Dietary Isatidis Root Residue Improves Diarrhea and Intestinal Function in Weaned Piglets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Quantitative Analysis of Active Ingredients in Residues
2.3. Animals and Dietary Treatments
2.4. Sample Collection
2.5. Growth Performance
2.6. Organ Index
2.7. Serum Biochemical Parameter Analysis
2.8. Immunoglobulin Analysis
2.9. Intestinal Morphology
2.10. AB-PAS Staining
2.11. Quantitative Real-Time PCR Analysis
2.12. Microbial Analysis
2.13. Statistical Analysis
3. Results
3.1. Growth Performance and Diarrhea Score
3.2. Serum Biochemical Parameters
3.3. Intestinal Morphology
3.4. Expressions of Tight Barrier and Inflammation-Related Genes
3.5. Intestinal Bacterial Compositions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gimsa, U.; Tuchscherer, M.; Kanitz, E. Psychosocial stress and immunity—What can we learn from pig studies? Front. Behav. Neurosci. 2018, 12, 64. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Tang, L.; Liu, N.; Zhang, F.; Liu, X.; Jiang, Q.; Chen, J.; Ma, X. Comparative effects of compound enzyme and antibiotics on growth performance, nutrient digestibility, blood biochemical index, and intestinal health in weaned pigs. Front. Microbiol. 2021, 12, 768767. [Google Scholar] [CrossRef] [PubMed]
- Martin, M.J.; Thottathil, S.E.; Newman, T.B. Antibiotics overuse in animal agriculture: A call to action for health care providers. Am. J. Public Health 2015, 105, 2409–2410. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Li, Z.X.; Wu, Y.; Huang, Z.Y.; Hu, Y.; Gao, J. Treatment and bioresources utilization of traditional Chinese medicinal herb residues: Recent technological advances and industrial prospect. J. Environ. Manag. 2021, 299, 113607. [Google Scholar] [CrossRef]
- Chen, J.; Zhu, Z.; Gao, T.; Chen, Y.; Yang, Q.; Fu, C.; Zhu, Y.; Wang, F.; Liao, W. Isatidis Radix and Isatidis Folium: A systematic review on ethnopharmacology, phytochemistry and pharmacology. J. Ethnopharmacol. 2022, 283, 114648. [Google Scholar] [CrossRef]
- Su, J.; Chen, X.M.; Xie, Y.L.; Li, M.Q.; Shang, Q.; Zhang, D.K.; Cai, X.F.; Liu, H.; Huang, H.Z.; Zheng, C.; et al. Clinical efficacy, pharmacodynamic components, and molecular mechanisms of antiviral granules in the treatment of influenza: A systematic review. J. Ethnopharmacol. 2024, 318, 117011. [Google Scholar] [CrossRef]
- Yu, H.; Li, T.N.; Ran, Q.; Huang, Q.W.; Wang, J. Strobilanthes cusia (Nees) Kuntze, a multifunctional traditional Chinese medicinal plant, and its herbal medicines: A comprehensive review. J. Ethnopharmacol. 2021, 265, 113325. [Google Scholar] [CrossRef]
- Zeng, H.T.; Dai, D.; He, X.Q.; Tian, Y.Y.; Wang, X.Q.; Yu, J.B.; Li, J.; Liao, W.B. Research practice and strategy of resource utilization of residues for edible medicinal plants under background of Big Health. Zhongguo Zhong Yao Za Zhi 2022, 47, 3968–3976. [Google Scholar] [CrossRef]
