1. Introduction
Abrupt change in cat dietary patterns may trigger inflammation and disrupt the intestinal microbiota, especially when cats transition to high-protein diets. Since cats are carnivorous animals, commercial cat foods often contain high levels of protein [
1]. Employing a gradual transition approach over a span of seven days when introducing a new cat food regimen has been shown to mitigate the occurrence of gastrointestinal disturbances. Nevertheless, the prevalence of feline diarrhea resulting from dietary change persists, primarily due to challenges in owner compliance and inherent individual variations among cats.
Extensive research has focused on probiotic microorganisms for treating intestinal disorders [
2,
3]. Furthermore, probiotic microorganisms also show promise in managing metabolic conditions like obesity and diabetes by influencing the composition of the intestinal microbiota [
4]. However, against the backdrop of rising antimicrobial resistance, the role of probiotics in alleviating gastrointestinal diseases in pets has been repeatedly highlighted, though their efficacy is often determined by specific strains [
5,
6]. Additionally, it is imperative to recognize that the safety concerns associated with probiotics should not be underestimated. A study [
7] observed that, in patients with predicted severe acute pancreatitis, the probiotic group demonstrated a heightened risk of mortality. Furthermore, probiotic strains can directly cause bacteremia [
8]. Therefore, in recent years, some scholars have directed their efforts towards exploring the potential roles of inactivated probiotics, also known as paraprobiotics [
9].
Bifidobacterium spp. is a widely studied probiotic playing a crucial role in human intestinal health by contributing to various beneficial processes, including enhancement of lactose digestion, manifestation of anti-cancer activity, reduction of serum cholesterol levels, synthesis of B-complex vitamins, and facilitation of calcium absorption [
10]. Pasteurized yogurt containing heat-treated
Bifidobacterium longum has shown mitigative effects on allergic airway inflammation by altering the structure and function of the intestinal microbiota [
11]. Additionally, heat-treated
Bifidobacterium longum exhibits inhibitory effects on proliferation and promotes apoptosis of human colon cancer cells [
12]. Compared to probiotics, paraprobiotics not only address the safety concerns associated with the use of live microbial cells but also have an extended shelf life. Currently, there are no studies reporting the effects of heat-treated
Bifidobacterium longum on the intestinal microbiota and intestinal barrier in cats.
Prebiotics, mainly plant-derived oligosaccharides, resistant starch, and other compounds, serve as fermentation substrates in the gastrointestinal tract. They promote the growth of beneficial microorganisms and contribute to overall intestinal health [
13]. Fibersol-2, a resistant maltodextrin (RMD) with prebiotic properties, is a non-viscous, soluble, and fermentable dietary fiber produced from corn starch [
13]. Fibersol-2 not only reduces blood glucose, postprandial insulin levels, triglycerides, and serum cholesterol levels, but also promotes intestinal health. It accelerates the transit of feces and stimulates the growth of various beneficial bacteria, indirectly inhibiting the proliferation of potential pathogenic microorganisms [
14]. Research indicates that, for adults with insufficient dietary fiber intake, the administration of 25 g of RMD resulted in a 38% increase in the quantity of
Bifidobacteria in the stool. The stool volume also increased, and participants did not exhibit noticeable gastrointestinal discomfort symptoms [
15]. Nathaniel D. Fastinger, PhD and colleagues [
16] also observed that the addition of Fibersol-2 significantly increased the abundance of fecal
Bifidobacterium in a healthy population.
The impact of heat-treated Bifidobacterium longum and Fibersol-2 on intestinal health has been extensively studied. However, there is limited research assessing their effects on the intestinal microbiota and immune function in cats. This study marks the first attempt to combine heat-treated Bifidobacterium longum CECT-7347 with Fibersol-2 in cats, aiming at exploring their influence on the intestinal health of cats undergoing an abrupt dietary change. It is anticipated that this combination could potentially serve as a dietary management tool to improve feline intestinal health.
