Effects of Low and High Maternal Protein Intake on Fetal Skeletal Muscle miRNAome in Sheep
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Diets
2.2. Estrus Synchronization, Semen Preparation, and Artificial Insemination
2.3. Necropsy, Sample Collection, and Isolation of miRNA
2.4. Microarray Hybridization and Data Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ji, Y.; Wu, Z.; Dai, Z.; Wang, X.; Li, J.; Wang, B.; Wu, G. Fetal and Neonatal Programming of Postnatal Growth and Feed Efficiency in Swine. J. Anim. Sci. Biotechnol. 2017, 8, 42. [Google Scholar] [CrossRef]
- Lin, Y.J.; Huang, L.T.; Tsai, C.C.; Sheen, J.M.; Tiao, M.M.; Yu, H.R.; Lin, I.C.; Tain, Y.L. Maternal High-fat Diet Sex-Specifically Alters Placental Morphology and Transcriptome in Rats: Assessment by Next-Generation Sequencing. Placenta 2019, 78, 44–53. [Google Scholar] [CrossRef]
- Hoffman, M.L.; Reed, S.A.; Pillai, S.M.; Jones, A.K.; McFadden, K.K.; Zinn, S.A.; Govoni, K.E. Physiology and Endocrinology Symposium: The Effects of Poor Maternal Nutrition During Gestation on Offspring Postnatal Growth and Metabolism. J. Anim. Sci. 2017, 95, 2222–2232. [Google Scholar] [CrossRef]
- Du, M.; Tong, J.; Zhao, J.; Underwood, K.R.; Zhu, M.; Ford, S.P.; Nathanielsz, P.W. Fetal Programming of Skeletal Muscle Development in Ruminant Animals. J. Anim. Sci. 2010, 88, E51–E60. [Google Scholar] [CrossRef]
- Du, M.; Wang, B.; Fu, X.; Yang, Q.; Zhu, M.J. Fetal Programming in Meat Production. Meat Sci. 2015, 109, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.M.H. Macronutrient Modulation of mRNA and microRNA Function in Animals: A Review. Anim. Nutr. 2020, 6, 258–268. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.M.H.; Konca, Y.; Cinar, M.U. Impacts of Macronutrients on Gene Expression: Recent Evidence to Understand Productive and Reproductive Performance of Livestock. Turk. J. Agric. -Food Sci. Technol. 2018, 6, 203–212. [Google Scholar] [CrossRef]
- Ho, D.H.; Burggren, W.W. Epigenetics and Transgenerational Transfer: A Physiological Perspective. J. Exp. Biol. 2010, 213, 3–16. [Google Scholar] [CrossRef]
- Quintanilha, B.J.; Reis, B.Z.; Duarte, G.B.S.; Cozzolino, S.M.; Rogero, M.M. Nutrimiromics: Role of microRNAs and Nutrition in Modulating Inflammation and Chronic Diseases. Nutrients 2017, 9, 1168. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. Board-Invited Review: Intrauterine Growth Retardation: Implications for the Animal Sciences. J. Anim. Sci. 2006, 84, 2316–2337. [Google Scholar] [CrossRef]
- McMillen, I.C.; Robinson, J.S. Developmental Origins of the Metabolic Syndrome: Prediction, Plasticity, and Programming. Physiol. Rev. 2005, 85, 571–633. [Google Scholar] [CrossRef]
- Murphy, V.E.; Smith, R.; Giles, W.B.; Clifton, V.L. Endocrine Regulation of Human Fetal Growth: The Role of the Mother, Placenta, and Fetus. Endocr. Rev. 2006, 27, 141–169. [Google Scholar] [CrossRef]
- Mickiewicz, M.; Zabielski, R.; Grenier, B.; Le Normand, L.; Savary, G.; Holst, J.J.; Guilloteau, P. Structural and Functional Development of Small Intestine in Intrauterine Growth Retarded Porcine Offspring Born to Gilts Fed Diets with Differing Protein Ratios Throughout Pregnancy. J. Physiol. Pharmacol. 2012, 63, 225. [Google Scholar]
- Meza-Herrera, C.A.; Ross, T.T.; Hallford, D.M.; Hawkins, D.E.; Gonzalez-Bulnes, A. High Periconceptional Protein Intake Modifies Uterine and Embryonic Relationships Increasing Early Pregnancy Losses and Embryo Growth Retardation in Sheep. Reprod. Domest. Anim. 2010, 45, 723–728. [Google Scholar] [CrossRef] [PubMed]
