The Simulated Physiological Oocyte Maturation (SPOM) System Enhances Cytoplasmic Maturation and Oocyte Competence in Cattle
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Oocyte Collection and In Vitro Maturation
2.2. In Vitro Fertilisation (IVF) and In Vitro Embryo Culture (IVC)
2.3. Quantification of Total Cell Number
2.4. Evaluation of Cryopreservation Tolerance
2.5. Determination of Relative mRNA Abundance of Stress-Related Genes
2.6. Analysis of Mitochondrial Activity and Distribution
2.7. Experimental Design and Statistical Analysis
3. Results
3.1. Effects of cAMP Modulators on Nuclear and Cytoplasmic Maturation
3.2. The Use of cAMP Modulators during IVM Increases Bovine Embryo Development
3.3. Oocytes Matured in the Presence of cAMP Modulators Show an Enhanced Embryo Quality
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ferré, L.B.; Kjelland, M.E.; Strøbech, L.B.; Hyttel, P.; Mermillod, P.; Ross, P.J. Review: Recent advances in bovine in vitro embryo production: Reproductive biotechnology history and methods. Animal 2020, 14, 991–1004. [Google Scholar] [CrossRef]
- Lonergan, P.; Fair, T. The ART of studying early embryo development: Progress and challenges in ruminant embryo culture. Theriogenology 2014, 81, 49–55. [Google Scholar] [CrossRef]
- Dekel, N. Regulation of Oocyte Maturation. Ann. N. Y. Acad. Sci. 1988, 541, 211–216. [Google Scholar] [CrossRef]
- Tsafriri, A.; Pomerantz, S.H. 8 Oocyte maturation inhibitor. Clin. Endocrinol. Metab. 1986, 15, 157–170. [Google Scholar] [CrossRef]
- Törnell, J.; Billig, H.; Hillensjö, T. REVIEW: Regulation of oocyte maturation by changes in ovarian levels of cyclic nucleotides. Hum. Reprod. 1991, 6, 411–422. [Google Scholar] [CrossRef]
- Luciano, A.M.; Franciosi, F.; Modina, S.C.; Lodde, V. Gap Junction-Mediated Communications Regulate Chromatin Remodeling During Bovine Oocyte Growth and Differentiation Through cAMP-Dependent Mechanism(s)1. Biol. Reprod. 2011, 85, 1252–1259. [Google Scholar] [CrossRef]
- Anguita, B.; Vandaele, L.; Mateusen, B.; Maes, D.; Van Soom, A. Developmental competence of bovine oocytes is not related to apoptosis incidence in oocytes, cumulus cells and blastocysts. Theriogenology 2007, 67, 537–549. [Google Scholar] [CrossRef]
- Voronina, E.; Wessel, G.M. The Regulation of Oocyte Maturation. Curr. Top. Dev. Biol. 2003, 58, 53–110. [Google Scholar] [CrossRef]
- Fair, T.; Hulshof, S.C.J.; Hyttel, P.; Greve, T.; Boland, M. Oocyte ultrastructure in bovine primordial to early tertiary follicles. Anat. Embryol. 1997, 195, 327–336. [Google Scholar] [CrossRef]
- Van Blerkom, J. Mitochondrial function in the human oocyte and embryo and their role in developmental competence. Mitochondrion 2011, 11, 797–813. [Google Scholar] [CrossRef]
- Van Blerkom, J.; Runner, M.N. Mitochondrial reorganization during resumption of arrested meiosis in the mouse oocyte. Am. J. Anat. 1984, 171, 335–355. [Google Scholar] [CrossRef]