2. Materials and Methods
2.1. Diets
The functional additives (ADM (Shanghai) Management Co., Ltd., Shanghai, China) contain heat-treated
Bifidobacterium longum CECT-7347 and Fibersol-2. The exact proportions of each component in the formulation are proprietary. The experiment evaluated two different diets with or without the functional additives over two periods. The first diet was a commercial diet for adult cats with a lower protein concentration (33%) (LPF). The second diet was a commercial diet for adult cats with a higher protein concentration (40%) (HPF). The composition and nutritional components of the diets for both groups are detailed in
Table 1 and
Table 2.
2.2. Animals and Groups
Twenty-four British shorthair cats that had not received antibiotics in the past three months and showed no gastrointestinal symptoms were selected from Shanchong Shuifu Pet Nutrition Research Center in Fangshan District, Beijing, China. All cats had been regularly dewormed and immunized, with good overall health. Each cat was housed in a separate cage within the same room. They had free access to food, with fresh food and water provided at 9 a.m. each day, and litter changed at 8 p.m. daily. The cats were divided into two groups, each consisting of 12 cats (6 males and 6 females in each group). The age, weight, and body condition score (BCS) did not exhibit significant differences among the groups (
p > 0.05). Group allocations are detailed in
Table 3. Throughout the experiment, one female cat each from the control and treated groups was excluded: one due to food refusal and the other due to neurological symptoms resulting from an aural polyp. Prior to the commencement of the experiment, all cats were fed an LPF diet for 10 days, designated as the pre-feeding phase. From day 1 to day 14, the control group received the LPF diet, while the treated group received the LPF diet supplemented with 0.16% functional additives. Subsequently, from day 15 to day 28, the control group transitioned to an HPF diet, while the treated group received an HPF diet supplemented with 0.16% functional additives. The experimental design and a timeline of events are shown in
Figure 1.
2.3. Sample Collection
On days 0, 14, 17, 21, and 28 of the experiment, 2 mL of blood was collected from the medial vein of the hind limbs into non-heparinized blood collection tubes at room temperature. The tubes were allowed to stand for 30 min before being centrifuged at 3000× g revolutions per minute for 10 min. The supernatant was then transferred to a 1.5 mL centrifuge tube. Samples were stored at −80 °C in a freezer for future use.
On days 0, 14, 17, 21, and 28 of the experiment, fresh feces were collected, and a portion was extracted. The portion was used for pH and fecal dry matter (DM) evaluation. The remaining feces were placed into a sterile fecal collection tubes and stored at −80 °C in a freezer for future use.
2.4. Plasma Parameters and Fecal Parameters Measurement
On days 0, 14, 17, 21, and 28 of the experiment, fresh feces were collected to analyze fecal pH, DM, and fecal score (FS). The Waltham
® Fecal Score system (
Appendix A) was used, with grades 2–3 indicating good fecal status and grades 3.5 and above indicating excessive fecal moisture. Measurements of pH were conducted using a pH meter (Shenzhen Yage Technology Co., Ltd., Shenzhen, China). Fresh feces (0.5 g) were weighed into a 15 mL centrifuge tube, and 9.5 mL deionized water was added. The sample was centrifuged at 3000×
g rpm for 5 min after being mixed thoroughly, and the supernatant was poured into a disposable plastic cup. For fresh fecal DM measurement, 5 g fresh feces was dried at 121 °C on a HNB-50T (Xiamen Senbi Technology Co., Ltd., Fujian, China) baking tray.
On days 0, 14, 17, 21, and 28 of the experiment, serum was collected for measurements of lipopolysaccharide (LPS) and diamine oxidase (DAO) using feline-specific commercial ELISA kits (Jiangsu Enzyme-Free Industry Co., Ltd., Taizhou, China). Calprotectin (CALP), secretary immunoglobulin A (sIgA), and myeloperoxidase (MPO) were measured using feline-specific commercial ELISA kits (Jiangsu Enzyme-Free Industry Co., Ltd.)
