysis. J. Diabetes Res. 2020, 2020, 4178639. [Google Scholar] [CrossRef]
- Chen, S.; Yang, D.; Lei, C.; Li, Y.; Sun, X.; Chen, M.; Wu, X.; Zheng, Y. Identification of crucial genes in abdominal aortic aneurysm by WGCNA. PeerJ 2019, 7, e7873. [Google Scholar] [CrossRef]
- Wan, Q.; Tang, J.; Han, Y.; Wang, D. Co-expression modules construction by WGCNA and identify potential prognostic markers of uveal melanoma. Exp. Eye Res. 2018, 166, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Xie, H.; Wei, X.; Dossa, K.; Yu, Y.; Hui, S.; Tang, G.; Zeng, X.; Yu, Y.; Hu, P.; et al. WGCNA Analysis of Salt-Responsive Core Transcriptome Identifies Novel Hub Genes in Rice. Genes 2019, 10, 719. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Li, Y.; Bao, X.; Zhang, E.; Cui, C.; Liu, X.; Luo, Q.; Yang, J.; Li, Z.; Xu, X. Transcriptome profiling based on protein-protein networks provides a core set of genes for understanding blood immune response mechanisms against LPS stress in Amphioctopus fangsiao. Dev. Comp. Immunol. 2022, 136, 104509. [Google Scholar] [CrossRef]
- Chen, X.; Liu, X.; Cai, D.; Wang, W.; Cui, C.; Yang, J.; Xu, X.; Li, Z. Sequencing-based network analysis provides a core set of genes for understanding hemolymph immune response mechanisms against Poly I:C stimulation in Amphioctopus fangsiao. Fish Shellfish. Immunol. 2023, 133, 108544. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Horvath, S. A general framework for weighted gene co-expression network analysis. Stat. Appl. Genet. Mol. Biol. 2005, 4, 17. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.L.; Palmquist, D.E.; Ma, M.; Liu, J.; Alexander, N.J. Application of a master equation for quantitative mRNA analysis using qRT-PCR. J. Biotechnol. 2009, 143, 10–16. [Google Scholar] [CrossRef]
- Jiang, D.; Zheng, X.; Qian, Y.; Zhang, Q. Embryonic development of Amphioctopus fangsiao under elevated temperatures: Implications for resource management and conservation. Fish. Res. 2020, 225, 105479. [Google Scholar] [CrossRef]
- Iglesias, J.; Sánchez, F.J.; Bersano, J.G.F.; Carrasco, J.F.; Dhont, J.; Fuentes, L.; Linares, F.; Muñoz, J.L.; Okumura, S.; Roo, J.; et al. Rearing of Octopus vulgaris paralarvae: Present status, bottlenecks and trends. Aquaculture 2007, 266, 1–15. [Google Scholar] [CrossRef]
- Yip, L.; Su, L.; Sheng, D.; Chang, P.; Atkinson, M.; Czesak, M.; Albert, P.R.; Collier, A.R.; Turley, S.J.; Fathman, C.G.; et al. Deaf1 isoforms control the expression of genes encoding peripheral tissue antigens in the pancreatic lymph nodes during type 1 diabetes. Nat. Immunol. 2009, 10, 1026–1033. [Google Scholar] [CrossRef]
- Stubbs, L.; Sun, Y.; Caetano-Anolles, D. Function and evolution of C2H2 zinc finger arrays. In A Handbook of Transcription Factors; Springer: Dordrecht, The Netherlands, 2011; pp. 75–94. [Google Scholar]
- Reed, D.E.; Huang, X.M.; Wohlschlegel, J.A.; Levine, M.S.; Senger, K. DEAF-1 regulates immunity gene expression in Drosophila. Proc. Natl. Acad. Sci. USA 2008, 105, 8351–8356. [Google Scholar] [CrossRef]