- Hyttel, P.; Xu, K.P.; Smith, S.; Greve, T. Ultrastructure of in-vitro oocyte maturation in cattle. Reproduction 1986, 78, 615–625. [Google Scholar] [CrossRef]
- Sun, Q.Y.; Wu, G.M.; Lai, L.; Park, K.W.; Cabot, R.; Cheong, H.T.; Day, B.N.; Prather, R.S.; Schatten, H. Translocation of active mitochondria during pig oocyte maturation, fertilization and early embryo development in vitro. Reproduction 2001, 122, 155–163. [Google Scholar] [CrossRef]
- Wilding, M.; Dale, B.; Marino, M.; Di Matteo, L.; Alviggi, C.; Pisaturo, M.L.; Lombardi, L.; De Placido, G. Mitochondrial aggregation patterns and activity in human oocytes and preimplantation embryos. Hum. Reprod. 2001, 16, 909–917. [Google Scholar] [CrossRef]
- Kirillova, A.; Smitz, J.E.J.; Sukhikh, G.T.; Mazunin, I. The Role of Mitochondria in Oocyte Maturation. Cells 2021, 10, 2484. [Google Scholar] [CrossRef]
- Meirelles, F.; Caetano, A.; Watanabe, Y.; Ripamonte, P.; Carambula, S.; Merighe, G.; Garcia, S. Genome activation and developmental block in bovine embryos. Anim. Reprod. Sci. 2004, 82–83, 13–20. [Google Scholar] [CrossRef]
- Ferreira, E.; Vireque, A.; Adona, P.; Meirelles, F.; Ferriani, R.; Navarro, P. Cytoplasmic maturation of bovine oocytes: Structural and biochemical modifications and acquisition of developmental competence. Theriogenology 2009, 71, 836–848. [Google Scholar] [CrossRef]
- Edwards, R.G. Maturation in vitro of Mouse, Sheep, Cow, Pig, Rhesus Monkey and Human Ovarian Oocytes. Nature 1965, 208, 349–351. [Google Scholar] [CrossRef]
- Ferré-Pujol, P.; Nguyen, X.K.; Nagahara, T.; Bui, T.T.M.; Wakai, T.; Funahashi, H. Removal of cumulus cells around 20 h after the start of in vitro maturation improves the meiotic competence of porcine oocytes via reduction in cAMP and cGMP levels. J. Reprod. Dev. 2019, 65, 177–182. [Google Scholar] [CrossRef]
- Thompson, J.; Lane, M.; Gilchrist, R. Metabolism of the bovine cumulus-oocyte complex and influence on subsequent developmental competence. Reprod. Domest. Ruminants 2007, 6, 179–190. [Google Scholar] [CrossRef]
- Gilchrist, R.B.; Ho, T.M.; De Vos, M.; Sanchez, F.; Romero, S.; Ledger, W.L.; Anckaert, E.; Vuong, L.N.; Smitz, J. A fresh start for IVM: Capacitating the oocyte for development using pre-IVM. Hum. Reprod. Updat. 2024, 30, 3–25. [Google Scholar] [CrossRef]
- Rose, B.I.; Nguyen, K.; Brown, S.E. The Effect of In Vitro Maturation (IVM) Protocol Changes on Measures of Oocyte/Embryo Competence. Reprod. Med. 2023, 4, 65–73. [Google Scholar] [CrossRef]
- Albuz, F.K.; Sasseville, M.; Lane, M.; Armstrong, D.T.; Thompson, J.G.; Gilchrist, R.B. Simulated physiological oocyte maturation (SPOM): A novel in vitro maturation system that substantially improves embryo yield and pregnancy outcomes. Hum. Reprod. 2010, 25, 2999–3011. [Google Scholar] [CrossRef]
- Richani, D.; Wang, X.; Zeng, H.; Smitz, J.; Thompson, J.; Gilchrist, R. Pre-maturation with cAMP modulators in conjunction with EGF-like peptides during in vitro maturation enhances mouse oocyte developmental competence. Mol. Reprod. Dev. 2014, 81, 422–435. [Google Scholar] [CrossRef]
