Next Article in Journal
An Automated Sprinkler Cooling System Effectively Alleviates Heat Stress in Dairy Cows
Previous Article in Journal
Hesperidin Helps Improve the Intestinal Structure, Maintain Barrier Function, and Reduce Inflammation in Yellow-Feathered Broilers Exposed to High Temperatures
Previous Article in Special Issue
Identification of Aichivirus in a Pet Rat (Rattus norvegicus) in Italy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 17
10.3390/ani14172584
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence of Aleutian Mink Disease Virus (AMDV) in Free-Ranging American Mink from Biebrza and Narew National Parks (Poland)—An Epidemiological Concern

by
Konrad Przywara
1,
Jan Siemionek
2,
Tadeusz Jakubowski
3,4,
Klaudia Konczyk-Kmiecik
2 and
Anna Szczerba-Turek
2,*
1
Veterinarian Konrad Przywara, 40A Grudzielskiego St., 63-700 Krotoszyn, Poland
2
Department of Epizootiology, Faculty of Veterinary Medicine, University of Warmia and Mazury, Oczapowskiego 13, 10-718 Olsztyn, Poland
3
Department of Large Animal Diseases with Clinic, Faculty of Veterinary Medicine, Warsaw University of Life Sciences, 02-797 Warsaw, Poland
4
Laboratory of the Polish Society of Breeders and Producers of Fur Animals, Pocztowa St. 5, 62-080 Tarnowo Podgórne, Poland
*
Author to whom correspondence should be addressed.
Animals 2024, 14(17), 2584; https://doi.org/10.3390/ani14172584
Submission received: 12 July 2024 / Revised: 27 August 2024 / Accepted: 4 September 2024 / Published: 5 September 2024
(This article belongs to the Special Issue General Epidemiology of Animal Viruses)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Aleutian Mink Disease Virus (AMDV) causes Aleutian disease, a chronic disorder affecting both farmed and free-ranging mink. This study aimed to analyze AMDV variants from free-ranging American mink in northeastern Poland. Between 2018 and 2019, 26 spleen samples were collected from minks in Narew National Park (NNP) and Biebrza National Park (BNP). DNA was extracted and subjected to PCR to amplify the NS1 gene, followed by sequencing and phylogenetic analysis. The NS1 gene was detected in 50% of samples from NNP minks and in 30% of samples from BNP minks, with an overall prevalence of 42.31%. Phylogenetic analysis revealed high homology among most sequences, indicating a stable, potentially endemic AMDV population, although unique variants suggest ongoing genetic diversity. These findings highlight the significant prevalence of AMDV in free-ranging mink and underscore the need for continued monitoring and research to understand the virus’s transmission dynamics and impact on wildlife and mink farming.

Abstract

Aleutian Mink Disease Virus (AMDV) is the causative agent of Aleutian disease (AD). This progressive and chronic disorder significantly impacts the mink breeding industry, affecting farmed and free-ranging American and European mink. This study investigated AMDV variants isolated from free-ranging American mink in northeastern Poland. Between 2018 and 2019, 26 spleen samples were collected from mink in Narew National Park (NNP) and Biebrza National Park (BNP). DNA was extracted and subjected to PCR to amplify the NS1 gene, followed by sequencing and phylogenetic analysis. The NS1 gene was detected in 50% of samples from NNP minks and in 30% of samples from BNP minks, with an overall prevalence of 42.31%; these findings align with global data and indicate serious ecological and health concerns. Ten closely related AMDV variants and one distinct variant were identified. The grouped variants exhibited high genetic homogeneity, closely related to strains found in mink from the USA, Germany, Greece, Latvia, and Poland; meanwhile, the distinct variant showed similarities to strains found in mink from Finland, Denmark, China, Poland, and Latvia, suggesting multiple infection sources. These findings, consistent with data from Polish mink farms, indicate significant genetic similarity between farmed and wild mink strains, suggesting potential bidirectional transmission. This underscores the importance of a One Health approach, emphasizing the interconnectedness of human, animal, and environmental health. Continuous surveillance and genetic studies are crucial for understanding AMDV dynamics and mitigating their impacts. Measures to reduce transmission between farmed and wild mink populations are vital for maintaining mink health and ecosystem stability.