- Kuttenkeuler, D.; Pelte, N.; Ragab, A.; Gesellchen, V.; Schneider, L.; Blass, C.; Axelsson, E.; Huber, W.; Boutros, M. A large-scale RNAi screen identifies Deaf1 as a regulator of innate immune responses in Drosophila. J. Innate Immun. 2010, 2, 181–194. [Google Scholar] [CrossRef] [PubMed]
- Wagenseil, J.E.; Mecham, R.P. New insights into elastic fiber assembly. Birth Defects Res. Part C Embryo Today 2007, 81, 229–240. [Google Scholar] [CrossRef] [PubMed]
- Sorokin, L. The impact of the extracellular matrix on inflammation. Nat. Rev. Immunol. 2010, 10, 712–723. [Google Scholar] [CrossRef] [PubMed]
- Gibson, G.; Çalışkan, M.; Baker, S.W.; Gilad, Y.; Ober, C. Host Genetic Variation Influences Gene Expression Response to Rhinovirus Infection. PLoS Genet. 2015, 11, e1005111. [Google Scholar]
- Patel, N.; Itakura, T.; Gonzalez, J.M., Jr.; Schwartz, S.G.; Fini, M.E. GPR158, an orphan member of G protein-coupled receptor Family C: Glucocorticoid-stimulated expression and novel nuclear role. PLoS ONE 2013, 8, e57843. [Google Scholar] [CrossRef] [PubMed]
- Orlandi, C.; Posokhova, E.; Masuho, I.; Ray, T.A.; Hasan, N.; Gregg, R.G.; Martemyanov, K.A. GPR158/179 regulate G protein signaling by controlling localization and activity of the RGS7 complexes. J. Cell Biol. 2012, 197, 711–719. [Google Scholar] [CrossRef] [PubMed]
- Lammermann, T.; Kastenmuller, W. Concepts of GPCR-controlled navigation in the immune system. Immunol. Rev. 2019, 289, 205–231. [Google Scholar] [CrossRef]
- Kahles, F.; Meyer, C.; Diebold, S.; Foldenauer, A.C.; Stohr, R.; Mollmann, J.; Lebherz, C.; Findeisen, H.M.; Marx, N.; Lehrke, M. Glucose-dependent insulinotropic peptide secretion is induced by inflammatory stimuli in an interleukin-1-dependent manner in mice. Diabetes Obes. Metab. 2016, 18, 1147–1151. [Google Scholar] [CrossRef]
- Nie, Y.; Ma, R.C.; Chan, J.C.; Xu, H.; Xu, G. Glucose-dependent insulinotropic peptide impairs insulin signaling via inducing adipocyte inflammation in glucose-dependent insulinotropic peptide receptor-overexpressing adipocytes. FASEB J. 2012, 26, 2383–2393. [Google Scholar] [CrossRef]
- Fishman, S.; Zvibel, I.; Varo, C. Incretin Hormones in the Control of Immunometabolism. Immunometabolism 2019, 1, e190004. [Google Scholar] [CrossRef]
- Efimova, I.; Steinberg, I.; Zvibel, I.; Neumann, A.; Mantelmacher, D.F.; Drucker, D.J.; Fishman, S.; Varol, C. GIPR Signaling in Immune Cells Maintains Metabolically Beneficial Type 2 Immune Responses in the White Fat from Obese Mice. Front. Immunol. 2021, 12, 643144. [Google Scholar] [CrossRef] [PubMed]