- Luo, J.; Yang, R.; Ma, F.; Jiang, W.; Han, C. Recycling utilization of Chinese medicine herbal residues resources: Systematic evaluation on industrializable treatment modes. Environ. Sci. Pollut. Res. Int. 2023, 30, 32153–32167. [Google Scholar] [CrossRef]
- Wu, S.; Luo, H.; Zhong, Z.; Ai, Y.; Zhao, Y.; Liang, Q.; Wang, Y. Phytochemistry, Pharmacology and Quality Control of Xiasangju: A Traditional Chinese Medicine Formula. Front. Pharmacol. 2022, 13, 930813. [Google Scholar] [CrossRef]
- Shao, Y.; Sun, Y.; Li, D.; Chen, Y. Chrysanthemum indicum L.: A Comprehensive Review of its Botany, Phytochemistry and Pharmacology. Am. J. Chin. Med. 2020, 48, 871–897. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Lu, C.; Zhou, J.; Zhou, F.; Gui, A.; Chu, H.; Shao, Q. Chrysanthemum morifolium as a traditional herb: A review of historical development, classification, phytochemistry, pharmacology and application. J. Ethnopharmacol. 2024, 330, 118198. [Google Scholar] [CrossRef] [PubMed]
- Kuralkar, P.; Kuralkar, S.V. Role of herbal products in animal production—An updated review. J. Ethnopharmacol. 2021, 278, 114246. [Google Scholar] [CrossRef]
- Tsiplakou, E.; Pitino, R.; Manuelian, C.L.; Simoni, M.; Mitsiopoulou, C.; De Marchi, M.; Righi, F. Plant Feed Additives as Natural Alternatives to the Use of Synthetic Antioxidant Vitamins in Livestock Animal Products Yield, Quality, and Oxidative Status: A Review. Antioxidants 2021, 10, 780. [Google Scholar] [CrossRef]
- Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharmacother. 2018, 97, 67–74. [Google Scholar] [CrossRef]
- Gao, J.; Yang, Z.; Zhao, C.; Tang, X.; Jiang, Q.; Yin, Y. A comprehensive review on natural phenolic compounds as alternatives to in-feed antibiotics. Sci. China Life Sci. 2023, 66, 1518–1534. [Google Scholar] [CrossRef]
- Shi, Y.-C.; Zhao, Y.-R.; Zhang, A.-Z.; Zhao, L.; Yu, Z.; Li, M.-Y. Hexavalent chromium-induced toxic effects on the hematology, redox state, and apoptosis in Cyprinus carpio. Reg. Stud. Mar. Sci. 2022, 56, 102676. [Google Scholar] [CrossRef]
- Yu, Z.; Zhao, Y.Y.; Zhang, Y.; Zhao, L.; Ma, Y.F.; Li, M.Y. Bioflocs attenuate Mn-induced bioaccumulation, immunotoxic and oxidative stress via inhibiting GR-NF-κB signalling pathway in Channa asiatica. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 247, 109060. [Google Scholar] [CrossRef]
- Wang, K.; Zhou, M.; Gong, X.; Zhou, Y.; Chen, J.; Ma, J.; Zhang, P. Starch–protein interaction effects on lipid metabolism and gut microbes in host. Front. Nutr. 2022, 9, 1018026. [Google Scholar] [CrossRef]