- Lane, M.; Gardner, D.K. Ammonium Induces Aberrant Blastocyst Differentiation, Metabolism, pH Regulation, Gene Expression and Subsequently Alters Fetal Development in the Mouse. Biol. Reprod. 2003, 69, 1109–1117. [Google Scholar] [CrossRef] [PubMed]
- Gardner, D.K.; Hewitt, E.; Linck, D. Diet Affects Embryo Imprinting and Fetal Development. Hum. Reprod. 2004, 19, i27. [Google Scholar]
- Rehfeldt, C.; Lang, I.S.; Görs, S.; Hennig, U.; Kalbe, C.; Stabenow, B.; Metges, C.C. Limited and Excess Dietary Protein During Gestation Affects Growth and Compositional Traits in Gilts and Impairs Offspring Fetal Growth. J. Anim. Sci. 2011, 89, 329–341. [Google Scholar] [CrossRef]
- Vanselow, J.; Kucia, M.; Langhammer, M.; Koczan, D.; Rehfeldt, C.; Metges, C.C. Hepatic Expression of the GH/JAK/STAT/IGF Pathway, Acute-Phase Response Signalling and Complement System are Affected in Mouse Offspring by Prenatal and Early Postnatal Exposure to Maternal High-Protein Diet. Eur. J. Nutr. 2011, 50, 611–623. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Pond, W.G.; Ott, T.; Bazer, F.W. Maternal Dietary Protein Deficiency Decreases Amino Acid Concentrations in Fetal Plasma and Allantoic Fluid of Pigs. J. Nutr. 1998, 128, 894–902. [Google Scholar] [CrossRef]
- Jahan-Mihan, A.; Luhovyy, B.L.; Khoury, D.E.; Anderson, G.H. Dietary Proteins as Determinants of Metabolic and Physiologic Functions of the Gastrointestinal Tract. Nutrients 2011, 3, 574–603. [Google Scholar] [CrossRef]
- Jahan-Mihan, A.; Rodriguez, J.; Christie, C.; Sadeghi, M.; Zerbe, T. The Role of Maternal Dietary Proteins in Development of Metabolic Syndrome in Offspring. Nutrients 2015, 7, 9185–9217. [Google Scholar] [CrossRef] [PubMed]
- Meruvu, S.; Schutz, L.F.; Choudhury, M. Nutritional Influence on miRNA Epigenetic Regulation: Effect of Maternal Diet and miRNAs on the Fetal Metabolic Programming. In Molecular Nutrition: Mother and Infant, 1st ed.; Vinciguerra, M., Cordero Sanchez, P., Eds.; Academic Press: Cambridge, MA, USA, 2021; pp. 401–420. [Google Scholar]
- Blumfield, M.L.; Collins, C.E. High-Protein Diets During Pregnancy: Healthful or Harmful for Offspring? Am. J. Clin. Nutr. 2014, 100, 993–995. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Less, J.F.; Wang, L.; Yan, T.; Kiron, V.; Kaushik, S.J.; Lei, X.G. Meeting Global Feed Protein Demand: Challenge, Opportunity, and Strategy. Annu. Rev. Anim. Biosci. 2019, 7, 221–243. [Google Scholar] [CrossRef] [PubMed]
- Rauw, W.M.; Rydhmer, L.; Kyriazakis, I.; Øverland, M.; Gilbert, H.; Dekkers, J.C.; Gomez-Raya, L. Prospects for Sustainability of Pig Production in Relation to Climate Change and Novel Feed Resources. J. Sci. Food Agric. 2020, 100, 3575–3586. [Google Scholar] [CrossRef] [PubMed]
- Almaraz, M.; Kuempel, C.D.; Salter, A.M.; Halpern, B.S. The Impact of Excessive Protein Consumption on Human Wastewater Nitrogen Loading of US Waters. Front. Ecol. Environ. 2022, 20, 452–458. [Google Scholar] [CrossRef]
- Kizilaslan, M.; Arzik, Y.; Cinar, M.U.; Konca, Y. Genome-Wise Engineering of Ruminant Nutrition–Nutrigenomics: Applications, Challenges, and Future Perspectives—A Review. Ann. Anim. Sci. 2021, 22, 511–521. [Google Scholar] [CrossRef]
- Sohel, M.M.H.; Akyuz, B.; Konca, Y.; Arslan, K.; Gurbulak, K.; Abay, M.; Cinar, M.U. Differential Protein Input in the Maternal Diet Alters the Skeletal Muscle Transcriptome in Fetal Sheep. Mamm. Genom. 2020, 31, 309–324. [Google Scholar] [CrossRef]
- NRC: Nutrient Requirements of Small Ruminants; National Academy Press: Washington, DC, USA, 2007.