- Resnick, T.D.; Satinover, D.L.; MacIsaac, F.; Stukenberg, P.T.; Earnshaw, W.C.; Orr-Weaver, T.L.; Carmena, M. INCENP and Aurora B promote meiotic sister chromatid cohesion through localization of the Shugoshin MEI-S332 in Drosophila. Dev. Cell 2006, 11, 57–68. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Hu, B.; Zheng, J.; Ji, C.; Fan, X.; Gao, Y. Predose and Postdose Blood Gene Expression Profiles Identify the Individuals Susceptible to Acetaminophen-Induced Liver Injury in Rats. PLoS ONE 2015, 10, e0141750. [Google Scholar] [CrossRef] [PubMed]
- Baken, K.A.; Pennings, J.L.; Jonker, M.J.; Schaap, M.M.; de Vries, A.; van Steeg, H.; Breit, T.M.; van Loveren, H. Overlapping gene expression profiles of model compounds provide opportunities for immunotoxicity screening. Toxicol. Appl. Pharmacol. 2008, 226, 46–59. [Google Scholar] [CrossRef]
- Liao, L.; Chen, Y.; Wang, W. The current progress in understanding the molecular functions and mechanisms of visfatin in osteoarthritis. J. Bone Min. Metab. 2016, 34, 485–490. [Google Scholar] [CrossRef]
- Garten, A.; Petzold, S.; Korner, A.; Imai, S.; Kiess, W. Nampt: Linking NAD biology, metabolism and cancer. Trends Endocrinol. Metab. 2009, 20, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Jia, S.H.; Li, Y.; Parodo, J.; Kapus, A.; Fan, L.; Rotstein, O.D.; Marshall, J.C. Pre-B cell colony-enhancing factor inhibits neutrophil apoptosis in experimental inflammation and clinical sepsis. J. Clin. Investig. 2004, 113, 1318–1327. [Google Scholar] [CrossRef] [PubMed]
- Luk, T.; Malam, Z.; Marshall, J.C. Pre-B cell colony-enhancing factor (PBEF)/visfatin: A novel mediator of innate immunity. J. Leukoc. Biol. 2008, 83, 804–816. [Google Scholar] [CrossRef]
- Urrutia, R. Exploring the role of homeobox and zinc finger proteins in pancreatic cell proliferation, differentiation, and apoptosis. Int. J. Gastrointest. Cancer 1997, 22, 1–14. [Google Scholar] [CrossRef]
- Kim, M.A.; Lee, E.J.; Yang, W.; Shin, H.Y.; Kim, Y.H.; Kim, J.H. Identification of a novel gene signature in second-trimester amniotic fluid for the prediction of preterm birth. Sci. Rep. 2022, 12, 3085. [Google Scholar] [CrossRef]
- Shao, C.; Wang, Y.; Pan, M.; Guo, K.; Molnar, T.F.; Kocher, F.; Seeber, A.; Barr, M.P.; Navarro, A.; Han, J.; et al. The DNA damage repair-related gene PKMYT1 is a potential biomarker in various malignancies. Transl. Lung Cancer Res. 2021, 10, 4600–4616. [Google Scholar] [CrossRef] [PubMed]
- di Rorà, A.G.L.; Cerchione, C.; Martinelli, G.; Simonetti, G. A WEE1 family business: Regulation of mitosis, cancer progression, and therapeutic target. J. Hematol. Oncol. 2020, 13, 126. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Luo, M.; Zhao, H.; Sun, H. Overexpression of PKMYT1 indicates the poor prognosis and enhances proliferation and tumorigenesis in non-small cell lung cancer via activation of Notch signal pathway. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 4210–4219. [Google Scholar] [PubMed]
- Roos, W.P.; Kaina, B. DNA damage-induced cell death: From specific DNA lesions to the DNA damage response and apoptosis. Cancer Lett. 2013, 332, 237–248. [Google Scholar] [CrossRef] [PubMed]