- Park, B.; Lee, H.; Lee, Y.; Elahi, F.; Lee, J.; Lee, S.T.; Park, C.-K.; Hyun, S.-H.; Lee, E. Cilostamide and forskolin treatment during pre-IVM improves preimplantation development of cloned embryos by influencing meiotic progression and gap junction communication in pigs. Theriogenology 2016, 86, 757–765. [Google Scholar] [CrossRef]
- Adona, P.; Pires, P.; Quetglas, M.D.; Schwarz, K.; Leal, C. Nuclear maturation kinetics and in vitro embryo development of cattle oocytes prematured with butyrolactone I combined or not combined with roscovitine. Anim. Reprod. Sci. 2008, 104, 389–397. [Google Scholar] [CrossRef]
- Strączyńska, P.; Papis, K.; Morawiec, E.; Czerwiński, M.; Gajewski, Z.; Olejek, A.; Bednarska-Czerwińska, A. Signaling mechanisms and their regulation during in vivo or in vitro maturation of mammalian oocytes. Reprod. Biol. Endocrinol. 2022, 20, 37. [Google Scholar] [CrossRef]
- Leal, G.R.; Graciosa, M.A.G.; Monteiro, C.A.S.; Pasolini, R.; Camargo, A.J.d.R.; Oliveira, C.S.; Vasconcelos, C.O.d.P.; Nogueira, L.A.G.; Ferreira, A.M.R.; Serapião, R.V. The SPOM-adapted IVM system improves in vitro production of bovine embryos. Theriogenology 2020, 158, 277–282. [Google Scholar] [CrossRef]
- Gilchrist, R.; Zeng, H.; Wang, X.; Richani, D.; Smitz, J.; Thompson, J. Reevaluation and evolution of the simulated physiological oocyte maturation system. Theriogenology 2015, 84, 656–657. [Google Scholar] [CrossRef]
- Cánepa, M.J.; Ortega, N.M.; Monteleone, M.C.; Mucci, N.; Kaiser, G.G.; Brocco, M.; Mutto, A. Expression Profile of Genes as Indicators of Developmental Competence and Quality of In Vitro Fertilization and Somatic Cell Nuclear Transfer Bovine Embryos. PLoS ONE 2014, 9, e108139. [Google Scholar] [CrossRef]
- Songsasen, N.; Henson, L.; Tipkantha, W.; Thongkittidilok, C.; Henson, J.; Chatdarong, K.; Comizzoli, P. Dynamic changes in mitochondrial DNA, distribution and activity within cat oocytes during folliculogenesis. Reprod. Domest. Anim. 2017, 52, 71–76. [Google Scholar] [CrossRef]
- Bernal-Ulloa, S.M.; Heinzmann, J.; Herrmann, D.; Hadeler, K.-G.; Aldag, P.; Winkler, S.; Pache, D.; Baulain, U.; Lucas-Hahn, A.; Niemann, H. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle. PLoS ONE 2016, 11, e0150264. [Google Scholar] [CrossRef] [PubMed]
- Ushijima, H.; Akiyama, K.; Tajima, T. Classification of Morphological Changes Based on the Number of Cleavage Divisions in Bovine Embryos. J. Reprod. Dev. 2009, 55, 83–87. [Google Scholar] [CrossRef]
- Downs, S.M.; Coleman, D.L.; Eppig, J.J. Maintenance of murine oocyte meiotic arrest: Uptake and metabolism of hypoxanthine and adenosine by cumulus cell-enclosed and denuded oocytes. Dev. Biol. 1986, 117, 174–183. [Google Scholar] [CrossRef]
- Hashimoto, S.; Minami, N.; Takakura, R.; Imai, H. Bovine Immature Oocytes Acquire Developmental Competence During Meiotic Arrest In Vitro1. Biol. Reprod. 2002, 66, 1696–1701. [Google Scholar] [CrossRef]