- Yin, J.; Li, Y.; Han, H.; Chen, S.; Gao, J.; Liu, G.; Wu, X.; Deng, J.; Yu, Q.; Huang, X.; et al. Melatonin reprogramming of gut microbiota improves lipid dysmetabolism in high-fat diet-fed mice. J. Pineal. Res. 2018, 65, e12524. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.M.; Qin, J.A.; Dou, X.W.; Yang, M.H.; Sun, X.B. Extrinsic harmful residues in Chinese herbal medicines: Types, detection, and safety evaluation. Chin. Herb. Med. 2018, 10, 117–136. [Google Scholar] [CrossRef]
- Xu, Q.; Cheng, M.; Jiang, R.; Zhao, X.; Zhu, J.; Liu, M.; Chao, X.; Zhang, C.; Zhou, B. Effects of dietary supplement with a Chinese herbal mixture on growth performance, antioxidant capacity, and gut microbiota in weaned pigs. Front. Vet. Sci. 2022, 9, 971647. [Google Scholar] [CrossRef]
- Li, Y.; Sun, T.; Hong, Y.; Qiao, T.; Wang, Y.; Li, W.; Tang, S.; Yang, X.; Li, J.; Li, X.; et al. Mixture of Five Fermented Herbs (Zhihuasi Tk) Alters the Intestinal Microbiota and Promotes the Growth Performance in Piglets. Front. Microbiol. 2021, 12, 725196. [Google Scholar] [CrossRef]
- Liu, Y.; Li, Y.; Xiao, Y.; Peng, Y.; He, J.; Chen, C.; Xiao, D.; Yin, Y.; Li, F. Mulberry leaf powder regulates antioxidative capacity and lipid metabolism in finishing pigs. Anim. Nutr. 2021, 7, 421–429. [Google Scholar] [CrossRef]
- Hu, J.; Ma, L.; Nie, Y.; Chen, J.; Zheng, W.; Wang, X.; Xie, C.; Zheng, Z.; Wang, Z.; Yang, T.; et al. A Microbiota-Derived Bacteriocin Targets the Host to Confer Diarrhea Resistance in Early-Weaned Piglets. Cell Host Microbe 2018, 24, 817–832.e8. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.W.; Lee, T.T.; Shih, Y.C.; Yu, B. Effects of dietary supplementation of Chinese medicinal herbs on polymorphonuclear neutrophil immune activity and small intestinal morphology in weanling pigs. J. Anim. Physiol. Anim. Nutr. 2012, 96, 285–294. [Google Scholar] [CrossRef]
- Zhao, P.; Piao, X.; Zeng, Z.; Li, P.; Xu, X.; Wang, H. Effect of Forsythia suspensa extract and chito-oligosaccharide alone or in combination on performance, intestinal barrier function, antioxidant capacity and immune characteristics of weaned piglets. Anim. Sci. J. 2017, 88, 854–862. [Google Scholar] [CrossRef]
- Yin, J.; Li, Y.; Tian, Y.; Zhou, F.; Ma, J.; Xia, S.; Yang, T.; Ma, L.; Zeng, Q.; Liu, G.; et al. Obese Ningxiang pig-derived microbiota rewires carnitine metabolism to promote muscle fatty acid deposition in lean DLY pigs. Innovation 2023, 4, 100486. [Google Scholar] [CrossRef]
- Fan, L.; Xia, Y.; Wang, Y.; Han, D.; Liu, Y.; Li, J.; Fu, J.; Wang, L.; Gan, Z.; Liu, B.; et al. Gut microbiota bridges dietary nutrients and host immunity. Sci. China Life Sci. 2023, 66, 2466–2514. [Google Scholar] [CrossRef]