1. Introduction

Aleutian Mink Disease Virus (AMDV) is the causative agent of Aleutian disease (AD) or mink plasmacytosis, a progressive and chronic disorder affecting the mink breeding industry [1,2,3]. This viral disease predominantly affects farmed and free-ranging American mink (Neovison vison) and free-ranging European mink (Mustela lutreola) [4]. However, it has also been detected in other members of the family Mustelidae, such as martens (Martes spp.) and short-tailed weasels (Mustela erminea), and in other families: Felidae—lynx (Lynx spp.); Canidae—arctic fox (Vulpes lagopus), red fox (Vulpes vulpes), and raccoon dog (Nyctereutes procyonoides); Mephitidae—striped skunk (Mephitis mephitis); Viverridae—genet (Genetta genetta) [4,5,6,7,8,9,10,11]. The International Committee on Taxonomy of Viruses defined AMDV as the Carnivore amdoparvovirus 1 species, as a member of the genus Amdoparvovirus, within the family Parvoviridae and subfamily Parvovirinae [12,13]. The AMDV is a non-enveloped, single-stranded DNA genome with a size of 4.5–5.0 kilobase (kb) [14,15]. The genome of the virus contains two structural proteins, VP1 and VP2, as well as three non-structural proteins, NS1, NS2, and NS3 [1,16,17]. NS1–NS3 are produced through alternative splicing mechanisms and play crucial roles in regulating the late synthesis of structural proteins and in the replication of the virus’s nucleic acids [17,18,19]. The capsid is primarily composed of the structural protein VP2 along with the smaller protein VP1, both serving as the main immunogenic antigen proteins of AMDV [17,18]. Sequence variations in the genes encoding NS1 and VP2 proteins are commonly utilized in phylogenetic analyses and epidemiological investigations [20,21,22,23,24,25].
AMDV infection outcomes vary depending on factors such as the strain and dose of the virus, the age of the host, and the host genotype [12,26]. AD can cause acute and chronic symptoms with subclinical or asymptomatic presentations [1]. Chronic infections typically result in hair depigmentation, weakness, weight loss, decreased appetite, and diarrhea [1,27]. The subclinical course is marked by reproductive issues like reduced pregnancies, smaller litters, and spontaneous terminations [28,29,30]. In clinical cases, AMDV induces a progressive syndrome in adult mink known as chronic AD, characterized by immune-complex deposition, weight loss, hypergammaglobulinemia, and necrotizing arteritis [1,8,27,31].
In mink, the primary mode of virus transmission is typically vertical, passing from infected females to their offspring [32]. However, horizontal transmission through blood, feces, urine, and saliva, is also possible [3,33,34]. The AMDV can contaminate cage surfaces, gloves, protective footwear, or even the tracks left by vehicle tires [34,35,36]. Notably, free-ranging mink can serve as reservoirs for the virus, thus endangering farmed mink [3,34,37,38]. Given the virus’s longevity in the environment, mink farms can experience outbreaks even after the apparent eradication of the disease. No effective treatment or vaccine exists, and outbreaks lead to substantial economic losses for mink farms [2,39]. The main problems with eradication programs seem to be the following: first, persistence; second, the high concentration of farms; third, high seroprevalence. None of the programs achieved satisfactory results [2,35,38,40,41].
Poland ranks among the top mink farming nations globally, which underscores the significant risk of transmission between farmed and free-ranging populations. As per the Act of 11 March 2004 on the protection of animal health and eradication of infectious animal diseases, AD is subject to registration in Poland [42]. AMDV is a subject of interest among Polish scientists [20,23,24,29,31,37,43,44]. According to the latest investigation into farmed mink in Poland, two separate clads of AMDV variants have been identified, suggesting that two independent pools of viruses persist in farms [20,24]. The first clad (group A) consists of AMDV variants that show approximately 95% similarity with the nonpathogenic strain AMDV-G (Acc. No. NC001662); meanwhile, the second clad (group B) consists of AMDV variants that show approximately 86% similarity with the nonpathogenic strain AMDV-G (Acc. No. NC001662). Variants from the first clad were isolated from farmed mink located in the West Pomeranian Voivodeship in northwestern Poland [20,24]. AMDV variants from the second clad persist in mink farms located in Greater Poland, Podkarpackie, Lesser Poland, Podlaskie, and Pomeranian Voivodeships. AMDV variants from the first clad indicated high homogeneity in the viral pool, while the AMDV variants from the second clad showed less homogeneity in the viral pool, which may be recognized in some sub-clads [20,24]. However, the data on the prevalence of AMDV in farmed and free-ranging mink in Poland seem insufficient from an epidemiological perspective, and further research is warranted. In line with the “Spill-over and Spill-back” strategy, free-ranging mink with AMDV infections can jeopardize farmed mink upon contact, potentially introducing the virus to a susceptible farm population [34,45]. Conversely, infected farmed mink might transmit the virus to free-ranging populations, ensuring its environmental persistence. Despite the American mink being recognized as an invasive species in Europe, concerns linger regarding the disease’s ramifications on free-ranging populations and the encompassing ecosystem [34,46,47].
The probable prevalence of AMDV in free-ranging American mink in Poland emerges as a significant epidemiological challenge, considering Poland’s pivotal role in mink farming and the potential interchange of the virus between free-ranging and farmed populations. Consistent monitoring, in-depth research, and rigorous biosecurity protocols are paramount in managing and alleviating the disease’s impacts. The primary aim of this study was to analyze AMDV variants isolated from free-ranging American mink from northeastern Poland (Biebrza and Narew National Parks).

2. Materials and Methods

2.1. Research Material

Between 2018 and 2019, we collected 16 spleen samples from free-ranging American mink inhabiting Narew National Park (NNP) (latitude 53.2492° N, longitude 23.4700° E) and 10 spleen samples from mink within Biebrza National Park (BNP) (latitude 53.5° N, longitude 22.8° E). The mink trapping was part of conservation efforts under the LIFE+ project “Protection of water and marsh birds in five National Parks” (LIFE09 NAT/PL/000263). This project was implemented to restore habitats and manage invasive species, such as the American mink, threatening native species in these protected areas [48]. The trapping and euthanasia procedures were conducted in compliance with national and local regulations, specifically under the oversight of the Ministry of Climate and Environment of Poland and the relevant park authorities, including the Directorate for Environmental Protection and the Veterinary Inspection Services. These bodies ensured that all animal welfare regulations were followed, with approval from the Local Ethical Commission for Animal Experiments in Białystok. The euthanasia process was carried out by trained personnel using CO2, following ethical guidelines aiming to minimizing suffering. This approach ensured that all practices adhered to the highest standards of humane treatment of wildlife, as required by Polish law.

2.2. DNA Extraction

Total DNA was isolated from 10 mg spleens using a Genomic Mini DNA isolation kit (A&A Biotechnology, Gdynia, Poland) following the manufacturer’s protocol. DNA was eluted in 150 µL of elution buffer. The quality and quantity of the extracted DNA were assessed using a BioPhotometer® (Eppendorf, Hamburg, Germany). Extracted DNA was stored at −20 °C for future molecular biology experiments.

2.3. PCR

PCR was conducted for all DNA samples extracted from spleens using primers amplifying a fragment of the NS1 gene (AMDV-F-7-H-PN1: 5′ CATATTCACTGTTGCTTAGGTTA 3′ and AMDV-R-7-HPN2: 5′ CGTTCTTT-GTTAGTTAGGTTGTC 3′), as previously described by Jensen [49]. The reaction mixture contained 120 ng DNA (3 µL), 12.5 µL JumpStartTM REDTaq® ReadyMixTM Reaction Mix (Sigma-Aldrich, St. Louis, MO, USA), approximately 0.1 µL of each primer (AMDV-F-7-H-PN1 and AMDV-R-7-HPN2)—the final concentration of each primer was 0.4 µM—and 9.3 µL water. The total volume was 25 µL. The reaction conditions were as follows: initial denaturation—94 °C for 2 min; thirty-four cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 2 min; final extinction at 72 °C for 5 min in a Mastercycler (Eppendorf, Hamburg, Germany). The reaction products were separated on a 2% agarose gel with Midori Green Advance DNA stain (NIPPON Genetics EUROPE, Düren, Germany) at 80 V. Visualization and archiving of the gel were conducted using the Gel Doc Gel Documentation System (BioRad, Hercules, CA, USA).