2.5. Microbiome and Functional Analysis
Fecal DNA was extracted using an E.Z.N.A.® soil DNA kit (Omega Engineering, Norwalk, CT, USA) following the manufacturer’s instructions. The quality of the extracted genomic DNA was evaluated by 1% agarose gel electrophoresis. The concentration and purity were assessed using a NanoDrop 2000 microspectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
On days 14, 17, and 28, the 16S rRNA gene was amplified with region-specific primers (338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT). The PCR reaction was performed using 25 μL of output from the AxyPrep DNA Gel Purification Kit (AXYGEN, Union City, CA USA), with the following conditions: initial denaturation at 95 °C for 3 min (1 cycle), followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 45 s; with a final extension step at 72 °C for 10 min, and holding at 10 °C until halted by the user. Library construction using a TruSeqTM DNA Sample Prep Kit (Illumina, Inc., San Diego, CA, USA) followed by paired-end sequencing using an Illumina Paired-End 300 (PE300) platform (Majorbio, Shanghai, China) were performed according to the standard protocols from the manufacturers.
Bioinformatics analysis of the sequencing data was carried out as follows: the paired-end reads obtained from Illumina sequencing were spliced based on overlap relationships. Sequence quality was controlled and filtered, and the samples were differentiated for Operational Taxonomic Unit (OTU) clustering analysis and species taxonomic analysis.
2.6. Calculations and Statistical Analysis
Alpha (α) diversity metrics for the microbiome results were evaluated using the ACE, Chao, Shannon, Simpson, and Sobs indicesby Mothur 1.30.2 software. we employed the Bray–Curtis distance algorithm for beta (β) diversity analysis via Principal Coordinate Analysis (PCoA) and performed differential analysis using Adonis. Relative abundance and differential analyses of community structure were conducted at the phylum and genus levels based on taxonomic information. Due to non-normal distribution, median values (upper quartile, lower quartile) were used. The Scheirer–Ray–Hare test was applied for two-factor analysis of variance. We used Linear Discriminant Analysis Effect Size (LEfSe) to distinguish differential taxa at the genus level and higher taxonomic levels, setting the Linear Discriminant Analysis (LDA) score to greater than 4.0. PICRUSt2 2.2.0 was utilized to predict metabolic pathways at Pathway Level 3.
The main statistical analyses were performed using IBM SPSS 27.0. Two-way ANOVA was used to analyze the differences in intestinal inflammation and intestinal immune indicators between groups. Data conforming to a normal distribution pattern were expressed as mean ± standard deviation, while non-normally distributed data and hierarchical information were expressed as median (upper quartile, lower quartile). Graphing was performed using GraphPad Prism 9.0 software. Statistical significance was defined as 0.01 ≤ p < 0.05, highly significant as p < 0.01, and a significant trend as 0.05 ≤ p < 0.10.
4. Discussion
We investigated the effects of heat-treated Bifidobacterium longum CECT-7347 combined with Fibersol-2 on gastrointestinal tract stability in adult cats undergoing a diet transition from an LPF diet to an HPF diet. The hypothesis of the study was that the treated group, receiving heat-treated Bifidobacterium longum CECT-7347 combined with Fibersol-2, would exhibit a greater ability to adapt to the new diet composition. Our results showed that, before the diet transition, all indices except for LPS were unaffected by supplementation of functional additives. After the abrupt dietary change, all measurements except for pH, LPS, and sIgA concentration remained unchanged, and the functional additives significantly increased the abundance of beneficial bacteria like Actinobacteria and Blautia in the treated group.
In the present study, the pH values of feces significantly increased in both groups of cats after abrupt dietary change, which is consistent with results observed in humans and dogs [
17,
18]. This may be attributed to the association between high pH values and protein hydrolysis metabolism [
19]. However, Taís Silvino and colleagues [
20] reached the opposite conclusion, and the decrease in fecal pH observed in dogs on the HPF diet was accompanied by a decrease in the fecal concentration of short-chain fatty acids (SCFAs). In our study, while both groups showed a rise in fecal pH, the treated group displayed a notably lower fecal pH compared to the control group, possibly explained by the higher levels of
Blautia.
Blautia, a beneficial bacterium, produces organic acids such as lactic acid, thereby regulating intestinal pH levels [
21].
CALP and MPO are commonly utilized as markers for intestinal inflammation [
21,
22]. Our findings indicate that MPO did not exhibit statistically significant differences, which may be attributed to its poor stability in feces. Another plausible explanation could be the lack of direct correlation between MPO activity and its expression levels. Selecting assays that assess enzymatic activity rather than relying on available sandwich ELISA might provide a more accurate evaluation of intestinal inflammatory status [
22]. In the early stages following dietary change (day 17), both groups of treated animals exhibited a significant increase in fecal CALP levels, suggesting onset of intestinal inflammation due to the dietary change [
23], with no differences observed between the groups. Notably, different concentrations of
Bifidobacterium longum significantly affected CALP measurements [
24], indicating that higher additive doses do not necessarily result in better anti-inflammatory effects. This suggests that further experiments are needed to determine the optimal dosage of functional additives for significantly alleviating intestinal inflammation. Consistent with our results, children also showed a significant increase in CALP after short-term RMD treatment [
25]. RMD mainly improves animal health by modulating the composition of the gut microbiota. In our experiment, the use of functional additives did improve the composition of the gut microbiota, but this did not include microbes with obvious anti-inflammatory effects, except for
Blautia, which has some anti-inflammatory properties but seems insufficient to counteract the intestinal inflammation caused by abrupt dietary change [
26].
Under normal conditions, LPS remains primarily within the intestine, confined by the intestinal barrier. If this barrier is compromised or permeability increases, LPS may enter the bloodstream, resulting in elevated serum levels [
27,
28]. During the initial phase of dietary transition, the levels of LPS significantly increased in both groups, possibly due to disruption of intestinal barrier function caused by dietary change [
29]. Throughout the entire experiment, the levels of LPS in the treated group were significantly lower than those in the control group, indicating that the additives could significantly reduce the levels of LPS in feline plasma, thereby accelerating restoration of intestinal barrier function impaired by dietary transition. Consistent with our findings, Dong-Yun Lee isolated
Lactobacillus plantarum NK151 and
Bifidobacterium longum NK173 from a human fecal bacteria collection, which inhibited Escherichia coli LPS production [
30]. Additionally, resistant dextrin has beneficial effects in improving disruption of the intestinal epithelial barrier [
31,
32]. On the other hand, the ratio of Gram-positive to Gram-negative bacteria in the intestine also influences the detectable levels of LPS [
27]. Subsequent analysis of intestinal microbiota revealed a consistent correlation between changes in the abundance of
Bacteroidetes and variations in LPS concentration. Therefore, we speculate that functional additives may improve intestinal microbiota composition, thereby restoring intestinal mucosal barrier function and suppressing serum LPS levels [
33,
34].
sIgA stands as a cornerstone within mucosal immunity, acting as a pivotal defense mechanism against infections and playing an indispensable role in protecting the body from pathogen infiltration [
35]. Our study revealed that fecal sIgA in the treated group was significantly higher than that in the control group (
p < 0.05). Consistent with our findings, [
36] demonstrates that the intake of grain-derived RS by cats enhances sIgA production. Experiments conducted in human infants [
37] and mice [
23] also indicate a positive impact of
Bifidobacterium on sIgA production. In conclusion, cats may benefit from the use of heat-treated
Bifidobacterium longum in combination with Fibersol-2 to support intestinal immune function.
Upon analyzing the α and β diversity, it becomes evident that, following the dietary change, both groups exhibited a notable increase in the richness and evenness of their fecal microbiota. Moreover, significant disparities in the intestinal microbiota structure were observed, attributed to dietary modification and functional additives, aligning with prior research [
19,
38]; specifically, a high-protein diet may stimulate microbes to utilize mucin as a nutrient source, thereby increasing the availability of specific substrates such as amino acids, dipeptides, and their metabolites. This process could enhance the diversity and richness of the intestinal microbiota [
19].
The phylum
Firmicutes, representing more than 60% of the bacteria in feline feces, stands as the dominant bacterial phylum, consistent with the findings of previous research [
39]. However, contrary to previous studies [
40,
41], the lower abundance of
Bacteroidetes observed in this study may be influenced by dietary differences. Following the dietary change, there was a decline in the abundance of the
Firmicutes phylum, while
Bacteroidetes exhibited an opposite trend. This shift could be attributed to the potential contribution of a high-protein diet, which may increase the availability of substrates favoring the growth of
Bacteroidetes over
Firmicutes [
19,
42]. However, on day 28, we observed an increasing trend in the relative abundance of
Firmicutes, which could be explained by the effect of RMD, as indicated by previous research [
43,
44], Another possible factor is the production of lactate by
Bifidobacterium longum, which can be utilized by members of
Lachnospiraceae, thereby stimulating their proliferation [
45].
Actinobacteria [
46], particularly
Bifidobacterium [
47], plays a pivotal role in maintaining intestinal equilibrium and fortifying intestinal barrier function. In this study,
Collinsella, rather than
Bifidobacterium, emerged as the dominant genus within the
Actinobacteria phylum in the feces of cats. In patients with irritable bowel syndrome (IBS), the abundance of
Collinsella typically decreases [
48], while it increases in individuals with improved symptoms, often accompanied by a reduction in pain [
49]. In cats, there is evidence suggesting that
Collinsella is linked to improved fecal scores following a therapeutic response to diet [
50]. Although the cats in our study did not show significant diarrhea after the dietary transition, changes in pH, CALP, and LPS levels suggest an imbalance in the intestinal tract post-transition. However, the use of functional additives helped alleviate intestinal disruption.
Blautia is a beneficial bacterium that produces organic acids like lactic acid, contributing to intestinal pH regulation and inhibiting harmful bacterial growth. It plays a role in regulating host health and alleviating metabolic syndrome [
51]. Previous studies have confirmed a negative correlation between the levels of intestinal
Blautia and obesity [
52,
53]. In individuals effectively losing weight,
Blautia becomes a dominant genus of bacteria [
54].
Blautia may assist in weight loss by regulating intestinal regulatory T cells and producing SCFAs, thus alleviating obesity-related inflammation [
55]. Similarly, analysis of the fecal and mucosal microbial communities in patients diagnosed with inflammatory bowel disease and colorectal cancer consistently indicate a marked decrease in
Blautia abundance [
55,
56]. Therefore, the significant increase in
Blautia abundance observed in this experiment suggests superior intestinal health status in the treated group compared to the control group. It is worth noting that not all inflammatory bowel diseases are negatively correlated with
Blautia abundance; studies have reported higher levels of
Blautia in patients with IBS. Due to the fact that patients with IBS are often advised to modulate carbohydrate intake, such as following diets low in fermentable oligosaccharides, disaccharides, monosaccharides, and polyols [
57], which typically include indigestible carbohydrates [
58], it is likely that the higher levels of
Blautia observed in patients with IBS are due to
Blautia’s ability to ferment resistant starch as a substrate [
59].
Further analysis using LEfSe indicated an increase in
Parasutterella abundance in the control group following the dietary transition.
Parasutterella is associated with the onset and progression of conditions such as IBS and chronic inflammation [
60]. Beneficial bacteria [
51] such as
Lachnospiraceae,
Lachnospirales, and
Blautia were enriched in the treated group, indicating a possible protective effect of the functional additives against potential pathogenic bacteria and promoting colonization with beneficial bacteria.
In the present study, functional analysis of the intestinal microbiome identified upregulation of genes related to colonization by pathogenic bacteria, such as epithelial cell signaling in Helicobacter pylori infection and Salmonella infection, only in the control group. Salmonella has been verified as a pathogenic factor that contributes to chronic inflammation and carcinogenesis [
61]. Helicobacter pylori is implicated in colorectal cancer [
62] and gastric carcinogenesis [
63]. Moreover, pathways implicated in inflammation, such as arachidonic acid metabolism [
64], alongside those pertinent to the establishment of pathogenic bacterial populations, such as D-glutamine and D-glutamate metabolism, exhibited heightened activation [
65].
Conversely, in the treated group, the upregulated genes primarily pertained to lipid biosynthesis, carbohydrate metabolism and uptake, and amino acid biosynthesis. On day 28, genes associated with propionate metabolism were enriched in the treated group. Propionate plays a vital role in maintaining intestinal homeostasis by enhancing mucin secretion, strengthening intestinal barrier function, protecting the intestinal mucosa [
66], and inhibiting the expression of virulence invasion genes of Salmonella [
67]. These genes may contribute to improving gastrointestinal function. However, given the intricate interactions within the gastrointestinal tract, it is imperative to conduct additional metagenomic studies to gain a deeper understanding of these mechanisms.