- Paulenz, H.; Ådnøy, T.; Fossen, O.H.; Söderquist, L.; Andersen Berg, K. Effect of Deposition Site and Sperm Number on the Fertility of Sheep Inseminated with Liquid Semen. Vet. Rec. 2002, 150, 299–302. [Google Scholar] [CrossRef] [PubMed]
- McGeary, S.E.; Lin, K.S.; Shi, C.Y.; Pham, T.M.; Bisaria, N.; Kelley, G.M.; Bartel, D.P. The Biochemical Basis of microRNA Targeting Efficacy. Science 2019, 366, eaav1741. [Google Scholar] [CrossRef]
- Herwig, R.; Hardt, C.; Lienhard, M.; Kamburov, A. Analyzing and Interpreting Genome Data at the Network Level with ConsensusPathDB. Nat. Protoc. 2016, 11, 1889–1907. [Google Scholar] [CrossRef]
- Parisi, G.; Tulli, F.; Fortina, R.; Marino, R.; Bani, P.; Dalle Zotte, A.; Danieli, P.P. Protein hunger of the feed sector: The alternatives offered by the plant world. Ital. J. Anim. Sci. 2020, 19, 1204–1225. [Google Scholar] [CrossRef]
- Moorby, J.M.; Fraser, M.D. New Feeds and New Feeding Systems in Intensive and Semi-Intensive Forage-Fed Ruminant Livestock Systems. Animal 2021, 15, 100297. [Google Scholar]
- Calsamiglia, S.; Ferret, A.; Reynolds, C.K.; Kristensen, N.B.; Van Vuuren, A.M. Strategies for Optimizing Nitrogen Use by Ruminants. Animal 2010, 4, 1184–1196. [Google Scholar] [CrossRef] [PubMed]
- Gengler, N.; Soyeurt, H.; Dehareng, F.; Bastin, C.; Colinet, F.; Hammami, H.; Dardenne, P. Capitalizing on Fine Milk Composition for Breeding and Management of Dairy Cows. J. Dairy Sci. 2016, 99, 4071–4079. [Google Scholar] [CrossRef]
- Preethi, K.A.; Sekar, D. Dietary microRNAs: Current Status and Perspective in Food Science. J. Food Biochem. 2021, 45, e13827. [Google Scholar] [CrossRef] [PubMed]
- Pokharel, K.; Peippo, J.; Li, M.H.; Kantanen, J. Identification and Characterization of miRNAs During Early Pregnancy in Domestic Sheep. Anim. Genet. 2020, 51, 833–836. [Google Scholar] [CrossRef] [PubMed]
- Kaczmarek, M.M.; Najmula, J.; Guzewska, M.M.; Przygrodzka, E. miRNAs in the Peri-Implantation Period: Contribution to Embryo–Maternal Communication in Pigs. Int. J. Mol. Sci. 2020, 21, 2229. [Google Scholar] [CrossRef]
- Morales-Prieto, D.M.; Favaro, R.R.; Markert, U.R. Placental miRNAs in Feto-Maternal Communication Mediated by Extracellular Vesicles. Placenta 2020, 102, 27–33. [Google Scholar] [CrossRef]
- Salilew-Wondim, D.; Gebremedhn, S.; Hoelker, M.; Tholen, E.; Hailay, T.; Tesfaye, D. The Role of Micrornas in Mammalian Fertility: From Gametogenesis to Embryo Implantation. Int. J. Mol. Sci. 2020, 21, 585. [Google Scholar] [CrossRef]
- Kabekkodu, S.P.; Shukla, V.; Varghese, V.K.; D’Souza, J.; Chakrabarty, S.; Satyamoorthy, K. Clustered miRNAs and Their Role in Biological Functions and Diseases. Biol. Rev. 2018, 93, 1955–1986. [Google Scholar] [CrossRef]
- Hong, A.V.; Bourg, N.; Sanatine, P.; Poupiot, J.; Charton, K.; Gicquel, E.; Israeli, D. Dlk1-Dio3 Cluster miRNAs Regulate Mitochondrial Functions in the Dystrophic Muscle in Duchenne Muscular Dystrophy. Life Sci. Alliance 2023, 6, e202201506. [Google Scholar] [CrossRef] [PubMed]