2.4. Sequencing and Phylogenetic Analysis

The amplicons were cleaned using a clean-up kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer’s instructions. The purified amplicons were sequenced at Genomed S. A. (Warsaw, Poland). The sequence data were compared with the nucleotide sequence of other AMDVs from NCBI using BLAST+ 2.15.0 [50]. The sequence analysis was conducted using BioEdit Sequence Alignment Editor, Computational Evolutionary Biology package MEGAX, and Clustal W software [51,52,53]. The phylogenetic and evolutionary history analyses were performed using the maximum composite likelihood method [51,54]. The sequences used in the phylogenetic analysis are listed in Table 1.

2.5. Statistical Analysis

The prevalence of the NS1 gene of AMDV strains in free-ranging American mink populations was evaluated using the Clopper–Pearson ‘exact’ method, which relies on the beta distribution at a significance level of α = 0.05. Statistical analyses were performed using EpiTools, a set of free epidemiological calculators, to conduct comparisons [55].
Table 1. Other known sequences of NS1 gene of AMDV isolates used in this study (note: ND—no data).
Table 1. Other known sequences of NS1 gene of AMDV isolates used in this study (note: ND—no data).
Accession Number
(Acc. No.) 		StrainVirulenceCountryTypeReferences
NC 001662AMDV GNonpathogenicUSAFarmed[14]
X77083AMDV-UtahHighly virulentUSAFarmed[56]
X77084AMDV-UnitedHighly virulentDenmarkFarmed[56]
X77085AMDV-KHighly virulentDenmarkFarmed[56]
X97629AMDV-SL3Intermediately virulentGermanyFarmed[57]
MN175700AMDV ZP1b (I)NDPolandFarmed[20]
MN175735AMDV LUB1 (II)NDPolandFarmed[20]
MN175724AMDV WLKP 2a (III)NDPolandFarmed[20]
MN175729AMDV PODK2a (IV)NDPolandFarmed[20]
KY997051AMDV_mink-f_PL_459NDPolandFarmed[22]
OR123963AMDV A1NDLatviaFarmed[24]
OR123971AMDV B4NDLatviaFarmed[24]
MG366646AMDV F8B5NDGreeceFarmed[22]
GU183265AMDV ADV-LN2Highly virulentChinaFarmed[58]
MG821256AMDV HY 47NDFinlandWild[59]
MG821257AMDV HY 51NDFinlandWild[59]
MG821282FIN17/F40NDFinlandFarmed[59]
OK263135AMDV BPN5NDPolandWildThis study
OK263139AMDV NPN4NDPolandWildThis study
OK263140AMDV NPN5NDPolandWildThis study
OK263142AMDV NPN7NDPolandWildThis study

3. Results

3.1. Prevalence of AMDV in Free-Ranging American Mink

The presence of the NS1 gene of AMDV was confirmed in 8 out of 16 spleen samples (50%, 95% CI = 24.65–75.35) taken from free-ranging American mink in NNP, and in 3 out of 10 spleen samples (30%, 95% CI = 6.67–65.25) from those in BNP. The overall prevalence of AMDV in free-ranging American mink across both national parks was 42.31% (11 out of 26, 95% CI = 23.35–63.08). There is no statistically significant difference in the prevalence of AMDV in American mink between the two examined national parks.

3.2. Analysis of NS1 Gene of AMDV

The sequences obtained during this study had lengths of 374 base pairs (bp); they were deposited in the GenBank databases at the National Center for Biotechnology Information (NCBI) with the following Accession Numbers (Acc. No.): OK263135–OK263145. The evolutionary relationship between the NS1 gene variants obtained in this study and AMDV G (Acc. No. NC001662) is presented in Figure 1.
After the phylogenetic analyses, the isolates divided into one group with 10 closely related isolates and one group with separate isolates: OK263142—AMDV NPN7 Wild PL. In the group, seven isolates (70.00%, 95% CI = 34.75–93.33) (Acc. No.: OK263135—AMDV BPN5 Wild PL; OK263136—AMDV BPN7 Wild PL; OK263137—AMDV BPN8 Wild PL; OK263138—AMDV NPN3 Wild PL; OK263141—AMDV NPN6 Wild PL; OK263144—AMDV NPN9 Wild PL; OK263145—AMDV NPN16 Wild PL) showed 100% homology in the nucleotide sequences of the NS1 gene. For further analysis, we selected OK263135 (AMDV BPN5 Wild PL) as a representative. Among these seven sequences, four (57.14%, 95% CI = 18.41–90.10) were isolated from the American mink obtained from the NPN, while three (42.86%, 95% CI = 9.90–81.59) were isolated from the American mink obtained from the BPN. Two additional sequences (Acc. No.: OK263139—AMDV NPN4 Wild PL; OK263143—AMDV NPN8 Wild PL) also exhibited 100% homology (18.18%, 95% CI = 2.28–51.78), and we selected OK263139 (AMDV NPN4 Wild PL) for future analysis. In the group was one isolate with a unique sequence (Acc. No.: OK263140—AMDV NPN5 Wild PL). The isolates in the group showed slight differences, with an evolutionary divergence ranging from 0.33% to 1.32%. The substitutions in the NS1 gene of our AMDV variants were compared to AMDV G (Acc. No. NC001662), as presented Figure 2.
Amino acid (aa) substitutions in the NS1 protein of our AMDV variants were compared with the NS1 protein of AMDV G (Protein ID NP042872), as presented Figure 3.
Details on the point mutations (transitions and transversions) that induce amino acid changes are presented Table 2.
The evolutionary relationships between the NS1 gene variants obtained in this study and the other NS1 genes of AMDV (Table 1) from NCBI are shown Figure 4.
The isolates from the group were most similar to the isolates from first clade (group A) described previously by Kondracki et al. [24] and the sequences isolated in the USA—AMDV G (Acc. No. NC 001662); there is evolutionary divergence between the sequences of 5.80 and 6.86%, AMDV Utah (Acc. No. X77083), with an evolutionary divergence between sequences of 6.16 and 7.23%, and Germany, AMDV SL3 (Acc. No. X77085), with an evolutionary divergence between sequences of 6.16 and 7.23%. These variants also shared similarity with the nucleotide sequences isolated in Greece, AMDV isolate F8B5 F (Acc. No. MG366646.1), an evolutionary divergence between sequences of 7.23 and 7.59%, Latvia, AMDV A1 F (Acc. No. OR123963.1), an evolutionary divergence between sequences of 7.24%, and Poland, AMDV isolate ZP1b (I) F (Acc. No. MN175700.1), and an evolutionary divergence between sequences of 7.60%. The compared sequences were obtained from farmed mink.
The nucleotide sequence of the NS1 AMDV gene of the AMDV NPN7 W Poland (Acc. No. OK263142.1) was different from those of the other variants isolated in this study, with an evolutionary divergence between sequences of 14.60 and 15.39%. The sequence of the AMDV NPN7 W Poland variant (Acc. No. OK263142.1) was the most similar to the sequences from second clad (group B) described previously by Kondracki et al. [24] and variants of AMDV isolated in Finland: AMDV HY 47 W (Acc. No. MG821256.1), AMDV HY 47 W (Acc. No. MG821256.1), AMDV FIN17/F40 F (Acc. No. MG821282.1). These had evolutionary divergences between sequences of 5.09%, 5.79%, and 7.60%, respectively. From Denmark, AMDV-United (Acc. No. X77085), an evolutionary divergence was found between sequences of 6.17%. From China, AMDV ADV-LN2 (Acc. No. GU183265.1), an evolutionary divergence was found between sequences of 6.87%. From Poland, AMDV mink PL 459 F (Acc. No. KY997051.1), AMDV PODK2a (IV) F (Acc. No. MN175729.1), AMDV WLKP2a (III) F (Acc. No. MN175724.1), and AMDV LUB1 (II) F (Acc. No. MN175735.1), an evolutionary divergence was found between sequences of 6.16%, 6.52%, 6.86%, and 6.89%, respectively. From Latvia, AMDV B4 F (Acc. No. OR123971.1), an evolutionary divergence was found between sequences of 7.22%. These NS1 AMDV gene fragments were obtained from both farm-raised and free-ranging mink.