- Yu, D.C.; Chen, X.Y.; Zhou, H.Y.; Yu, D.Q.; Yu, X.L.; Hu, Y.C.; Zhang, R.H.; Zhang, X.B.; Zhang, K.; Lin, M.Q.; et al. TRIP13 knockdown inhibits the proliferation, migration, invasion, and promotes apoptosis by suppressing PI3K/AKT signaling pathway in U2OS cells. Mol. Biol. Rep. 2022, 49, 3055–3064. [Google Scholar] [CrossRef] [PubMed]
- Setiaputra, D.; Durocher, D. Shieldin—The protector of DNA ends. EMBO Rep. 2019, 20, e47560. [Google Scholar] [CrossRef] [PubMed]
- de Krijger, I.; Fohr, B.; Perez, S.H.; Vincendeau, E.; Serrat, J.; Thouin, A.M.; Susvirkar, V.; Lescale, C.; Paniagua, I.; Hoekman, L.; et al. MAD2L2 dimerization and TRIP13 control shieldin activity in DNA repair. Nat. Commun. 2021, 12, 5421. [Google Scholar] [CrossRef] [PubMed]
- Lampson, M.A.; Kapoor, T.M. The human mitotic checkpoint protein BubR1 regulates chromosome-spindle attachments. Nat. Cell Biol. 2005, 7, 93–98. [Google Scholar] [CrossRef]
- Komura, K.; Inamoto, T.; Tsujino, T.; Matsui, Y.; Konuma, T.; Nishimura, K.; Uchimoto, T.; Tsutsumi, T.; Matsunaga, T.; Maenosono, R.; et al. Increased BUB1B/BUBR1 expression contributes to aberrant DNA repair activity leading to resistance to DNA-damaging agents. Oncogene 2021, 40, 6210–6222. [Google Scholar] [CrossRef]
- Basu, J.; Bousbaa, H.; Logarinho, E.; Li, Z.; Williams, B.C.; Lopes, C.; Sunkel, C.E.; Goldberg, M.L. Mutations in the essential spindle checkpoint gene bub1 cause chromosome missegregation and fail to block apoptosis in Drosophila. J. Cell Biol. 1999, 146, 13–28. [Google Scholar] [CrossRef]
- Cunha-Ferreira, I.; Chazeau, A.; Buijs, R.R.; Stucchi, R.; Will, L.; Pan, X.; Adolfs, Y.; van der Meer, C.; Wolthuis, J.C.; Kahn, O.I.; et al. The HAUS Complex Is a Key Regulator of Non-centrosomal Microtubule Organization during Neuronal Development. Cell Rep. 2018, 24, 791–800. [Google Scholar] [CrossRef] [PubMed]
- He, T.S.; Chen, T.; Wang, D.D.; Xu, L.G. HAUS8 regulates RLRVISA antiviral signaling positively by targeting VISA. Mol. Med. Rep. 2018, 18, 2458–2466. [Google Scholar] [PubMed]
- Tuan, N.M.; Lee, C.H. Role of Anillin in Tumour: From a Prognostic Biomarker to a Novel Target. Cancers 2020, 12, 1600. [Google Scholar] [CrossRef] [PubMed]
- Dai, X.; Chen, X.; Hakizimana, O.; Mei, Y. Genetic interactions between ANLN and KDR are prognostic for breast cancer survival. Oncol. Rep. 2019, 42, 2255–2266. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Deng, Z.; Li, Y.; Wei, B.; Chen, X.; Zhao, Z.; Xiu, Y.; Hu, M.; Alahdal, M.; Deng, Z.; et al. ANLN and UBE2T are prognostic biomarkers associated with immune regulation in breast cancer: A bioinformatics analysis. Cancer Cell Int. 2022, 22, 193. [Google Scholar] [CrossRef]
- Luo, C.; Lei, M.; Zhang, Y.; Zhang, Q.; Li, L.; Lian, J.; Liu, S.; Wang, L.; Pi, G.; Zhang, Y. Systematic construction and validation of an immune prognostic model for lung adenocarcinoma. J. Cell. Mol. Med. 2020, 24, 1233–1244. [Google Scholar] [CrossRef]