- Lin, Z.N.; Ye, L.; Li, Z.W.; Huang, X.S.; Lu, Z.; Yang, Y.Q.; Xing, H.W.; Bai, J.Y.; Ying, Z.Y. Chinese herb feed additives improved the growth performance, meat quality, and nutrient digestibility parameters of pigs. Anim. Models Exp. Med. 2020, 3, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Aoyama, Y.; Ashida, K. Effect of Excess and Deficiency of Individual Essential Amino Acids in Diets on the Liver Lipid Content of Growing Rats. J. Nutr. 1972, 102, 1025–1032. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, L.; Qin, Y.; Mao, Z.; Huang, Z.; Jia, G.; Zhao, H.; Liu, G. Dietary L-theanine supplementation improves lipid metabolism and antioxidant capacity in weaning piglets. Anim. Biotechnol. 2022, 33, 1407–1415. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Chen, Y.; Liu, H.; Liu, J.; Makkar, H.P.; Becker, K. Effects of replacing soybean meal by detoxified Jatropha curcas kernel meal in the diet of growing pigs on their growth, serum biochemical parameters and visceral organs. Anim. Feed. Sci. Technol. 2011, 170, 141–146. [Google Scholar] [CrossRef]
- He, L.; Guo, J.; Wang, Y.; Wang, L.; Xu, D.; Yan, E.; Zhang, X.; Yin, J. Effects of dietary yeast β-glucan supplementation on meat quality, antioxidant capacity and gut microbiota of finishing pigs. Antioxidants 2022, 11, 1340. [Google Scholar] [CrossRef]
- Chen, H.; Lv, K.; Ji, G.; Yuan, Y.; Lu, L.; Liang, F.; Li, K.; Xu, Z.; Xiong, J.; Qu, L. Physiological acclimatization of the liver to 180-day isolation and the Mars solar day. BioMed Res. Int. 2020, 2020, 2796510. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Zhou, M.; Song, Z.; Deng, Y.; Xia, S.; Li, Y.; Huang, X.; Xiao, D.; Yin, Y.; Yin, J. Clec7a drives gut fungus-mediated host lipid deposition. Microbiome 2023, 11, 264. [Google Scholar] [CrossRef]
- Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning stress and intestinal health of piglets: A review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef]
- Zhao, J.; Zhang, G.; Zhou, X.; Dong, W.; Wang, Q.; Xiao, C.; Zhang, S. Effect of Dandelion root extract on growth performance, immune function and bacterial community in weaned pigs. Food Agric. Immunol. 2019, 30, 95–111. [Google Scholar] [CrossRef]
- Wang, M.; Huang, H.; Hu, Y.; Liu, Y.; Zeng, X.; Zhuang, Y.; Yang, H.; Wang, L.; Chen, S.; Yin, L. Effects of dietary supplementation with herbal extract mixture on growth performance, organ weight and intestinal morphology in weaning piglets. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1462–1470. [Google Scholar] [CrossRef]
- Speranza, J.; Miceli, N.; Taviano, M.F.; Ragusa, S.; Kwiecień, I.; Szopa, A.; Ekiert, H. Isatis tinctoria L. (Woad): A Review of Its Botany, Ethnobotanical Uses, Phytochemistry, Biological Activities, and Biotechnological Studies. Plants 2020, 9, 298. [Google Scholar] [CrossRef] [PubMed]
- Song, W.; Zou, Z.; Chen, X.; Tan, J.; Liu, L.; Wei, Q.; Xiong, P.; Song, Q.; Chen, J.; Su, W.; et al. Effects of traditional Chinese herbal feed supplement on growth performance, immunity, antioxidant levels, and intestinal health in chickens: A study on Ningdu yellow chickens. Poult. Sci. 2023, 102, 102986. [Google Scholar] [CrossRef]