4. Discussion

The results of our study underscore a significant prevalence of AMDV in free-ranging American mink populations in the national parks in northeast Poland. The detection of the NS1 gene in 50% of spleen samples from mink in Narew National Park (NNP) and 30% of spleen samples from mink in Biebrza National Park (BNP)—resulting in an overall prevalence of 42.31%—aligns with global reports of widespread AMDV presence in free-ranging mink populations; such studies have reported prevalence rates between 14.80% and 57.60% [3,4,8,23,60,61]. These findings corroborate earlier research by Jakubczak et al., who reported a 35% prevalence of AMDV in free-ranging mink from the same region in Poland in 2017 [43]. The detection of AMDV across different ecosystems suggests potentially serious ecological and health implications, particularly given the virus’s environmental persistence and high contagion [3,34,38].
Our phylogenetic analysis revealed that the majority of AMDV variants identified in this study (10 out of 11) belonged to a homogenous group, closely resembling clade 1 (group A), as described by Kowalczyk et al. and Kondracki et al. [20,24]. The variants exhibited an evolutionary divergence ranging from 0.33% to 1.32% and shared high genetic similarity with strains isolated in the USA, Germany, Greece, Latvia, and Poland [14,20,22,24,54,55]. The presence of a distinct variant (AMDV NPN7) further underscores the genetic diversity of AMDV within these populations, as it clustered with different clades described by Kowalczyk et al. and Kondracki et al. (clades II, III, and IV/group B) and with sequences from other European countries (Finland, Denmark, Latvia, Finland, Poland) and China [20,24,56,57,58,59].
The higher prevalence of AMDV found in samples from NNP compared to that found in samples from BNP suggests possible environmental or population density factors influencing virus transmission, although these differences were not statistically significant. This variation could also reflect different management practices across the parks, warranting further investigation.
Our findings, which identified similar AMDV variants in both farmed and free-ranging mink populations, suggest a potential interchange of viral strains between these groups, highlighting the risk of spill-back and spill-over events. Such interactions between domesticated and wild mink could contribute to the observed genetic diversity and have significant implications for AMDV transmission dynamics [3,38,45]. The presence of closely related AMDV strains in both free-ranging and farmed mink populations indicates that mink farms could be a source of AMDV transmission to wild populations, reinforcing the need for vigilant disease monitoring and management.
The One Health approach is particularly relevant in addressing the transmission of AMDV, as it emphasizes the interconnectedness of human, animal, and environmental health. Collaborative efforts among veterinary, wildlife, and public health sectors are essential in the effective surveillance, prevention, and control of AMDV spread. Continued research, including genetic analysis and epidemiological studies, is crucial for understanding the transmission dynamics of AMDV and implementing strategies to mitigate its impact on mink populations and broader ecosystems.

5. Conclusions

In conclusion, our study highlights the significant prevalence and genetic diversity of AMDV among free-ranging American mink in national parks in northeast Poland. The identification of closely related viral strains in both wild and farmed mink populations suggests potential cross-transmission between these groups, raising concerns about broader ecological and health impacts. The findings underscore the importance of continued surveillance, genetic analysis, and collaborative efforts across sectors to manage the spread of AMDV. Adopting a One Health approach is essential if we are to effectively address the interconnected challenges posed by this persistent and contagious virus.

Author Contributions

Conceptualization, K.P., J.S., T.J. and A.S.-T.; methodology, K.P., K.K.-K. and A.S.-T.; software, A.S.-T.; validation, K.P., J.S. and A.S.-T.; formal analysis, K.P. and A.S.-T.; investigation, K.P. and A.S.-T.; resources, K.P. and A.S.-T.; data curation, K.P. and A.S.-T.; writing—original draft preparation, K.P. and A.S.-T.; writing—review and editing, K.P., J.S., T.J. and A.S.-T.; visualization, K.P. and A.S.-T.; supervision, A.S.-T. and J.S.; project administration, K.P. and A.S.-T.; funding acquisition, A.S.-T. All authors have read and agreed to the published version of the manuscript.