- Gao, P.S.; Leung, D.Y.; Rafaels, N.M.; Boguniewicz, M.; Hand, T.; Gao, L.; Hata, T.R.; Schneider, L.C.; Hanifin, J.M.; Beaty, T.H.; et al. Genetic variants in interferon regulatory factor 2 (IRF2) are associated with atopic dermatitis and eczema herpeticum. J. Investig. Dermatol. 2012, 132 Pt 1, 650–657. [Google Scholar] [CrossRef]
- Yuan, S.; Zheng, T.; Li, P.; Yang, R.; Ruan, J.; Huang, S.; Wu, Z.; Xu, A. Characterization of Amphioxus IFN Regulatory Factor Family Reveals an Archaic Signaling Framework for Innate Immune Response. J. Immunol. 2015, 195, 5657–5666. [Google Scholar] [CrossRef]
- Nhu, Q.M.; Cuesta, N.; Vogel, S.N. Transcriptional regulation of lipopolysaccharide (LPS)-induced Toll-like receptor (TLR) expression in murine macrophages: Role of interferon regulatory factors 1 (IRF-1) and 2 (IRF-2). J. Endotoxin Res. 2006, 12, 285–295. [Google Scholar] [CrossRef]
- Sumiyoshi, M.; Kotani, Y.; Ikuta, Y.; Suzue, K.; Ozawa, M.; Katakai, T.; Yamada, T.; Abe, T.; Bando, K.; Koyasu, S.; et al. Arf1 and Arf6 Synergistically Maintain Survival of T Cells during Activation. J. Immunol. 2021, 206, 366–375. [Google Scholar] [CrossRef]
- Khadilkar, R.J.; Ray, A.; Chetan, D.R.; Sinha, A.R.; Magadi, S.S.; Kulkarni, V.; Inamdar, M.S. Differential modulation of the cellular and humoral immune responses in Drosophila is mediated by the endosomal ARF1-Asrij axis. Sci. Rep. 2017, 7, 118. [Google Scholar] [CrossRef] [PubMed]
- Selyunin, A.S.; Reddick, L.E.; Weigele, B.A.; Alto, N.M. Selective protection of an ARF1-GTP signaling axis by a bacterial scaffold induces bidirectional trafficking arrest. Cell Rep. 2014, 6, 878–891. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, D.; Mori, T.; Wakabayashi, M.; Mori, Y.; Susa, K.; Zeniya, M.; Sohara, E.; Rai, T.; Sasaki, S.; Uchida, S. KLHL2 interacts with and ubiquitinates WNK kinases. Biochem. Biophys. Res. Commun. 2013, 437, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Zinngrebe, J.; Montinaro, A.; Peltzer, N.; Walczak, H. Ubiquitin in the immune system. EMBO Rep. 2014, 15, 28–45. [Google Scholar] [CrossRef]
- Morris, J.R.; Solomon, E. BRCA1: BARD1 induces the formation of conjugated ubiquitin structures, dependent on K6 of ubiquitin, in cells during DNA replication and repair. Hum. Mol. Genet. 2004, 13, 807–817. [Google Scholar] [CrossRef]
- Nishikawa, H.; Ooka, S.; Sato, K.; Arima, K.; Okamoto, J.; Klevit, R.E.; Fukuda, M.; Ohta, T. Mass spectrometric and mutational analyses reveal Lys-6-linked polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. J. Biol. Chem. 2004, 279, 3916–3924. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-3′) | TM (°C) | Reverse Primer (5′-3′) | TM (°C) | Length (bp) |
---|---|---|---|---|---|
EAF1 | TTGTCTCTGGGCCATTTAAG | 60 | ACTGAGAGCGTCGATTAGTA | 60 | 102 |
FBN2 | GTCTGCAAAGCTGGTTACT | 60 | GATTGGCTGTGTGGTTGA | 60 | 105 |
GPR158 | GCTCCACTTGCACATTTATC | 59 | GAGAACCTTCGATCCAGAAC | 60 | 106 |