- Jandhyala, S.M.; Talukdar, R.; Subramanyam, C.; Vuyyuru, H.; Sasikala, M.; Reddy, D.N. Role of the normal gut microbiota. World J. Gastroenterol. WJG 2015, 21, 8787. [Google Scholar] [CrossRef]
- Basso, M.; Venditti, C.; Raponi, G.; Navazio, A.S.; Alessandri, F.; Giombini, E.; Nisii, C.; Di Caro, A.; Venditti, M. A case of persistent bacteraemia by Ralstonia mannitolilytica and Ralstonia pickettii in an intensive care unit. Infect. Drug Resist. 2019, 12, 2391–2395. [Google Scholar] [CrossRef] [PubMed]
- Chiers, K.; Haesebrouck, F.; Mateusen, B.; Van Overbeke, I.; Ducatelle, R. Pathogenicity of Actinobacillus minor, Actinobacillus indolicus and Actinobacillus porcinus Strains for Gnotobiotic Piglets. J. Vet. Med. Ser. B 2001, 48, 127–131. [Google Scholar] [CrossRef]
- Ren, D.; Li, L.; Schwabacher, A.W.; Young, J.W.; Beitz, D.C. Mechanism of cholesterol reduction to coprostanol by Eubacterium coprostanoligenes ATCC 51222. Steroids 1996, 61, 33–40. [Google Scholar] [CrossRef]
- Freier, T.A.; Beitz, D.C.; Li, L.; Hartman, P.A. Characterization of Eubacterium coprostanoligenes sp. nov., a cholesterol-reducing anaerobe. Int. J. Syst. Evol. Microbiol. 1994, 44, 137–142. [Google Scholar] [CrossRef]
No. | L-Arg | Guanine | L-Phe | Epigoitrin | Deoxyvasicinone | 3-Indolylacetonitrile | Indigo | Indirubin |
---|---|---|---|---|---|---|---|---|
1 | 1.26 | 1.84 | 0.34 | 0.45 | 0.23 | 0.67 | 2.88 | 0.33 |
2 | 0.98 | 0.98 | 0.22 | 0.49 | 0.26 | 0.70 | 1.58 | 0.29 |
3 | 0.87 | 0.74 | 0.20 | 0.48 | 0.24 | 0.77 | 1.56 | 0.28 |
4 | 1.01 | 0.84 | 0.20 | 0.43 | 0.22 | 0.63 | 1.56 | 0.25 |
5 | 1.46 | 1.27 | 0.22 | 0.37 | 0.19 | 0.54 | 2.28 | 0.22 |
6 | 1.43 | 1.55 | 0.23 | 0.36 | 0.17 | 0.49 | 2.84 | 0.21 |
7 | 1.03 | 0.64 | 0.12 | 0.31 | 0.12 | 0.43 | 1.43 | 0.14 |
8 | 1.43 | 0.64 | 0.16 | 0.41 | 0.17 | 0.40 | 1.55 | 0.18 |
9 | 1.39 | 0.78 | 0.13 | 0.33 | 0.12 | 0.39 | 1.55 | 0.15 |
10 | 1.28 | 0.65 | 0.11 | 0.35 | 0.11 | 0.40 | 1.69 | 0.14 |
11 | 1.16 | 0.66 | 0.16 | 0.42 | 0.18 | 0.49 | 1.51 | 0.19 |
12 | 1.08 | 1.28 | 0.16 | 0.42 | 0.17 | 0.47 | 1.57 | 0.19 |
13 | 1.03 | 0.73 | 0.13 | 0.36 | 0.14 | 0.40 | 1.44 | 0.16 |
14 | 1.33 | 1.41 | 0.21 | 0.38 | 0.18 | 0.51 | 2.31 | 0.22 |
15 | 1.18 | 1.35 | 0.22 | 0.34 | 0.16 | 0.52 | 2.74 | 0.20 |
Mean (n = 15) | 1.19 | 1.02 | 0.19 | 0.39 | 0.18 | 0.52 | 1.90 | 0.21 |
SD | 0.19 | 0.39 | 0.06 | 0.05 | 0.05 | 0.12 | 0.55 | 0.06 |
RSD | 0.16 | 0.38 | 0.31 | 0.14 | 0.25 | 0.23 | 0.29 | 0.27 |
Ingredient | Content (%) | Ingredient | Content (%) |
---|---|---|---|
ASP | 0.59 | VAL | 0.39 |
GLU | 0.80 | MET | 0.05 |
SER | 0.28 | PHE | 0.31 |
HIS | 0.22 | ILE | 0.28 |
GLY | 0.34 | LEU | 0.46 |
THR | 0.30 | LYS | 0.37 |
ARG | 0.94 | PRO | 0.73 |