- Sanson, M.; Vu Hong, A.; Massourides, E.; Bourg, N.; Suel, L.; Amor, F.; Israeli, D. miR-379 Links Glucocorticoid Treatment with Mitochondrial Response in Duchenne Muscular Dystrophy. Sci. Rep. 2020, 10, 9139. [Google Scholar] [CrossRef] [PubMed]
- Amor, F.; Vu Hong, A.; Corre, G.; Sanson, M.; Suel, L.; Blaie, S.; Israeli, D. Cholesterol Metabolism is a Potential Therapeutic Target in Duchenne Muscular Dystrophy. J. Cachexia Sarcopenia Muscle 2021, 12, 677–693. [Google Scholar] [CrossRef] [PubMed]
- Walling, G.A.; Visscher, P.M.; Wilson, A.D.; McTeir, B.L.; Simm, G.; Bishop, S.C. Mapping of Quantitative Trait Loci for Growth and Carcass Traits in Commercial Sheep Populations. J. Anim. Sci. 2004, 82, 2234–2245. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liu, J.; Zhao, F.; Ren, H.; Xu, L.; Lu, J.; Du, L. Genome-Wide Association Studies for Growth and Meat Production Traits in Sheep. PLoS ONE 2013, 8, e66569. [Google Scholar] [CrossRef]
- Shandilya, U.K.; Sharma, A.; Naylor, D.; Canovas, A.; Mallard, B.; Karrow, N.A. Expression Profile of miRNA from High, Middle, and Low Stress-Responding Sheep During Bacterial Endotoxin Challenge. Animals 2023, 13, 508. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Shandilya, U.K.; Sullivan, T.; Naylor, D.; Canovas, A.; Mallard, B.A.; Karrow, N.A. Identification of Ovine Serum miRNAs Following Bacterial Lipopolysaccharide Challenge. Int. J. Mol. Sci. 2020, 21, 7920. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Shandilya, U.K.; Sullivan, T.; Naylor, D.; Cánovas, A.; Mallard, B.; Karrow, N. PSXIV-20 Ovine Circulatory Markers Regulating the Acute-phase Response of Variable Stress Responding Sheep to LPS Challenge. J. Anim. Sci. 2021, 99, 494–495. [Google Scholar] [CrossRef]
- Peter, M.E. Targeting of mRNAs by Multiple miRNAs: The Next Step. Oncogene 2010, 29, 2161–2164. [Google Scholar] [CrossRef]
- Wu, S.; Huang, S.; Ding, J.; Zhao, Y.; Liang, L.; Liu, T.; He, X. Multiple microRNAs Modulate p21Cip1/Waf1 Expression by Directly Targeting Its 3′ Untranslated Region. Oncogene 2010, 29, 2302–2308. [Google Scholar] [CrossRef]
- DeVeale, B.; Swindlehurst-Chan, J.; Blelloch, R. The Roles of microRNAs in Mouse Development. Nat. Rev. Genet. 2021, 22, 307–323. [Google Scholar] [CrossRef] [PubMed]
- Junho, C.V.C.; Caio-Silva, W.; Trentin-Sonoda, M.; Carneiro-Ramos, M.S. An Overview of the Role of Calcium/Calmodulin-Dependent Protein Kinase in Cardiorenal Syndrome. Front. Physiol. 2020, 11, 735. [Google Scholar] [CrossRef] [PubMed]
- Ichinose, K.; Juang, Y.T.; Crispín, J.C.; Kis-Toth, K.; Tsokos, G.C. Suppression of Autoimmunity and Organ Pathology in Lupus-prone Mice Upon Inhibition of Calcium/Calmodulin-Dependent Protein Kinase Type IV. Arthritis Rheum. 2011, 63, 523–529. [Google Scholar] [CrossRef]