- Leal, G.R.; Monteiro, C.A.S.; Carvalheira, L.d.R.; Souza-Fabjan, J.M. The Simulated Physiological Oocyte Maturation (SPOM) system in domestic animals: A systematic review. Theriogenology 2022, 188, 90–99. [Google Scholar] [CrossRef] [PubMed]
- Jeseta, M.; Knitlova, D.C.; Hanzalova, K.; Hulinska, P.; Hanulakova, S.; Milakovic, I.; Nemcova, L.; Kanka, J.; Machatkova, M. Mitochondrial Patterns in Bovine Oocytes with Different Meiotic Competence Related to Their in vitro Maturation. Reprod. Domest. Anim. 2014, 49, 469–475. [Google Scholar] [CrossRef]
- Dumollard, R.; Duchen, M.; Sardet, C. Calcium signals and mitochondria at fertilisation. Semin. Cell Dev. Biol. 2006, 17, 314–323. [Google Scholar] [CrossRef]
- Dalcin, L.; Silva, R.C.; Paulini, F.; Silva, B.D.M.; Neves, J.P.; Lucci, C.M. Cytoskeleton structure, pattern of mitochondrial activity and ultrastructure of frozen or vitrified sheep embryos. Cryobiology 2013, 67, 137–145. [Google Scholar] [CrossRef]
- Boruszewska, D.; Kowalczyk-Zieba, I.; Suwik, K.; Staszkiewicz-Chodor, J.; Jaworska, J.; Lukaszuk, K.; Woclawek-Potocka, I. Prostaglandin E2 affects in vitro maturation of bovine oocytes. Reprod. Biol. Endocrinol. 2020, 18, 40. [Google Scholar] [CrossRef]
- Niu, Y.-J.; Zhou, D.; Zhou, W.; Nie, Z.-W.; Kim, J.-Y.; Oh, Y.; Lee, S.-R.; Cui, X.-S. Nitric Oxide-induced Protein S-nitrosylation Causes Mitochondrial Dysfunction and Accelerates Post-ovulatory Aging of Oocytes in Cattle. J. Anim. Reprod. Biotechnol. 2020, 35, 102–111. [Google Scholar] [CrossRef]
- Babayev, E.; Seli, E. Oocyte mitochondrial function and reproduction. Curr. Opin. Obstet. Gynecol. 2015, 27, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Dumollard, R.; Carroll, J.; Duchen, M.; Campbell, K.; Swann, K. Mitochondrial function and redox state in mammalian embryos. Semin. Cell Dev. Biol. 2009, 20, 346–353. [Google Scholar] [CrossRef] [PubMed]
- Dumollard, R.; Marangos, P.; Fitzharris, G.; Swann, K.; Duchen, M.; Carroll, J. Sperm-triggered [Ca2+] oscillations and Ca2+homeostasis in the mouse egg have an absolute requirement for mitochondrial ATP production. Development 2004, 131, 3057–3067. [Google Scholar] [CrossRef] [PubMed]
- Van Blerkom, J. Mitochondria in early mammalian development. Semin. Cell Dev. Biol. 2009, 20, 354–364. [Google Scholar] [CrossRef] [PubMed]
- Van Blerkom, J. Mitochondria in human oogenesis and preimplantation embryogenesis: Engines of metabolism, ionic regulation and developmental competence. Reproduction 2004, 128, 269–280. [Google Scholar] [CrossRef] [PubMed]
- Gutnisky, C.; Dalvit, G.C.; Thompson, J.G.; Cetica, P.D. Pentose phosphate pathway activity: Effect on in vitro maturation and oxidative status of bovine oocytes. Reprod. Fertil. Dev. 2014, 26, 931–942. [Google Scholar] [CrossRef] [PubMed]