Funding

Funded by the Minister of Science under the Regional Initiative of Excellence Program.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The study was conducted with the assistance of the Management and Workers of the Biebrza and Narew National Parks. This study would not have been possible without their hard work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bloom, M.E.; Kanno, H.; Mori, S.; Wolfinbarger, J.B. Aleutian mink disease—Puzzles and paradigms. Infect. Agents Dis. 1994, 3, 279–301. [Google Scholar]
  2. Farid, A.H.; Zillig, M.L.; Finley, G.G.; Smith, G.C. Prevalence of the Aleutian mink disease virus infection in Nova Scotia, Canada. Prev. Vet. Med. 2012, 106, 332–338. [Google Scholar] [CrossRef]
  3. Nituch, L.A.; Bowman, J.; Wilson, P.; Schulte-Hostedde, A.I. Molecular epidemiology of Aleutian disease virus in free-ranging domestic, hybrid, and wild mink. Evol. Appl. 2012, 5, 330–340. [Google Scholar] [CrossRef]
  4. Farid, A.H. Aleutian mink disease virus in furbearing mammals in Nova Scotia, Canada. Acta Vet. Scand. 2013, 55, 10. [Google Scholar] [CrossRef]
  5. Canuti, M.; McDonald, E.; Graham, S.M.; Rodrigues, B.; Bouchard, É.; Neville, R.; Pitcher, M.; Whitney, H.G.; Marshall, H.D.; Lang, A.S. Multi-host dispersal of known and novel carnivore amdoparvoviruses. Virus Evol. 2020, 6, veaa072. [Google Scholar] [CrossRef]
  6. Canuti, M.; Todd, M.; Monteiro, P.; Van Osch, K.; Weir, R.; Schwantje, H.; Britton, A.P.; Lang, A.S. Ecology and Infection Dynamics of Multi-Host Amdoparvoviral and Protoparvoviral Carnivore Pathogens. Pathogens 2020, 9, 124. [Google Scholar] [CrossRef] [PubMed]
  7. Alex, C.E.; Canuti, M.; Schlesinger, M.S.; Jackson, K.A.; Needle, D.; Jardine, C.; Nituch, L.; Bourque, L.; Lang, A.S.; Pesavento, P.A. Natural disease and evolution of an Amdoparvovirus endemic in striped skunks (Mephitis mephitis). Transbound. Emerg. Dis. 2022, 69, E1758–E1767. [Google Scholar] [CrossRef]
  8. Leimann, A.; Knuuttila, A.; Maran, T.; Vapalahti, I.; Saarma, U. Molecular epidemiology of Aleutian mink disease virus (AMDV) in Estonia, and a global phylogeny of AMDV. Virus Res. 2015, 199, 56–61. [Google Scholar] [CrossRef] [PubMed]
  9. Manas, S.; Cena, J.C.; Ruiz-Olmo, J.; Palazon, S.; Domingo, M.; Wolfinbarger, J.B.; Bloom, M.E. Aleutian mink disease parvovirus in wild riparian carnivores in Spain. J. Wild. Dis. 2001, 37, 138–144. [Google Scholar] [CrossRef] [PubMed]
  10. Lu, T.; Zhang, H.; Zhou, J.; Ma, Q.; Yan, W.; Zhao, L.; Wu, S.; Chen, H. Aptamer-targeting of Aleutian mink disease virus (AMDV) can be an effective strategy to inhibit virus replication. Sci. Rep. 2021, 11, 4649. [Google Scholar] [CrossRef]
  11. Jepsen, J.R.; d’Amore, F.; Baandrup, U.; Clausen, M.R.; Gottschalck, E.; Aasted, B. Aleutian Mink Disease Virus and Humans. Emerg. Infect. Dis. 2009, 15, 2040–2042. [Google Scholar] [CrossRef]
  12. Canuti, M.; Whitney, H.G.; Lang, A.S. Amdoparvoviruses in small mammals: Expanding our understanding of parvovirus diversity, distribution, and pathology. Front. Microbiol. 2015, 6, 1119. [Google Scholar] [CrossRef] [PubMed]
  13. Cotmore, S.F.; Agbandje-McKenna, M.; Chiorini, J.A.; Mukha, D.V.; Pintel, D.J.; Qiu, J.; Soderlund-Venermo, M.; Tattersall, P.; Tijssen, P.; Gatherer, D.; et al. The family Parvoviridae. Arch. Virol. 2014, 159, 1239–1247. [Google Scholar] [CrossRef]
  14. Bloom, M.E.; Alexandersen, S.; Perryman, S.; Lechner, D.; Wolfinbarger, J.B. Nucleotide-sequence and genomic organization of Aleutian Mink Disease Parvovirus (ADV)—Sequence comparison between a nonpathogenic and a pathogenic strain of ADV. J. Virol. 1988, 62, 2903–2915. [Google Scholar] [CrossRef]
  15. Karimi, K.; Farid, A.H.; Myles, S.; Miar, Y. Detection of selection signatures for response to Aleutian mink disease virus infection in American mink. Sci. Rep. 2021, 11, 2944. [Google Scholar] [CrossRef]
  16. Huang, Q.; Luo, Y.; Cheng, F.; Best, S.M.; Bloom, M.E.; Qiu, J. Molecular characterization of the small nonstructural proteins of parvovirus Aleutian mink disease virus (AMDV) during infection. Virology 2014, 452, 23–31. [Google Scholar] [CrossRef]
  17. Xi, J.; Wang, J.; Yu, Y.; Zhang, X.; Mao, Y.; Hou, Q.; Liu, W. Genetic characterization of the complete genome of an Aleutian mink disease virus isolated in north China. Virus Gen. 2016, 52, 463–473. [Google Scholar] [CrossRef] [PubMed]
  18. Alexandersen, S.; Bloom, M.E.; Perryman, S. Detailed transcription map of Aleutian Mink Disease Parvovirus. J. Virol. 1988, 62, 3684–3694. [Google Scholar] [CrossRef]
  19. Tong, M.; Sun, N.; Cao, Z.; Cheng, Y.; Zhang, M.; Cheng, S.; Yi, L. Molecular epidemiology of Aleutian mink disease virus from fecal swab of mink in northeast China. BMC Microbiol. 2020, 20, 234. [Google Scholar] [CrossRef] [PubMed]
  20. Kowalczyk, M.; Horecka, B.; Jakubczak, A. Aleutian Mink Disease Virus in the breeding environment in Poland and its place in the global epidemiology of AMDV. Virus Res. 2019, 270, 197665. [Google Scholar] [CrossRef]
  21. Prieto, A.; Fernandez-Antonio, R.; Lopez-Lorenzo, G.; Manuel Diaz-Cao, J.; Lopez-Novo, C.; Remesar, S.; Panadero, R.; Diaz, P.; Morrondo, P.; Diez-Banos, P.; et al. Molecular epidemiology of Aleutian mink disease virus causing outbreaks in mink farms from Southwestern Europe: A retrospective study from 2012 to 2019. J. Vet. Sci. 2020, 21, e65. [Google Scholar] [CrossRef]