Total | 6.63 |
Ingredient | Content (%) | ||||
---|---|---|---|---|---|
IRR | CON | 0.5 | 1 | 2 | 4 |
Corn | 56.08 | 55.63 | 55.08 | 53.88 | 51.68 |
Fermented soybean meal | 30.1 | 30 | 30 | 30 | 29.8 |
Soybean oil | 3 | 3.05 | 3.1 | 3.3 | 3.7 |
Glucose | 2 | 2 | 2 | 2 | 2 |
Sucrose | 3 | 3 | 3 | 3 | 3 |
Limestone | 1 | 1 | 1 | 1 | 1 |
CaHPO4 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
NaCl | 0.3 | 0.3 | 0.3 | 0.3 | 0.3 |
Citric acid | 0.9 | 0.9 | 0.9 | 0.9 | 0.9 |
Choline chloride | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
L-Lysine HCl | 0.6 | 0.6 | 0.6 | 0.6 | 0.6 |
DL-Methionine | 0.3 | 0.3 | 0.3 | 0.3 | 0.3 |
L-Threonine | 0.12 | 0.12 | 0.12 | 0.12 | 0.12 |
Premix | 1 | 1 | 1 | 1 | 1 |
Total | 100 | 100 | 100 | 100 | 100 |
Nutrient Levels | Content | ||||
CON | 0.5 | 1 | 2 | 4 | |
Digestible energy, kcal/kg | 3509 | 3509 | 3506 | 3506 | 3506 |
Crude protein, % | 19.82 | 19.81 | 19.81 | 19.83 | 19.82 |
Calcium, % | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
Total phosphorus, % | 0.6 | 0.6 | 0.6 | 0.6 | 0.6 |
Available phosphorus, % | 0.38 | 0.38 | 0.38 | 0.38 | 0.38 |
SID lysine, % | 1.45 | 1.45 | 1.45 | 1.45 | 1.45 |
SID methionine, % | 0.56 | 0.56 | 0.56 | 0.56 | 0.56 |
SID methionine + cystine, % | 0.76 | 0.76 | 0.76 | 0.76 | 0.76 |
SID threonine, % | 0.78 | 0.78 | 0.78 | 0.78 | 0.78 |
SID tryptophan, % | 0.19 | 0.19 | 0.19 | 0.19 | 0.19 |
Gene | Primer Sequences (5′-3′) | Size, bp |
---|---|---|
IL-1β | F: CCTGGACCTTGGTTCTCT | 123 |
R: GGATTCTTCATCGGCTTCT | ||
IL-10 | F: TCGGCCCAGTGAAGAGTTTC | 127 |
R: GGAGTTCACGTGCTCCTTGA | ||
IL-6 | F: AAATGTCGAGGCCGTGCAGATTAG | 86 |
R: GGGTGGTGGCTTTGTCTGGATTC | ||
TNF-α | F: ACAGGCCAGCTCCCTCTTAT | 102 |
R: CCTCGCCCTCCTGAATAAAT | ||
ZO-1 | F: TTGATAGTGGCGTTGACA | 126 |
R: CCTCATCTTCATCATCTTCTAC | ||
Claudin-1 | F: GCATCATTTCCTCCCTGTT | 97 |
R: TCTTGGCTTTGGGTGGTT | ||
Occludin | F: CAGTGGTAACTTGGAGGCGTCTTC | 103 |
R: CGTCGTGTAGTCTGTCTCGTAATGG | ||
β-actin | F: CTGCGGCATCCACGAAACT | 147 |
R: AGGGCCGTGATCTCCTTCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Yan, Z.; Xia, S.; Wang, K.; Han, Q.; Zhou, M.; Wang, D.; Yin, J.; Yin, Y. Dietary Isatidis Root Residue Improves Diarrhea and Intestinal Function in Weaned Piglets. Animals 2024, 14, 2776. https://doi.org/10.3390/ani14192776
Chen Z, Yan Z, Xia S, Wang K, Han Q, Zhou M, Wang D, Yin J, Yin Y. Dietary Isatidis Root Residue Improves Diarrhea and Intestinal Function in Weaned Piglets. Animals. 2024; 14(19):2776. https://doi.org/10.3390/ani14192776
Chicago/Turabian StyleChen, Zhong, Zenghao Yan, Siting Xia, Kaijun Wang, Qi Han, Miao Zhou, Deqin Wang, Jie Yin, and Yulong Yin. 2024. "Dietary Isatidis Root Residue Improves Diarrhea and Intestinal Function in Weaned Piglets" Animals 14, no. 19: 2776. https://doi.org/10.3390/ani14192776