- Snook, R.R.; Hosken, D.J.; Karr, T.L. The biology and evolution of polyspermy: Insights from cellular and functional studies of sperm and centrosomal behavior in the fertilized egg. Reproduction 2011, 142, 779–792. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.H.; Seidel, G.E., Jr. Effects of heparin and sperm concentration on cleavage and blastocyst development rates of bovine oocytes inseminated with flow cytometrically-sorted sperm. Theriogenology 2004, 62, 819–830. [Google Scholar] [CrossRef]
- Papi, M.; Brunelli, R.; Familiari, G.; Frassanito, M.C.; Lamberti, L.; Maulucci, G.; Monaci, M.; Pappalettere, C.; Parasassi, T.; Relucenti, M.; et al. Whole-Depth Change in Bovine Zona Pellucida Biomechanics after Fertilization: How Relevant in Hindering Polyspermy? PLoS ONE 2012, 7, e45696. [Google Scholar] [CrossRef]
- Mori, M.; Otoi, T.; Suzuki, T. Correlation between the Cell Number and Diameter in Bovine Embryos Produced In Vitro. Reprod. Domest. Anim. 2002, 37, 181–184. [Google Scholar] [CrossRef] [PubMed]
- Ushijima, H.; Akiyama, K.; Tajima, T. Transition of Cell Numbers in Bovine Preimplantation Embryos: In Vivo Collected and In Vitro Produced Embryos. J. Reprod. Dev. 2008, 54, 239–243. [Google Scholar] [CrossRef] [PubMed]
- Velazquez, M.; Hadeler, K.-G.; Herrmann, D.; Kues, W.; Rémy, B.; Beckers, J.-F.; Niemann, H. In vivo oocyte IGF-1 priming increases inner cell mass proliferation of in vitro-formed bovine blastocysts. Theriogenology 2012, 78, 517–527. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Amplicon Length (bp) |
---|---|---|---|
70 kDa heat shock protein (hsp70) | CCATCTTTTGTCAGTTTCTTTTTGTAGTA | GGAAGTAAACAGAAACGGGTGAA | 75 |
Proteasome subunit β5 (psmβ5) | GCTTCTGGGAGAGGCTGTTG | CGGAGATGCGTTCCTTGTTT | 69 |
Activating transcription factor 6 (atf-6) | AAGCTGCTCCATTTCTCACCAT | CTTGCCTTGTGTCAGCTTCAGT | 65 |
Immunoglobulin heavy chain binding protein (bip) | GATTGAAGTCACCTTTGAGATAGATGTG | GATCTTATTTTTGTTGCCTGTACCTTT | 85 |
Bcl2 associated X protein (bax) | GCGCATCGGAGATGAATTG | CCACAGCTGCGATCATCCT | 59 |
Hydroxymethylbilane synthase (hmbs) | CTTTGGAGAGGAATGAAGTGG | AATGGTGAAGCCAGGAGGAA | 80 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Navarro, M.; Fanti, T.; Ortega, N.M.; Waremkraut, M.; Guaimas, F.; Mutto, A.Á.; Blüguermann, C. The Simulated Physiological Oocyte Maturation (SPOM) System Enhances Cytoplasmic Maturation and Oocyte Competence in Cattle. Animals 2024, 14, 1893. https://doi.org/10.3390/ani14131893
Navarro M, Fanti T, Ortega NM, Waremkraut M, Guaimas F, Mutto AÁ, Blüguermann C. The Simulated Physiological Oocyte Maturation (SPOM) System Enhances Cytoplasmic Maturation and Oocyte Competence in Cattle. Animals. 2024; 14(13):1893. https://doi.org/10.3390/ani14131893
Chicago/Turabian StyleNavarro, Micaela, Tomás Fanti, Nicolas Matias Ortega, Magalí Waremkraut, Francisco Guaimas, Adrian Ángel Mutto, and Carolina Blüguermann. 2024. "The Simulated Physiological Oocyte Maturation (SPOM) System Enhances Cytoplasmic Maturation and Oocyte Competence in Cattle" Animals 14, no. 13: 1893. https://doi.org/10.3390/ani14131893