  22. Ryt-Hansen, P.; Hagberg, E.E.; Chriel, M.; Struve, T.; Pedersen, A.G.; Larsen, L.E.; Hjulsager, C.K. Global phylogenetic analysis of contemporary aleutian mink disease viruses (AMDVs). Virol. J. 2017, 14, 231. [Google Scholar] [CrossRef]
  23. Jakubczak, A.; Kowalczyk, M.; Kostro, K.; Horecka, B.; Jezewska-Witkowska, G. High molecular polymorphism of the hypervariable region in the VP2 gene of Aleutian mink disease virus. Acta Virol. 2016, 60, 354–360. [Google Scholar] [CrossRef]
  24. Kondracki, M.; Jakubczak, A.; Kowalczyk, M.; Mazurkiewicz, I.; Moryl, M.; Kaczmarczyk, J. Genetic differences in variants of the AMD virus at the site of a disease outbreak. Virology 2023, 587, 109851. [Google Scholar] [CrossRef]
  25. Ryt-Hansen, P.; Hjulsager, C.K.; Hagberg, E.E.; Chriel, M.; Struve, T.; Pedersen, A.G.; Larsen, L.E. Outbreak tracking of Aleutian mink disease virus (AMDV) using partial NS1 gene sequencing. Virol. J. 2017, 14, 119. [Google Scholar] [CrossRef] [PubMed]
  26. Farid, A.H.; Hussain, I. Dose response of black American mink to Aleutian mink disease virus. Immun. Inflamm. Dis. 2020, 8, 150–164. [Google Scholar] [CrossRef]
  27. Eklund, C.M.; Hadlow, W.J.; Kennedy, R.C.; Boyle, C.C.; Jackson, T.A. Aleutian Disease of mink—Properties of etiologic agent and host responses. J. Infects. Dis. 1968, 118, 510–526. [Google Scholar] [CrossRef] [PubMed]
  28. Hansen, M.; Lund, E. Pregnancy rate and fetal mortality in Aleutian Disease Virus—infected mink. Acta Vet. Scand. 1988, 29, 271–272. [Google Scholar] [CrossRef]
  29. Zalewski, A.; Virtanen, J.M.E.; Zalewska, H.; Sironen, T.; Kolodziej-Sobocinska, M. Asymptomatic viral infection is associated with lower host reproductive output in wild mink populations. Sci. Rep. 2023, 13, 9390. [Google Scholar] [CrossRef]
  30. Reichert, M.; Kostro, K. Effect of persistent infection of mink with Aleutian mink disease virus on reproductive failure. Bull. Vet. Inst. Pul. 2014, 58, 369–373. [Google Scholar] [CrossRef]
  31. Siemionek, J.; Zaleska-Wawro, M.; Przywara, K.; Gasiorek, B.; Szczerba-Turek, A.; Szweda, W. Occurrence of Aleutian mink disease in selected national mink farms in light of serological and molecular investigations. Med. Wet. Vet. Med. Sci. Pract. 2017, 73, 591–594. [Google Scholar] [CrossRef]
  32. Oie, K.L.; Durrant, G.; Wolfinbarger, J.B.; Martin, D.; Costello, F.; Perryman, S.; Hogan, D.; Hadlow, W.J.; Bloom, M.E. Relationship between capsid protein (VP2) sequence and pathogenicity of Aleutian mink disease parvovirus (ADV): A possible role for raccoons in the transmission of ADV infections. J. Virol. 1996, 70, 852–861. [Google Scholar] [CrossRef] [PubMed]
  33. Prieto, A.; Diaz-Cao, J.M.; Fernandez-Antonio, R.; Panadero, R.; Lopez-Lorenzo, G.; Diaz, P.; Perez-Creo, A.; Morrondo, M.P.; Fernandez, G. Lesser housefly (Fannia canicularis) as possible mechanical vector for Aleutian mink disease virus. Vet. Microbiol. 2018, 221, 90–93. [Google Scholar] [CrossRef]
  34. Prieto, A.; Fernandez-Antonio, R.; Diaz-Cao, J.M.; Lopez, G.; Diaz, P.; Alonso, J.M.; Morrondo, P.; Fernandez, G. Distribution of Aleutian mink disease virus contamination in the environment of infected mink farms. Vet. Microbiol. 2017, 204, 59–63. [Google Scholar] [CrossRef] [PubMed]
  35. Prieto, A.; Manuel Diaz-Cao, J.; Fernandez-Antonio, R.; Panadero, R.; Diaz, P.; Lopez, C.; Morrondo, P.; Diez-Banos, P.; Fernandez, G. Application of real-time PCR to detect Aleutian Mink Disease Virus on environmental farm sources. Vet. Microbiol. 2014, 173, 355–359. [Google Scholar] [CrossRef]
  36. Themudo, G.E.; Houe, H.; Agger, J.F.; Ostergaard, J.; Ersboll, A.K. Identification of biosecurity measures and spatial variables as potential risk factors for Aleutian disease in Danish mink farms. Prev. Vet. Med. 2012, 107, 134–141. [Google Scholar] [CrossRef]
  37. Zalewski, A.; Virtanen, J.M.E.; Brzezinski, M.; Kolodziej-Sobocinska, M.; Jankow, W.; Sironen, T. Aleutian mink disease: Spatio-temporal variation of prevalence and influence on the feral American mink. Transbound. Emerg. Dis. 2021, 68, 2556–2570. [Google Scholar] [CrossRef]
  38. Nituch, L.A.; Bowman, J.; Beauclerc, K.B.; Schulte-Hostedde, A.I. Mink Farms Predict Aleutian Disease Exposure in Wild American Mink. PLoS ONE 2011, 6, e21693. [Google Scholar] [CrossRef]
  39. Canuti, M.; O’Leary, K.E.; Hunter, B.D.; Spearman, G.; Ojkic, D.; Whitney, H.G.; Lang, A.S. Driving forces behind the evolution of the Aleutian mink disease parvovirus in the context of intensive farming. Virus Evol. 2016, 2, vew004. [Google Scholar] [CrossRef]
  40. Farid, A.H.; Rupasinghe, P.; Mitchell, J.L.; Rouvinen-Watt, K. A survey of Aleutian mink disease virus infection of feral American mink in Nova Scotia. Canad. Vet. J. 2010, 51, 75–77. [Google Scholar]
  41. Cho, H.J.; Greenfield, J. Eradication of Aleutian Disease of mink by eliminating posistive counterimmunoelectrophoresis test reactors. J. Clin. Microbiol. 1978, 7, 18–22. [Google Scholar] [CrossRef] [PubMed]
  42. Regulation of the Minister of the Agriculture of 11 March 2004 on the Protection of Animal Health and Combating Infectious Animal Diseases, Polish Law Gazette No. 69. 625, 2004. Internet System of Legal Documents. Available online: https://isap.sejm.gov.pl/isap.nsf/DocDetails.xsp?id=WDU20040690625 (accessed on 29 May 2024). (In Polish)