- Gu, R.; Ding, M.; Shi, D.; Huang, T.; Guo, M.; Yu, L.; Hu, J.; Huang, W.; Liao, H. Calcium/Calmodulin-Dependent Protein Kinase IV Mediates IFN-γ-Induced Immune Behaviors in Skeletal Muscle Cells. Cell. Physiol. Biochem. 2018, 46, 351–364. [Google Scholar] [CrossRef] [PubMed]
- Umeda, K.; Negishi, M.; Katoh, H. RasGRF1 Mediates Brain-Derived Neurotrophic Factor-Induced Axonal Growth in Primary Cultured Cortical Neurons. Biochem. Biophys. Rep. 2018, 17, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Rentería, I.; García-Suárez, P.C.; Fry, A.C.; Moncada-Jiménez, J.; Machado-Parra, J.P.; Antunes, B.M.; Jiménez-Maldonado, A. The Molecular Effects of BDNF Synthesis on Skeletal Muscle: A Mini-Review. Front. Physiol. 2022, 13, 934714. [Google Scholar] [CrossRef]
- Mousavi, K.; Jasmin, B.J. BDNF is Expressed in Skeletal Muscle Satellite Cells and Inhibits Myogenic Differentiation. J. Neurosci. 2006, 26, 5739–5749. [Google Scholar] [CrossRef] [PubMed]
- Mousavi, K.; Parry, D.J.; Jasmin, B.J. BDNF Rescues Myosin Heavy Chain IIB Muscle Fibers after Neonatal Nerve Injury. Am. J. Physiol. Cell Physiol. 2004, 287, C22–C29. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Ji, Y.; Liu, R.; Zhu, X.; Wang, K.; Yang, X.; Liu, B.; Gao, Z.; Huang, Y.; Shen, Y.; et al. Mitochondrial Dysfunction: Roles in Skeletal Muscle Atrophy. J. Transl. Med. 2023, 21, 503. [Google Scholar] [CrossRef]
- Papaioannou, G.; Inloes, J.B.; Nakamura, Y.; Paltrinieri, E.; Kobayashi, T. let-7 and miR-140 microRNAs Coordinately Regulate Skeletal Development. Proc. Natl. Acad. Sci. USA 2013, 110, E3291–E3300. [Google Scholar] [CrossRef]
- Yan, X.; Huang, Y.; Zhao, J.X.; Rogers, C.J.; Zhu, M.J.; Ford, S.P.; Nathanielsz, P.W.; Du, M. Maternal Obesity Downregulates microRNA let-7g Expression, A Possible Mechanism for Enhanced Adipogenesis during Ovine Fetal Skeletal Muscle Development. Int. J. Obes. 2013, 37, 568–575. [Google Scholar] [CrossRef] [PubMed]
- Jones, A.K.; Hoffman, M.L.; Pillai, S.M.; McFadden, K.K.; Govoni, K.E.; Zinn, S.A.; Reed, S.A. Gestational Restricted-and Over-feeding Promote Maternal and Offspring Inflammatory Responses That are Distinct and Dependent on Diet in Sheep. Biol. Rep. 2018, 98, 184–196. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Ding, J.; Zhang, Y.; Liu, S.; Yang, J.; Yin, T. Regulation and Function of Chemokines at the Maternal–Fetal Interface. Front. Cell Dev. Biol. 2022, 10, 826053. [Google Scholar] [CrossRef] [PubMed]
- Ngom, P.T.; Collinson, A.C.; Pido-Lopez, J.; Henson, S.M.; Prentice, A.M.; Aspinall, R. Improved Thymic Function in Exclusively Breastfed Infants Is Associated with Higher Interleukin 7 Concentrations in Their Mothers’ Breast Milk. Am. J. Clin. Nutr. 2004, 80, 722–728. [Google Scholar] [CrossRef] [PubMed]
- Aspinall, R.; Prentice, A.M.; Ngom, P.T. Interleukin 7 from Maternal Milk Crosses the Intestinal Barrier and Modulates T-Cell Development in Offspring. PLoS ONE 2011, 6, e20812. [Google Scholar] [CrossRef] [PubMed]