GIP | CGCGGACTTCCGAAATAATA | 60 | GTAACAAAGCTGTCGCAAAG | 60 | 120 |
INCENP | CGTTAGGCTTGGATCTAGTG | 60 | CCTGGAGCTGAGAACTTTG | 60 | 135 |
LOC107984567 | CTATGGGCTGTGAAGGAATC | 60 | CGAACAAACGACCGAAGT | 60 | 165 |
NAMPT | TTAGGGTGCAGGTATAGGAG | 60 | GAGAAACCCGCCATTTCA | 60 | 114 |
LOC106883262 | CGCTCTCCGGCTATTTATTT | 60 | TCTGATGGCGGGTATTCT | 60 | 153 |
ZNF572 | CCTGTGTGAATACGTCTGTG | 60 | ACTGAGAGCAGCAGTTTAAG | 60 | 128 |
LOC106867328 | CACACTCACACGCAAACA | 61 | CCACACTCTGCTCACTAAATC | 60 | 103 |
LOC106882400 | GAACGACCAACTTCCTTCTC | 60 | GTATCTGCTCCCTTATCCATTC | 60 | 111 |
PKMYT1 | GAATCTGGAACCCGACATAAC | 60 | CGTAGCCTCCAGTTGTATCTA | 61 | 118 |
TRIP13 | GAGTGGTCAATGCTCTTCTG | 60 | GAGGTGAAGGCAAACCTATG | 60 | 150 |
BUB1B | GGTAACGGACCTTCTTCAAC | 60 | GGGAGAGGTCTGTGGATTAT | 60 | 108 |
HAUS4 | CTGGCGATTCTGATGTTTCT | 60 | GCTTCATCAGTTCCTCTACTTC | 60 | 117 |
ANLN | CTGTTGCTCCACGTCTTATG | 61 | GGTCTTGAGCACTACCTTTG | 60 | 126 |
IRF2 | TTCTTCCTCTCTCACCTCAC | 60 | CCACTCAAGGCCTGAAATAC | 60 | 132 |
ARF1 | TATCCAGACATTTGCCTTCC | 60 | TAGTGAGGGAGAGAGAGAGA | 60 | 100 |
KLHL2 | GAAACATCAGTCGTCTCTGG | 60 | CTTGTTACCTCCGCTGTATG | 60 | 153 |
Modules | DEG Numbers |
---|---|
grey | 100 |
blue | 508 |
brown | 396 |
green | 223 |
megenta | 53 |
pink | 61 |
red | 170 |
tuquoise | 515 |
yellow | 237 |
black | 80 |
Gene Abbreviated Name | Gene Official Full Name | Protein Interaction Numbers |
---|---|---|
LPS stimulation (brown, pink, and turquoise modules) | ||
ANLN | anillin, actin-binding protein | 4 |
NAMPT | nicotinamide phosphoribosyltransferase | 3 |
IRF2 | Interferon regulatory factor 2 | 2 |
Poly I:C stimulation (brown, blue, and black modules) | ||
PKMYT1 | protein kinase, membrane associated tyrosine/threonine 1 | 12 |
ARF1 | ADP ribosylation factor 1 | 6 |
KLHL2 | kelch like family member 2 | 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Chen, X.; Xu, X.; Yang, J.; Liu, X.; Sun, G.; Li, Z. Weighted Gene Co-Expression Network Analysis Based on Stimulation by Lipopolysaccharides and Polyinosinic:polycytidylic Acid Provides a Core Set of Genes for Understanding Hemolymph Immune Response Mechanisms of Amphioctopus fangsiao. Animals 2024, 14, 80. https://doi.org/10.3390/ani14010080
Wang Y, Chen X, Xu X, Yang J, Liu X, Sun G, Li Z. Weighted Gene Co-Expression Network Analysis Based on Stimulation by Lipopolysaccharides and Polyinosinic:polycytidylic Acid Provides a Core Set of Genes for Understanding Hemolymph Immune Response Mechanisms of Amphioctopus fangsiao. Animals. 2024; 14(1):80. https://doi.org/10.3390/ani14010080
Chicago/Turabian StyleWang, Yongjie, Xipan Chen, Xiaohui Xu, Jianmin Yang, Xiumei Liu, Guohua Sun, and Zan Li. 2024. "Weighted Gene Co-Expression Network Analysis Based on Stimulation by Lipopolysaccharides and Polyinosinic:polycytidylic Acid Provides a Core Set of Genes for Understanding Hemolymph Immune Response Mechanisms of Amphioctopus fangsiao" Animals 14, no. 1: 80. https://doi.org/10.3390/ani14010080