  43. Jakubczak, A.; Kowalczyk, M.; Kostro, K.; Jezewska-Witkowska, G. Comparative molecular analysis of strains of the Aleutian Disease Virus isolated from farmed and wild mink. Ann. Agric. Environ. Med. 2017, 24, 366–371. [Google Scholar] [CrossRef] [PubMed]
  44. Zaleska-Wawro, M.; Szczerba-Turek, A.; Szweda, W.; Siemionek, J. Seroprevalence and Molecular Epidemiology of Aleutian Disease in Various Countries during 1972–2021: A Review and Meta-Analysis. Animals 2021, 11, 2975. [Google Scholar] [CrossRef] [PubMed]
  45. Kelly, D.W.; Paterson, R.A.; Townsend, C.R.; Poulin, R.; Tompkins, D.M. Parasite spillback: A neglected concept in invasion ecology? Ecology 2009, 90, 2047–2056. [Google Scholar] [CrossRef]
  46. Manas, S.; Gomez, A.; Asensio, V.; Palazon, S.; Podra, M.; Esther Alarcia, O.; Ruiz-Olmo, J.; Casal, J. Prevalence of antibody to aleutian mink disease virus in European Mink (Mustela lutreola) and American mink (Neovison vison) in Spain. J. Wild. Dis. 2016, 52, 22–32. [Google Scholar] [CrossRef]
  47. Bonesi, L.; Palazon, S. The American mink in Europe: Status, impacts, and control. Biol. Conserv. 2007, 134, 470–483. [Google Scholar] [CrossRef]
  48. Klockiewicz, M.; Jakubowski, T.; Karabowicz, J.; Baska, P.; Winiarska, J.; Dlugosz, E. Identification of intestinal parasites in wild American mink (Neovison vison) from Biebrza and Narew national parks (Poland). Parasitol. Res. 2023, 122, 1621–1629. [Google Scholar] [CrossRef]
  49. Jensen, T.H.; Christensen, L.S.; Chriel, M.; Uttenthal, A.; Hammer, A.S. Implementation and validation of a sensitive PCR detection method in the eradication campaign against Aleutian mink disease virus. J. Virol. Meth. 2011, 171, 81–85. [Google Scholar] [CrossRef]
  50. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucl. Acid. Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
  51. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
  52. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  53. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
  54. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar]
  55. Sergeant; ESG. Epitools Epidemiological Calculators. Ausvet. 2018. Available online: http://epitools.ausvet.com.au (accessed on 14 April 2024).
  56. Gottschalck, E.; Alexandersen, S.; Storgaard, T.; Bloom, M.E.; Aasted, B. Sequence comparison of the nonstructural genes of 4 different types of Aleutian Mink Disease Parvovirus indicates an usual degree of variability. Arch. Virol. 1994, 138, 213–231. [Google Scholar] [CrossRef] [PubMed]
  57. Schuierer, S.; Bloom, M.E.; Kaaden, O.R.; Truyen, U. Sequence analysis of the lymphotropic Aleutian disease parvovirus ADV-SL3. Arch. Virol. 1997, 142, 157–166. [Google Scholar] [CrossRef]
  58. Li, Y.W.; Huang, J.; Jia, Y.; Du, Y.J.; Jiang, P.; Zhang, R. Genetic characterization of Aleutian mink disease viruses isolated in China. Virus Genes 2012, 45, 24–30. [Google Scholar] [CrossRef]
  59. Virtanen, J.; Smura, T.; Aaltonen, K.; Moisander-Jylha, A.-M.; Knuuttila, A.; Vapalahti, O.; Sironen, T. Co-circulation of highly diverse Aleutian mink disease virus strains in Finland. J. Gen. Virol. 2019, 100, 227–236. [Google Scholar] [CrossRef]
  60. Yamaguchi, N.; Macdonald, D.W. Detection of Aleutian disease antibodies in feral American mink in southern England. Vet. Rec. 2001, 149, 485–488. [Google Scholar] [CrossRef]
  61. Knuuttila, A.; Aaltonen, K.; Virtala, A.M.K.; Henttonen, H.; Isomursu, M.; Leimann, A.; Maran, T.; Saarma, U.; Timonen, P.; Vapalahti, O.; et al. Aleutian mink disease virus in free-ranging mustelids in Finland—A cross-sectional epidemiological and phylogenetic study. J. Gen. Virol. 2015, 96, 1423–1435. [Google Scholar] [CrossRef]
Animals 14 02584 g001
Figure 1. The evolutionary relationship between the NS1 gene variants detected in this study and AMDV G (Acc. No. NC001662). Evolutionary history was inferred by using the maximum likelihood method and the Tamura–Nei model [54]. The tree with the highest log likelihood (−760.58) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying the Neighbor–Join and BioNJ algorithms to a matrix of pairwise distances, as estimated using the Tamura–Nei model, and then by selecting the topology with superior log likelihood value. The tree was drawn to scale with branch lengths measured according to the number of substitutions per site. This analysis involved 12 nucleotide sequences. Codon positions included were as follows: 1st + 2nd + 3rd + noncoding. There was a total of 374 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [52].
Figure 1. The evolutionary relationship between the NS1 gene variants detected in this study and AMDV G (Acc. No. NC001662). Evolutionary history was inferred by using the maximum likelihood method and the Tamura–Nei model [54]. The tree with the highest log likelihood (−760.58) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying the Neighbor–Join and BioNJ algorithms to a matrix of pairwise distances, as estimated using the Tamura–Nei model, and then by selecting the topology with superior log likelihood value. The tree was drawn to scale with branch lengths measured according to the number of substitutions per site. This analysis involved 12 nucleotide sequences. Codon positions included were as follows: 1st + 2nd + 3rd + noncoding. There was a total of 374 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [52].
Animals 14 02584 g001
Animals 14 02584 g002
Figure 2. Nucleotide substitution of Polish isolates of NS1 gene of AMDV in comparison to AMDV G genome (Acc. No. NC001662).