- Bennett, J.L.; Pratt, A.G.; Dodds, R.; Sayer, A.A.; Isaacs, J.D. Rheumatoid Sarcopenia: Loss of Skeletal Muscle Strength and Mass in Rheumatoid Arthritis. Nat. Rev. Rheumatol. 2023, 19, 239–251. [Google Scholar] [CrossRef] [PubMed]
- Steinz, M.M.; Santos-Alves, E.; Lanner, J.T. Skeletal Muscle Redox Signaling in Rheumatoid Arthritis. Clin. Sci. 2020, 134, 2835–2850. [Google Scholar] [CrossRef]
- Rossatti, P.; Redpath, G.M.; Ziegler, L.; Samson, G.P.; Clamagirand, C.D.; Legler, D.F.; Rossy, J. Rapid Increase in Transferrin Receptor Recycling Promotes Adhesion during T Cell Activation. BMC Biol. 2011, 20, 189. [Google Scholar] [CrossRef]
Transcript ID (Array Design) | miRBase ID | Fold Change | p-Value | Style | Mature Sequence | OAR |
---|---|---|---|---|---|---|
LP vs. HP | ||||||
oar-miR-3957-5p | MIMAT0019325 | 4.58 | 0.04 | up | cucggagaguggagcugugggugu | 18 |
oar-miR-329a-3p | MIMAT0019266 | 2.96 | 0.04 | up | aacacaccugguuaaccuuuuu | 18 |
SP vs. HP | ||||||
oar-miR-3957-5p | MIMAT0019325 | 4.25 | 0.005 | up | cucggagaguggagcugugggugu | 18 |
oar-miR-432 | MIMAT0001416 | 2.47 | 0.007 | up | ucuuggaguaggucauugggugg | 18 |
oar-miR-200c | MIMAT0030044 | 2.24 | 0.009 | up | uaauacugccggguaaugaugg | 3 |
oar-miR-362 | MIMAT0030060 | 2.24 | 0.01 | up | aauccuuggaaccuaggugugagu | X |
oar-miR-409-3p | MIMAT0019328 | 2.2 | 0.01 | up | cgaauguugcucggugaaccccu | 18 |
oar-let-7c | MIMAT0014964 | 2.18 | 0.01 | up | ugagguaguagguuguaugguu | 1 |
oar-miR-493-3p | MIMAT0019238 | 2.17 | 0.01 | up | ugaaggucuacugugugccagg | 18 |
oar-miR-181a | MIMAT0014973 | 2.12 | 0.02 | up | aacauucaacgcugucggugagu | 12 |
oar-miR-379-5p | MIMAT0019247 | 2.11 | 0.02 | up | ugguagacuauggaacguaggc | 18 |
oar-miR-134-5p | MIMAT0019308 | 2.1 | 0.03 | up | ugugacugguugaccagaggg | 18 |
oar-miR-127 | MIMAT0001415 | 2.04 | 0.04 | up | aucggauccgucugagcuuggcu | 18 |
SP vs. LP | ||||||
oar-miR-200c | MIMAT0030044 | 2.45 | 0.01 | up | uaauacugccggguaaugaugg | 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akyüz, B.; Sohel, M.M.H.; Konca, Y.; Arslan, K.; Gürbulak, K.; Abay, M.; Kaliber, M.; White, S.N.; Cinar, M.U. Effects of Low and High Maternal Protein Intake on Fetal Skeletal Muscle miRNAome in Sheep. Animals 2024, 14, 1594. https://doi.org/10.3390/ani14111594
Akyüz B, Sohel MMH, Konca Y, Arslan K, Gürbulak K, Abay M, Kaliber M, White SN, Cinar MU. Effects of Low and High Maternal Protein Intake on Fetal Skeletal Muscle miRNAome in Sheep. Animals. 2024; 14(11):1594. https://doi.org/10.3390/ani14111594
Chicago/Turabian StyleAkyüz, Bilal, Md Mahmodul Hasan Sohel, Yusuf Konca, Korhan Arslan, Kutlay Gürbulak, Murat Abay, Mahmut Kaliber, Stephen N. White, and Mehmet Ulas Cinar. 2024. "Effects of Low and High Maternal Protein Intake on Fetal Skeletal Muscle miRNAome in Sheep" Animals 14, no. 11: 1594. https://doi.org/10.3390/ani14111594