Figure 2. Nucleotide substitution of Polish isolates of NS1 gene of AMDV in comparison to AMDV G genome (Acc. No. NC001662).
Animals 14 02584 g002
Animals 14 02584 g003
Figure 3. Amino acid (aa) substitutions in of Polish isolates on NS1 protein of AMDV in comparison to NS1 protein of AMDV G (Protein ID NP042872).
Figure 3. Amino acid (aa) substitutions in of Polish isolates on NS1 protein of AMDV in comparison to NS1 protein of AMDV G (Protein ID NP042872).
Animals 14 02584 g003
Animals 14 02584 g004
Figure 4. The evolutionary relationship between the NS1 gene variants obtained in this study and the other NS1 genes of AMDV (Table 1) from NCBI (redo analysis, including outgroup OL889863.1). The evolutionary history was inferred by using the maximum likelihood method and the Tamura–Nei model [54]. The tree with the highest log likelihood (−4694.52) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying the Neighbor–Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura–Nei model, and then selecting the topology with the superior log likelihood value. The tree was drawn to scale with branch lengths measured according to the number of substitutions per site. This analysis involved 28 nucleotide sequences. Codon positions included were as follows: 1st + 2nd + 3rd + noncoding. Evolutionary analyses were conducted in MEGA X [52].
Figure 4. The evolutionary relationship between the NS1 gene variants obtained in this study and the other NS1 genes of AMDV (Table 1) from NCBI (redo analysis, including outgroup OL889863.1). The evolutionary history was inferred by using the maximum likelihood method and the Tamura–Nei model [54]. The tree with the highest log likelihood (−4694.52) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying the Neighbor–Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura–Nei model, and then selecting the topology with the superior log likelihood value. The tree was drawn to scale with branch lengths measured according to the number of substitutions per site. This analysis involved 28 nucleotide sequences. Codon positions included were as follows: 1st + 2nd + 3rd + noncoding. Evolutionary analyses were conducted in MEGA X [52].
Animals 14 02584 g004
Table 2. Point mutations that induce amino acid changes between isolates of NS1 gene of AMDV in comparison to AMDV G (Acc. No. NC001662, position 578–951; protein ID NP042872, position 125–249).
Table 2. Point mutations that induce amino acid changes between isolates of NS1 gene of AMDV in comparison to AMDV G (Acc. No. NC001662, position 578–951; protein ID NP042872, position 125–249).
Position in the NS1 Sequence:
Position in the
NS1 Protein		AMDV G
(NC001662)
Nucleotides:
Amino Acid		AMDV BPN5 W
(OK263135)
Nucleotides:
Amino Acid		AMDV NPN4 W
(OK263139)
Nucleotides:
Amino Acid		AMDV NPN5 W
(OK263140)
Nucleotides:
Amino Acid		AMDV NPN7 W
(OK263142)
Nucleotides:
Amino Acid
632–634: 143CAA: QCAA: QCAA: QCAA: QCAC: H
650–652: 149TTT: FTTT: FTTT: FTTT: FTTG: L
653–655: 150ATG: MATG: MATG: MATA: ICTT: L
659–661: 152AGA: RAGA: RAGA: RAAA: KAAA: K
668–670: 155AAA: KAAA: KAAA: KAAA: KAGA: R
680–682: 159GTT: VGTT: VGTT: VGTT: VGCT: A
683–685: 160ATC: IATA: IATA: IATA: IATC: I
686–688: 161TAT: YTAT: YTAT: YTAT: YTTT: F
707–709: 168ATA: IATA: IATA: IATA: ICAA: Q
713–715: 170GAT: DAAT: NAAT: NAAT: NGAC: D
728–730: 176GAA: DGAA: DGAA: DGAA: DGAG: A
740–742: 179AAG: KAAG: KAAG: KAAA: KGAT: D
797–799: 198AAA: KAAA: KAAA: KAAA: KAGA: R
818–820: 203AAT: DAAC: EAAC: EAAC: EAAT: D
824–826: 207CCA: PTCA: STCA: STCA: STCA: S
830–832: 209CAC: HCAC: HCAC: HCAC: HAAC: N
833–835: 210TTG: LATG: MATG: MATG: MATG: M
845–847: 214ACA: TGTA: VGTA: VGTA: VGCA: A
848–850: 215TTC: FATG: MATA: IATA: ICTA: L
878–880: 225AAT: NAAT: NAAT: NAAT: NCAT: H
881–883: 226ACA: TAAA: KAAA: KAAA: KAAG: K
884–886: 227GAT: DGAT: DGAT: DGAT: DGAA: E
887–889: 228AGT: SAAT: NAAT: NAAT: NGGT: G
902–904: 233TTT: FTTT: FTTT: FTTT: FTAT: Y
905–907: 234GCT: AACT: TACT: TACT: TAGT: S
Nucleotides: A—adenine; G—guanine; C—cytosine; T—thymine. Amino acids: A—alanine; D—aspartic acid; E—glutamic acid; F—phenylalanine; G—glycine; H—histidine; I—isoleucine; K—lysine; L—leucine; M—methionine; N—asparagine; Q—glutamine; R—arginine; S—serine; T—threonine; V—valine; Y—tyrosine. Silent mutation data is marked in bold text.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Przywara, K.; Siemionek, J.; Jakubowski, T.; Konczyk-Kmiecik, K.; Szczerba-Turek, A. Prevalence of Aleutian Mink Disease Virus (AMDV) in Free-Ranging American Mink from Biebrza and Narew National Parks (Poland)—An Epidemiological Concern. Animals 2024, 14, 2584. https://doi.org/10.3390/ani14172584

AMA Style

Przywara K, Siemionek J, Jakubowski T, Konczyk-Kmiecik K, Szczerba-Turek A. Prevalence of Aleutian Mink Disease Virus (AMDV) in Free-Ranging American Mink from Biebrza and Narew National Parks (Poland)—An Epidemiological Concern. Animals. 2024; 14(17):2584. https://doi.org/10.3390/ani14172584

Chicago/Turabian Style

Przywara, Konrad, Jan Siemionek, Tadeusz Jakubowski, Klaudia Konczyk-Kmiecik, and Anna Szczerba-Turek. 2024. "Prevalence of Aleutian Mink Disease Virus (AMDV) in Free-Ranging American Mink from Biebrza and Narew National Parks (Poland)—An Epidemiological Concern" Animals 14, no. 17: 2584. https://doi.org/10.3390/ani14172584

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop