Next Article in Journal
Performance, Egg Quality, and Composition in Isa Brown Laying Hens Fed with Different Levels of Desmodium tortuosum Leaf Flour
Previous Article in Journal
Evaluation of Synthetic GnRH-Analog Peforelin with Regard to Oocyte Differentiation and Follicular Development in C57BL/6J Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 19
10.3390/ani14192867
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity of Marek’s Disease Virus Strains in Infections in Backyard and Ornamental Birds

by
Ruy D. Chacón
1,
Christian J. Sánchez-Llatas
2,
Claudete S. Astolfi-Ferreira
1,
Tânia Freitas Raso
1 and
Antonio J. Piantino Ferreira
1,*
1
Department of Pathology, School of Veterinary Medicine, University of São Paulo, Av. Prof. Orlando Marques de Paiva, 87, São Paulo 05508-900, Brazil
2
Department of Genetics, Physiology, and Microbiology, Faculty of Biology, Complutense University of Madrid (UCM), 28040 Madrid, Spain
*
Author to whom correspondence should be addressed.
Animals 2024, 14(19), 2867; https://doi.org/10.3390/ani14192867 (registering DOI)
Submission received: 28 August 2024 / Revised: 1 October 2024 / Accepted: 3 October 2024 / Published: 5 October 2024
(This article belongs to the Section Birds)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Marek’s disease virus is a pathogen capable of inducing tumors, immunosuppression, and paralysis in birds. The degree of virulence is associated with oncogenes such as the meq gene, which is constantly subjected to mutations that can exacerbate clinical manifestations and aid immune escape. This study reports the detection of this virus in backyard and ornamental birds from Brazil and Peru. Through molecular and evolutionary analyses, we determined the circulation of various strains with distinct genetic virulence profiles. Additionally, we identified potential sources of introduction and distribution of this virus among the studied birds, as well as a link between backyard and commercial birds. Given that different bird species exhibit varying degrees of susceptibility or resistance to this virus, the detection and characterization of these strains are crucial for monitoring and preventing potential epidemiological outbreaks in other species.

Abstract

Marek’s disease is caused by Mardivirus gallidalpha2, commonly known as Marek’s disease virus (MDV). This pathogen infects various bird species resulting in a range of clinical manifestations. The meq gene, which is crucial for oncogenesis, has been extensively studied, but molecular investigations of MDV in noncommercial South American birds are limited. This study detected MDV in backyard and ornamental birds from Brazil and Peru and characterized the meq gene. MDV was confirmed in all seven outbreaks examined. Three isoforms of meq (S-meq, meq, and L-meq) and two to seven proline repeat regions (PRRs) were detected among the sequenced strains. At the amino acid level, genetic profiles with low and high virulence potential were identified. Phylogenetic analysis grouped the sequences into three distinct clusters. Selection pressure analysis revealed 18 and 15 codons under positive and negative selection, respectively. The results demonstrate significant MDV diversity in the studied birds, with both high and low virulence potentials. This study highlights the importance of monitoring and characterizing circulating MDV in backyard and ornamental birds, as they can act as reservoirs for future epidemiological outbreaks.

1. Introduction

Marek’s disease (MD) is a lymphoproliferative disease of birds that is characterized by the rapid development of lymphoid tumors, immunosuppression, and paralysis. It occurs in four main clinical forms: visceral, neural, cutaneous, and ocular [1,2]. The causative agent is Marek’s disease virus (MDV-1), an alphaherpesvirus classified as Mardivirus gallidalpha2 [3]. Other Mardivirus serotypes related to MD include Mardivirus gallidalpha3 (MDV-2), which is considered nonpathogenic, and Mardivirus meleagridalpha1 (HVT or MDV-3), which exclusively affects turkeys [1,3]. Viral particles consist of hexagonal nucleocapsids (85–100 nm) enveloped by an irregular, amorphous structure (up to 400 nm) [1,4]. Since its initial descriptions were recorded, MD has evolved, transitioning from neural to tumor manifestations. This shift has increased its virulence and mortality rate [5]. MDVs are categorized into pathotypes based on virulence: mild (mMDV), virulent (vMDV), very virulent (vvMDV), and very virulent plus (vv+MDV) strains [6].
Vaccination has been a primary strategy for MD prevention, using for monovalent or bivalent strains SB-1 (MDV-2), FC126 (MDV-3), and, since the 1990s, CVI988 (MDV-1) [1,5]. While vaccination programs have advanced and are routinely implemented, MD outbreaks have continued to occur in recent years [1,7,8,9,10]. For backyard and ornamental birds, given their lower biosecurity and high economic/conservation value, vaccination is strongly recommended, but less frequently practiced and regulated [11,12,13,14,15].
The complete MDV genome has an approximate length of 178 kb and comprises two unique regions: the long unique region (UL) and the short unique region (US) [16]. These regions are flanked by identical inverted repeats of terminal and internal regions called TRL and IRL (flanking UL), and TRS and IRS (flanking US). MDVs are known to encode more than 100 functional proteins [16]. Several of these have homologs in alphaherpesviruses, while others are unique to MDVs and are important for pathogenesis and evading the host immune response [1]. Some of these unique genes include latency-associated transcripts (LATs), Meq (Marek’s EcoQ), vIL-8, viral lipase pp38/pp24, the 1.8 kb gene family, telomerase RNA (vTR), and MDV-encoded microRNAs [1]. Among these genes, the meq oncogene is particularly important in terms of pathogenesis and immunosuppression. This gene has a standard form that is 339 amino acids in length [16]. However, other isoforms have been described, such as long-meq (L-meq), very long-meq (VL-meq), short-meq (S-meq), and very short-meq (VS-meq) [5,12,15,17]. The presence of polymorphisms in the basic region (BR) and leucine zipper (ZIP) domains, as well as the number of proline repeats in the transactivation domain (TAD), has been associated with variations in virulence [18,19,20].
MDV infections have been reported in various bird orders, primarily in commercial species but also backyard, ornamental, and free-living birds [4,11,12,13,14,15,21,22]. While MDV infections primarily affect Galliformes (chickens, turkeys, quails, pheasants, and partridges), occasional cases have been documented in Anseriformes (ducks, geese, and swans), Columbiformes (pigeons), Falconiformes (kestrels), Gruiformes (cranes), Passeriformes (sparrows), Strigiformes (owls), and peafowl, as well as in the subspecies Gallus gallus bankiva and lafayettii [1,4,23,24,25].
MDV is distributed worldwide. However, in South America, molecular studies are scarce and limited to Brazil and Colombia [7,8,9,10,11,23]. For commercial birds, studies in these countries have mainly focused on layers, revealing the circulation of different strains of MDV with various levels of virulence, including vv+MDV [7,8,9,10]. In one of these studies, selective pressure events and potential routes of MDV introduction to South America in recent years were inferred [8]. Conversely, studies of ornamental and free-living birds are mainly limited to isolated cases in Brazil, where MDV was detected in co-infection with reticuloendotheliosis virus (REV) in backyard chickens [11] and in white peafowl (Pavo cristatus) in a zoo [23].
This study aimed to investigate the prevalence of Marek’s disease virus (MDV) in backyard and ornamental birds from Brazil and Peru. Additionally, we conducted molecular characterization and a selective pressure analysis of the meq oncogene in the detected MDV strains.

2. Materials and Methods

2.1. Clinical Cases and Molecular Detection of Oncogenic Viruses

The present study included a collection of cases of outbreaks involving backyard and ornamental birds affected by MD, with no history of MD vaccination in most cases. Various tissue samples were sent to the Laboratory of Avian Diseases at the School of Veterinary Medicine, University of São Paulo, Brazil (Table 1). These samples were macerated in phosphate-buffered saline (PBS) at pH 7.2 at a 1:1 ratio and subjected to three freezing and thawing cycles at −80 °C and 56 °C. Then, they were centrifuged at 12,000× g for 20 min at 4 °C, and 200 µL of supernatant was collected. Nucleic acid extraction was performed using the BioGene Viral kit (Quibasa - Química Básica Ltda., Belo Horizonte, Brazil). The detection of MDV and the differentiation of vaccine strain CVI988 from field strains were performed by real-time PCR (qPCR) according to previously published conditions [26], using the PowerUp™ SYBR® Green Master Mix (Applied Biosystems, Austin, TX, USA) in a QuantStudio3 Real Time PCR System (Applied Biosystems, Marsiling, Singapore). To verify the presence of other oncogenic viruses, avian leukosis virus (ALV) and reticuloendotheliosis virus (REV) were detected in accordance with previous studies [27]. The first case (USP-386), previously described in [11], was further investigated in this study by sequencing the meq oncogene. The cases are described below.
  • Case 1: A 12-week-old backyard hen from a flock of 40 birds exhibited symptoms of apathy, anorexia, and facial cyanosis. Upon examination, multiple visceral tumors, polyneuritis, splenomegaly, hepatomegaly, and thymic atrophy were observed. The flock experienced a morbidity rate of 50% and a mortality rate of 10%.
  • Case 2: A 3-month-old Indian Giant hen from a flock of 160 birds exhibited symptoms of apathy, anorexia, and paralysis. Upon examination, splenomegaly and hepatomegaly were observed. The flock experienced a mortality rate of 23%, primarily due to sudden deaths.
  • Case 3: A 2-year-old red junglefowl rooster (Gallus gallus bankiva) from a flock of 100 birds exhibited symptoms of apathy, anorexia, and paralysis. Upon examination, splenomegaly, hepatomegaly, and multiple visceral tumors were observed. Each bird in this flock was individually housed. Only two roosters were affected, with morbidity and mortality rates of 2% each.
  • Case 4: A 35-week-old backyard hen was found dead without exhibiting any obvious signs in the preceding days. Upon examination, visceral tumors were observed. The bird had been vaccinated with a dose of HVT on its first day of life. This was the only affected bird in the flock (the total number of birds in the flock was not recorded).
  • Case 5: A 4-year-old female Indian peafowl (Pavo cristatus) exhibited symptoms of apathy, anorexia, paralysis, and facial cyanosis. A complete blood count suggested myelophthisis of lymphoid cells and revealed normocytic, normochromic anemia, along with a leukogram that showed leukocytosis, heterophilia, lymphocytosis, eosinophilia, and monocytosis, with 7% atypical lymphocytes, 5% large lymphocytes, and some heterophils with accentuated toxic granulation. The platelet count was normal. A radiographic examination revealed osteopenia and bone density loss, mainly in the pelvic region. Among the three Indian peafowl housed together, this was the only one that showed clinical signs. The bird died a few days after examination.
  • Case 6: A one-year-old Silkie rooster exhibited neurological symptoms, including altered proprioception and intermittent imbalance. Among the three Silkie chickens housed together, this was the only one that showed clinical signs. The bird made a full recovery two weeks after examination.
  • Case 7: A backyard rooster exhibited symptoms of apathy and paralysis. This was the only affected bird in the flock (the total number of birds in the flock was not recorded). The bird made a full recovery a few weeks after the examination.
Additional information is detailed in Table 1.
Table 1. Epidemiological and clinical information of the studied cases of Marek’s disease.
Table 1. Epidemiological and clinical information of the studied cases of Marek’s disease.
CaseIDHostComon NameYearCity/CountrySampleMD Form
1USP-386Gallus gallus domesticusCreole Hen2010São Paulo/BrazilLiver + SpleenVisceral
2USP-1171Gallus gallus domesticusIndian Giant2018São Paulo/BrazilLiver + Spleen + Sciatic nervesNeural
3USP-1540Gallus gallus bankivaRed Junglefowl2019Lima/PeruSpleen AVisceral
4USP-1790Gallus gallus domesticusCreole Hen2020São Paulo/BrazilLiver + LungsVisceral
5USP-1873Pavo cristatusIndian Peafowl2020São Paulo/BrazilBlood ANeural
6USP-2429Gallus gallus domesticusSilkie Chicken2022São Paulo/BrazilFeathersNeural
7USP-2583Gallus gallus domesticusCreole Hen2022São Paulo/BrazilFeathersNeural
A These samples were collected in FTATM WhatmanTM Classic Cards (GE Healthcare, Buckinghamshire, UK).

2.2. Meq Gene Sequencing

To characterize the detected MDV strains, the meq gene was amplified with primers CCGCACACTGATTCCTAGGC and AGAAACATGGGGCATAGACG, as previously reported [9]. The PCR primers were specifically designed to target the flanking regions of the meq gene. This resulted in the amplification of a 1148 bp product (based on the size of the standard meq isoform of the reference strain Md5, accession number NC_002229), which included the complete 1020 bp meq gene sequence and an additional 128 bp from the upstream and downstream regions. For the L-meq isoform of the reference strain CVI988, accession number DQ530348.1, the expected size was 1325 bp, which included the flanking 128 bp plus the 1197 bp of the meq gene.
PCR amplification was performed using a reaction mix containing 0.2 mM of each dNTP, 2 mM of MgCl2, 0.6 mM of each primer, 0.75 U of PlatinumTM Taq DNA Polymerase, and 1X PCR Buffer (Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania). The thermal conditions included an initial step at 94 °C for 2 min, followed by 36 cycles at 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min, and a final elongation step at 72 °C for 10 min. The amplified bands were purified from a 1.5% agarose gel using an Illustra™ GFX PCR and Gel Band Purification Kit (Cytiva, Marlborough, MA, USA). Sequencing was performed using Sanger technology on a 3500xL Genetic Analyzer with the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA). The electropherograms of the sense and antisense reads were assembled and analyzed using Geneious Prime® 2020.2.4. This program was also used to transcribe the DNA sequences into their deduced amino acids using the standard genetic code to perform polymorphism analysis.

2.3. Phylogenetic Analysis

To carry out the phylogenetic analyses, a set of 381 complete meq sequences previously reported in [8] was analyzed along with the sequences generated in this study (Table S1). The sequences were aligned using the MAFFT program with an iterative refinement method (FFT-NS-i) [28]. The best nucleotide evolutionary substitution model was estimated using ModelTest-NG v0.1.7 [29]. To infer the phylogenetic tree, the maximum likelihood method was applied with the RAxML program and 1000 bootstrap replicates [30]. The generated tree was processed and graphically edited using the iTOL v6 program [31].

2.4. Selection Pressure Analysis

For this analysis, the alignment of the complete meq sequences was used. Initially, positive selection at the gene level was evaluated using the BUSTED method. The FEL, FUBAR, and SLAC methods were subsequently employed to identify codons that underwent pervasive positive or negative selection. Finally, the MEME method was applied to detect codons undergoing positive episodic selection. All these methods were implemented using the Datamonkey 2.0 web platform [32].

3. Results

3.1. Molecular Detection of Oncogenic Viruses

After the molecular assays were performed, the presence of field MDV strains was confirmed in all cases (Table 2). REV was detected in one case (USP-386), while ALV was not detected in any case.
After confirming the presence of MDV in the studied cases, amplification of the meq gene revealed three different sizes: 1148 bp, 1025 bp, and 1325 bp (Figure 1). Two strains (USP-386 and USP-2429) presented sizes of 1148 bp, which correspond to the standard meq isoform (meq, 1020 bp). One strain (USP-1171) presented a size of 1025 bp, which corresponds to the short isoform of meq (S-meq, 897 bp). Three strains (USP-1540, USP-1790, and USP-1873) presented sizes of 1325 bp, which correspond to the long isoform of meq (L-meq, 1197 bp). The USP-2583 strain could not be amplified by end-point PCR, possibly due to the low viral load of the sample (CT > 36). For the CVI988 vaccine strain, two bands were observed, corresponding to the standard and L-meq isoforms.

3.2. Sequence and Phylogenetic Analysis of Meq Gene

The inferred phylogenetic tree revealed the distribution of the MDV sequences into eight clusters (Figure 2). The strains from this study were distributed across three different clusters. The three strains with L-meq isoforms (USP-1540, USP-1790, and USP-1873) were grouped in Cluster C2. The USP-1790 strain was closely related to various virulent strains (BC-1, JM102, 02LAR, 04CRE, FT158, and MPF57) and the attenuated strain 814. The USP-1540 and USP-1873 strains were located near the moderately virulent strain CU-2. The USP-386 strain was placed in Cluster C5, near the virulent strain 571 and close to Brazilian strains detected in commercial chickens (defined as Genotype II by Chacón et al., 2024 [8]). Finally, strains USP-1171 and USP-2429 were positioned in Cluster C7, along with strains from Colombia and an S-meq strain from Japan.
With respect to the amino acid polymorphisms of the meq gene, the three strains of the L-meq form (USP-1540, USP-1790, and USP-1873) presented seven PRRs and shared the polymorphisms 71S, 139T, and 194delP (Table 3). Additionally, the USP-1540 and USP-1873 strains presented the 80D and 115V polymorphisms, while USP-1790 presented the 80V polymorphism and the novel 337E polymorphism. The USP-386 strain (standard meq) presented five PRRs and only the 139T polymorphism. Strains USP-1171 (S-meq) and USP-2429 (standard meq) presented two and three PRRs, respectively, and shared similar polymorphism profiles including 110S, 115V, 139T, 151I, 176A (which eliminates a PRR), and 180A. Additionally, USP-2429 contains the polymorphism 217A and the novel 182D. Regarding PRR sites, one was lost in USP-2429 due to the 217A polymorphism, and three PRR sites were lost in USP-1171 due to the loss of 41 amino acids compared to the standard meq size (339 aa–298 aa). The obtained sequences were submitted to GenBank under the accession numbers PP783759 to PP783764.

3.3. Selection Pressure Analysis

The first analysis was performed with BUSTED, which provided a gene-wide test (not site-specific) to detect positive selection. The result, based on the likelihood ratio test, showed evidence of episodic diversifying selection in the analyzed data (p = 0.0000035).
In the site-specific selective pressure analyses, 18 codons were found to be under positive selection. Among these, thirteen sites were detected to be under pervasive positive pressure (identified by the FEL, FUBAR, and SLAC methods), with nine of these sites (71, 88, 110, 151, 176, 180, 194, 296, and 418) detected by two or three methods (Table 4). Additionally, 14 sites were detected to be under episodic positive pressure (identified by the MEME method).
Fifteen sites were detected to be under pervasive negative pressure (Table 4), with seven of these sites (49, 114, 182, 208, 332, 348, and 377) identified by two or three methods.
Some polymorphisms in the MDV strains studied (Table 3) correspond to those sites under positive pressure. In the BR domain, polymorphisms were found at sites 71 and 80 (in the three strains with L-meq: USP-1540, USP-1790, and USP-1873). In the ZIP domain, polymorphisms were detected at site 110 (in strains USP-1171 and USP-2429). In the TAD domain, polymorphisms were found at sites 139 (in all six strains studied), 151, 176, 180, and 217 (in the USP-1171 and USP-2429 strains), with deletions at site 194 (in USP-1171, USP-1540, USP-1790, and USP-1873). On the other hand, the 182D polymorphism in the USP-2429 strain was found to be under negative pressure.

4. Discussion

Marek’s disease is known to affect a considerable variety of birds, primarily Galliformes. Over the past few decades, numerous reports have demonstrated its ubiquity in commercial birds as well as in backyard and free-living birds. This study investigated a series of MD outbreaks with molecular characterization in backyard and ornamental birds from Brazil and, for the first time, from Peru. MDV has been widely reported in backyard birds [11,12,13,15,33,34]. Other reports include the presence of MDV or antibodies in ornamental birds such as red junglefowl (G. gallus bankiva), Ceylon junglefowl (Gallus lafayettii), Yokohama chickens, Silkie chickens, and Indian peafowl [4,23,25,35,36,37,38,39]. This study provides the first report of MDV in Indian Giant roosters. Moreover, to our knowledge, this is the first time that complete meq sequences of strains detected in some of these birds (red junglefowl, Indian Giant roosters, and Indian peafowl) have been obtained. Molecular and evolutionary studies were conducted to characterize these strains.
The presence of oncogenic viruses has been reported in backyard, ornamental, and free-living birds [1,11,27]. In this study, in addition to MDV, reticuloendotheliosis virus (REV) was detected in only one case, that of a backyard chicken with clinical symptoms of the visceral form of MD. REV is known to be associated with immunosuppression and can aggravate the clinical presentation of MDV when coinfected [40,41]. REV circulation has been reported in Brazil in commercial and backyard chickens as well as Muscovy ducks and wild turkeys [11,42,43,44].
The meq oncogene is known for its length polymorphism, with up to five isoforms reported to date, including the most recent, the S-meq and VS-meq versions [12,15,17,45]. There may even be strains presenting two isoforms simultaneously, as in the case of the vaccine strain CVI988, which was also observed in this study. This phenomenon has been previously reported and is associated with the processes of passaging and attenuation [5,17,18]. In this study, we identified three isoforms, L-meq, standard meq, and S-meq, suggesting considerable diversity among these groups of birds. Traditionally, it has been suggested that larger meq sizes (and greater numbers of PRRs) are associated with lower levels of virulence and pathogenicity [19,20]. However, experimental studies have shown opposing results, indicating the potential contribution of other functions or amino acid polymorphisms of meq [46,47]. In this study, all cases with visceral Marek’s disease (MD) resulted in death and exhibited either the standard or L-meq isoform, with five and seven PRRs, respectively. In contrast, only two of the four cases with neural MD resulted in death, and three of these sequenced neural cases exhibited two, three, and seven PRRs.
Phylogenetic analysis resulted in the distribution of sequences into eight clusters, with the sequences from this study clustered into three groups. Cluster C2 shows significant geographical dispersion, containing strains from various regions across almost all continents. This cluster contains diverse isoforms including standard meq, S-meq, L-meq, and VL-meq [14,20,48]. It also includes strains isolated from Anseriformes and backyard chickens [12,22]. These characteristics contribute to the great diversity within this cluster. Notably, the present study adds a strain detected in red junglefowl from Peru, a strain from backyard chickens in Brazil, and a strain from Indian peafowl from Brazil to this cluster. On the other hand, this study grouped the backyard chicken strain USP-386 (from 2010) in Cluster C5. This is particularly interesting because C5 contains all the strains defined as Genotype II from Brazil that were detected in commercial birds with MD between 2018 and 2022 [8]. These findings suggest a common ancestral relationship and potential links between backyard chickens and commercial birds. Finally, Cluster C7 included strains USP-1171 and USP-2429, which were detected in an Indian giant rooster and a Silkie chicken, respectively. Cluster C7 is characterized by a small number of PRRs (between two and four). In proximity to the strains from this study, Cluster C7 also contained strains from Colombia [9], China [49], and an S-meq strain from Japan [50].
Some meq amino acid polymorphisms have been shown to significantly influence increased virulence, enhanced shedding, and immune escape from vaccines [46]. According to the distribution of polymorphisms, our three strains from C2 with the L-meq isoform presented profiles (71S, 77E, 119C, 153P, 176P, 217P, and 277L) associated with less virulent strains [19,46]. The profile of the USP-386 strain was very similar to that of the previous strains except for 71A. In contrast, the USP-1171 and USP-2429 strains (from C7) presented profiles associated with more virulent strains (71A, 115V, 176A, 180A, 217A, or 217delP).
Selective pressure is an evolutionary mechanism that has been reported in MDV, specifically involving the meq oncogene [8,51]. In this study, we identified several polymorphisms associated with greater virulence that are subject to positive pressure, confirming the findings of previous studies [8,51]. This study also identifies a series of sites subjected to negative pressure. Interestingly, the novel 182D polymorphism detected in the USP-2429 strain from a Silkie chicken is located at a negative pressure site. The roles of some of these sites in processes such as oncogenesis, pathogenicity, and immunological response have been reported [19,49,52,53,54]. The distribution of evolutionary forces along meq codons may suggest important functions during MDV infection, as has been observed in other viruses affecting commercial and wild birds [55,56].
Considering all the results, there is a considerable diversity of MDVs among the cases presented in this study. This diversity can be associated with various sources of origin as previously reported [8,12]. Furthermore, this diversity is reflected in virulence potential, according to the meq amino acid profiles found. However, no direct relationship was observed between the sequences studied and their clinical presentation. There are varying degrees of susceptibility and genetic resistance among different breeds of commercial birds and between different host species [1,4]. Other factors influencing the degree of clinical manifestation include biosecurity measures (which are less strict for backyard and ornamental birds than for commercial birds), coinfection with other pathogens, age of the birds, immune status, lack of vaccination, and environmental factors, among others [18,57].

5. Conclusions

The results of this study demonstrate significant MDV diversity in backyard and ornamental birds, showing both high and low virulence profiles. Monitoring the presence and distribution of MDV in these birds is essential, as they can serve as reservoirs for the virus and potentially trigger new outbreaks. Further research should be conducted to assess the virulence and pathogenicity of these strains in other hosts and bird breeds.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani14192867/s1. Table S1. Accession numbers and additional information of MDV strains used in the phylogenetic analysis.

Author Contributions

Conceptualization, A.J.P.F., T.F.R. and R.D.C.; methodology, R.D.C. and C.J.S.-L.; formal analysis, R.D.C. and C.J.S.-L.; resources, C.S.A.-F., T.F.R. and A.J.P.F.; writing—original draft preparation, R.D.C. and C.J.S.-L.; writing—review and editing, R.D.C., C.J.S.-L., C.S.A.-F., T.F.R. and A.J.P.F.; visualization, R.D.C. and C.J.S.-L.; funding acquisition, C.S.A.-F. and A.J.P.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partly funded by the Conselho Nacional de Pesquisa e Desenvolvimento Tecnológico (CNPq), grant number 301084/2019-0.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Commission on Animal Use of the School of Veterinary Medicine, University of São Paulo (FMVZUSP), under CEUAVET protocol no. 1727010620.

Informed Consent Statement

Not applicable.

Data Availability Statement

The obtained sequences were submitted to GenBank under the accession numbers PP783759 to PP783764.

Acknowledgments

The authors would like to thank Jorge Chacón Sihuay and Vilma Villanueva Aliaga for granting access to their family farm for the collection of some of the studied samples; Maristela Furlan Rocha for providing additional samples; César Hijar (Centrum PUCP) for his contribution in creating graphical elements; and Sarah L. Pajuelo for her work in developing the preliminary database.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nair, V.; Gimeno, I.; Dunn, J.; Zavala, G.; Williams, S.M.; Reece, R.L.; Hafner, S. Neoplastic Diseases. In Diseases of Poultry; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2020; pp. 548–715. ISBN 978-1-119-37119-9. [Google Scholar]
  2. Souci, L.; Denesvre, C. Interactions between Avian Viruses and Skin in Farm Birds. Vet. Res. 2024, 55, 54. [Google Scholar] [CrossRef] [PubMed]
  3. ICTV. Current ICTV Taxonomy Release|ICTV. Available online: https://ictv.global/taxonomy (accessed on 30 July 2024).
  4. Kaleta, E.F.; Docherty, D.E. Avian Herpesviruses. In Infectious Diseases of Wild Birds; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2007; pp. 63–86. ISBN 978-0-470-34466-8. [Google Scholar]
  5. Osterrieder, N.; Kamil, J.P.; Schumacher, D.; Tischer, B.K.; Trapp, S. Marek’s Disease Virus: From Miasma to Model. Nat. Rev. Microbiol. 2006, 4, 283–294. [Google Scholar] [CrossRef] [PubMed]
  6. Witter, R.L.; Calnek, B.W.; Buscaglia, C.; Gimeno, I.M.; Schat, K.A. Classification of Marek’s Disease Viruses According to Pathotype: Philosophy and Methodology. Avian Pathol. 2005, 34, 75–90. [Google Scholar] [CrossRef] [PubMed]
  7. Torres, A.C.D.; Marin, S.Y.; Costa, C.S.; Martins, N.R.S. An Overview on Marek’s Disease Virus Evolution and Evidence for Increased Virulence in Brazil. Braz. J. Poult. Sci. 2019, 21, eRBCA. [Google Scholar] [CrossRef]
  8. Chacón, R.D.; Sánchez-Llatas, C.J.; L Pajuelo, S.; Diaz Forero, A.J.; Jimenez-Vasquez, V.; Médico, J.A.; Soto-Ugaldi, L.F.; Astolfi-Ferreira, C.S.; Piantino Ferreira, A.J. Molecular Characterization of the Meq Oncogene of Marek’s Disease Virus in Vaccinated Brazilian Poultry Farms Reveals Selective Pressure on Prevalent Strains. Vet. Q. 2024, 44, 1–13. [Google Scholar] [CrossRef]
  9. López-Osorio, S.; Piedrahita, D.; Espinal-Restrepo, M.A.; Ramírez-Nieto, G.C.; Nair, V.; Williams, S.M.; Baigent, S.; Ventura-Polite, C.; Aranzazu-Taborda, D.A.; Chaparro-Gutiérrez, J.J. Molecular Characterization of Marek’s Disease Virus in a Poultry Layer Farm from Colombia. Poult. Sci. 2017, 96, 1598–1608. [Google Scholar] [CrossRef]
  10. López-Osorio, S.; Villar, D.; Piedrahita, D.; Ramírez-Nieto, G.; Nair, V.; Baigent, S.; Chaparro-Gutiérrez, J. Molecular Detection of Marek’s Disease Virus in Feather and Blood Samples from Young Laying Hens in Colombia. Acta Virol. 2019, 63, 380–391. [Google Scholar] [CrossRef]
  11. Chacón, R.D.; Astolfi-Ferreira, C.S.; Guimarães, M.B.; Torres, L.N.; De la Torre, D.I.; de Sá, L.R.M.; Piantino Ferreira, A.J. Detection and Molecular Characterization of a Natural Coinfection of Marek’s Disease Virus and Reticuloendotheliosis Virus in Brazilian Backyard Chicken Flock. Vet. Sci. 2019, 6, 92. [Google Scholar] [CrossRef]
  12. Mescolini, G.; Lupini, C.; Felice, V.; Guerrini, A.; Silveira, F.; Cecchinato, M.; Catelli, E. Molecular Characterization of the Meq Gene of Marek’s Disease Viruses Detected in Unvaccinated Backyard Chickens Reveals the Circulation of Low- and High-Virulence Strains. Poult. Sci. 2019, 98, 3130–3137. [Google Scholar] [CrossRef]
  13. Abtin, A.; Molouki, A.; Eshtartabadi, F.; Akhijahani, M.M.; Roohani, K.; Ghalyanchilangeroudi, A.; Lim, S.H.E.; Abdoshah, M.; Shoushtari, A. Phylogenetic Analyses on Marek’s Disease Virus Circulating in Iranian Backyard and Commercial Poultry Indicate Viruses of Different Origin. Braz. J. Microbiol. 2022, 53, 1683–1689. [Google Scholar] [CrossRef]
  14. Mescolini, G.; Lupini, C.; Di Francesco, A.; Davidson, I.; Felice, V.; Bellinati, L.; Cecchinato, M.; Catelli, E. Marek’s Disease in Genetically Susceptible Cochin Chickens in Italy: A Case Report. Vet. Ital. 2022, 58, 117–124. [Google Scholar] [CrossRef]
  15. Molouki, A.; Ghalyanchilangeroudi, A.; Abdoshah, M.; Shoushtari, A.; Abtin, A.; Eshtartabadi, F.; Mahmoudzadeh Akhijahani, M.; Ziafatikafi, Z.; Babaeimarzango, S.S.; Allahyari, E.; et al. Report of a New Meq Gene Size: The First Study on Genetic Characterisation of Marek’s Disease Viruses Circulating in Iranian Commercial Layer and Backyard Chicken. Br. Poult. Sci. 2022, 63, 142–149. [Google Scholar] [CrossRef] [PubMed]
  16. Tulman, E.R.; Afonso, C.L.; Lu, Z.; Zsak, L.; Rock, D.L.; Kutish, G.F. The Genome of a Very Virulent Marek’s Disease Virus. J. Virol. 2000, 74, 7980–7988. [Google Scholar] [CrossRef] [PubMed]
  17. Chang, K.-S.; Ohashi, K.; Onuma, M. Diversity (Polymorphism) of the Meq Gene in the Attenuated Marek’s Disease Virus (MDV) Serotype 1 and MDV-Transformed Cell Lines. J. Vet. Med. Sci. 2002, 64, 1097–1101. [Google Scholar] [CrossRef]
  18. Lee, S.I.; Takagi, M.; Ohashi, K.; Sugimoto, C.; Onuma, M. Difference in the Meq Gene between Oncogenic and Attenuated Strains of Marek’s Disease Virus Serotype 1. J. Vet. Med. Sci. 2000, 62, 287–292. [Google Scholar] [CrossRef]
  19. Shamblin, C.E.; Greene, N.; Arumugaswami, V.; Dienglewicz, R.L.; Parcells, M.S. Comparative Analysis of Marek’s Disease Virus (MDV) Glycoprotein-, Lytic Antigen Pp38- and Transformation Antigen Meq-Encoding Genes: Association of Meq Mutations with MDVs of High Virulence. Vet. Microbiol. 2004, 102, 147–167. [Google Scholar] [CrossRef]
  20. Renz, K.G.; Cooke, J.; Clarke, N.; Cheetham, B.F.; Hussain, Z.; Fakhrul Islam, A.F.M.; Tannock, G.A.; Walkden-Brown, S.W. Pathotyping of Australian Isolates of Marek’s Disease Virus and Association of Pathogenicity with Meq Gene Polymorphism. Avian Pathol. 2012, 41, 161–176. [Google Scholar] [CrossRef]
  21. Murata, S.; Chang, K.-S.; Yamamoto, Y.; Okada, T.; Lee, S.-I.; Konnai, S.; Onuma, M.; Osa, Y.; Asakawa, M.; Ohashi, K. Detection of the Virulent Marek’s Disease Virus Genome from Feather Tips of Wild Geese in Japan and the Far East Region of Russia. Arch. Virol. 2007, 152, 1523–1526. [Google Scholar] [CrossRef]
  22. Murata, S.; Hayashi, Y.; Kato, A.; Isezaki, M.; Takasaki, S.; Onuma, M.; Osa, Y.; Asakawa, M.; Konnai, S.; Ohashi, K. Surveillance of Marek’s Disease Virus in Migratory and Sedentary Birds in Hokkaido, Japan. Vet. J. 2012, 192, 538–540. [Google Scholar] [CrossRef]
  23. Blume, G.R.; Cardoso, S.P.; Oliveira, M.L.B.; Matiolli, M.P.; Gómez, S.Y.M.; Reis Júnior, J.L.; Sant’Ana, F.J.F.; Martins, N.R.S. Visceral Marek’s Disease in White-Peafowl (Pavo Cristatus). Arq. Bras. Med. Vet. Zootec. 2016, 68, 1602–1608. [Google Scholar] [CrossRef]
  24. Lian, X.; Ming, X.; Xu, J.; Cheng, W.; Zhang, X.; Chen, H.; Ding, C.; Jung, Y.-S.; Qian, Y. First Molecular Detection and Characterization of Marek’s Disease Virus in Red-Crowned Cranes (Grus Japonensis): A Case Report. BMC Vet. Res. 2018, 14, 122. [Google Scholar] [CrossRef] [PubMed]
  25. Wilson, L.A.; Lewis, M.; Baigent, S.J.; Abate, V.; Dolega, B.A.; Morrison, L.R.; Poulos, C.; Walker, D. Marek’s Disease in an Indian Peafowl (Pavo Cristatus) with Clinical Ocular Disease and Paraparesis. J. Comp. Pathol. 2022, 195, 7–11. [Google Scholar] [CrossRef] [PubMed]
  26. Gimeno, I.M.; Dunn, J.R.; Cortes, A.L.; El-Gohary, A.E.-G.; Silva, R.F. Detection and Differentiation of CVI988 (Rispens Vaccine) from Other Serotype 1 Marek’s Disease Viruses. Avian Dis. 2014, 58, 232–243. [Google Scholar] [CrossRef] [PubMed]
  27. Gopal, S.; Manoharan, P.; Kathaperumal, K.; Chidambaram, B.; Divya, K.C. Differential Detection of Avian Oncogenic Viruses in Poultry Layer Farms and Turkeys by Use of Multiplex PCR. J. Clin. Microbiol. 2012, 50, 2668–2673. [Google Scholar] [CrossRef] [PubMed]
  28. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  29. Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A New and Scalable Tool for the Selection of DNA and Protein Evolutionary Models. Mol. Biol. Evol. 2020, 37, 291–294. [Google Scholar] [CrossRef]
  30. Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A Fast, Scalable and User-Friendly Tool for Maximum Likelihood Phylogenetic Inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef]
  31. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent Updates to the Phylogenetic Tree Display and Annotation Tool. Nucleic Acids Res. 2024, 52, W78–W82. [Google Scholar] [CrossRef]
  32. Weaver, S.; Shank, S.D.; Spielman, S.J.; Li, M.; Muse, S.V.; Kosakovsky Pond, S.L. Datamonkey 2.0: A Modern Web Application for Characterizing Selective and Other Evolutionary Processes. Mol. Biol. Evol. 2018, 35, 773–777. [Google Scholar] [CrossRef]
  33. Ongor, H.; Timurkaan, N.; Abayli, H.; Karabulut, B.; Kalender, H.; Tonbak, S.; Eroksuz, H.; Çetinkaya, B. First Report of Serotype-1 Marek’s Disease Virus (MDV-1) with Oncogenic Form in Backyard Turkeys in Turkey: A Molecular Analysis Study. BMC Vet. Res. 2022, 18, 30. [Google Scholar] [CrossRef]
  34. Viet Thu, H.T.; Trang, H.N.; Phuoc Chien, N.T.; Ngu, N.T.; Hien, N.D. Occurrence of Marek’s Disease in Backyard Chicken Flocks in Vietnam. Avian Dis. 2022, 66, 230–236. [Google Scholar] [CrossRef] [PubMed]
  35. Weiss, R.A.; Biggs, P.M. Leukosis and Marek’s Disease Viruses of Feral Red Jungle Flow and Domestic Fowl in Malaya. J. Natl. Cancer Inst. 1972, 49, 1713–1725. [Google Scholar] [CrossRef] [PubMed]
  36. Cho, B.R.; Kenzy, S.G. Virologic and Serologic Studies of Zoo Birds for Marek’s Disease Virus Infection. Infect. Immun. 1975, 11, 809–814. [Google Scholar] [CrossRef] [PubMed]
  37. Lin, J.A.; Kitagawa, H.; Ono, M.; Iwanaga, R.; Kodama, H.; Mikami, T. Isolation of Serotype 2 Marek’s Disease Virus from Birds Belonging to Genus Gallus in Japan. Avian Dis. 1990, 34, 336–344. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, L.; Qu, Y.; Wang, T.; Wang, G.; Wang, F.; Liu, S. Skin Involvement in Lymphomas Caused by Marek’s Disease Virus Infection in Silkie Chickens. J. Vet. Diagn. Investig. 2014, 26, 302–307. [Google Scholar] [CrossRef]
  39. Fiddaman, S.R.; Dimopoulos, E.A.; Lebrasseur, O.; du Plessis, L.; Vrancken, B.; Charlton, S.; Haruda, A.F.; Tabbada, K.; Flammer, P.G.; Dascalu, S.; et al. Ancient Chicken Remains Reveal the Origins of Virulence in Marek’s Disease Virus. Science 2023, 382, 1276–1281. [Google Scholar] [CrossRef]
  40. Sun, G.-R.; Zhang, Y.-P.; Zhou, L.-Y.; Lv, H.-C.; Zhang, F.; Li, K.; Gao, Y.-L.; Qi, X.-L.; Cui, H.-Y.; Wang, Y.-Q.; et al. Co-Infection with Marek’s Disease Virus and Reticuloendotheliosis Virus Increases Illness Severity and Reduces Marek’s Disease Vaccine Efficacy. Viruses 2017, 9, 158. [Google Scholar] [CrossRef]
  41. Du, X.; Zhou, D.; Zhou, J.; Xue, J.; Cheng, Z. Marek’s Disease Virus and Reticuloendotheliosis Virus Coinfection Enhances Viral Replication and Alters Cellular Protein Profiles. Front. Vet. Sci. 2022, 9, 854007. [Google Scholar] [CrossRef]
  42. Caleiro, G.S.; Nunes, C.F.; Urbano, P.R.; Kirchgatter, K.; de Araujo, J.; Durigon, E.L.; Thomazelli, L.M.; Stewart, B.M.; Edwards, D.C.; Romano, C.M. Detection of Reticuloendotheliosis Virus in Muscovy Ducks, Wild Turkeys, and Chickens in Brazil. J. Wildl. Dis. 2020, 56, 631–635. [Google Scholar] [CrossRef]
  43. Chacón, R.D.; Astolfi-Ferreira, C.S.; De la Torre, D.I.; de Sá, L.R.M.; Piantino Ferreira, A.J. An Atypical Clinicopathological Manifestation of Fowlpox Virus Associated with Reticuloendotheliosis Virus in Commercial Laying Hen Flocks in Brazil. Transbound. Emerg. Dis. 2020, 67, 2923–2935. [Google Scholar] [CrossRef]
  44. Chacón, R.D.; Sedano-Herrera, B.; Alfaro-Espinoza, E.R.; Quispe, W.U.; Liñan-Torres, A.; De la Torre, D.; de Oliveira, A.; Astolfi-Ferreira, C.S.; Ferreira, A.J.P. Complete Genome Characterization of Reticuloendotheliosis Virus Detected in Chickens with Multiple Viral Coinfections. Viruses 2022, 14, 798. [Google Scholar] [CrossRef]
  45. Motai, Y.; Murata, S.; Sato, J.; Nishi, A.; Maekawa, N.; Okagawa, T.; Konnai, S.; Ohashi, K. Characterization of a Very Short Meq Protein Isoform in a Marek’s Disease Virus Strain in Japan. Vet. Sci. 2024, 11, 43. [Google Scholar] [CrossRef] [PubMed]
  46. Conradie, A.M.; Bertzbach, L.D.; Bhandari, N.; Parcells, M.; Kaufer, B.B. A Common Live-Attenuated Avian Herpesvirus Vaccine Expresses a Very Potent Oncogene. mSphere 2019, 4, e00658-19. [Google Scholar] [CrossRef] [PubMed]
  47. Sato, J.; Murata, S.; Yang, Z.; Kaufer, B.B.; Fujisawa, S.; Seo, H.; Maekawa, N.; Okagawa, T.; Konnai, S.; Osterrieder, N.; et al. Effect of Insertion and Deletion in the Meq Protein Encoded by Highly Oncogenic Marek’s Disease Virus on Transactivation Activity and Virulence. Viruses 2022, 14, 382. [Google Scholar] [CrossRef]
  48. Wajid, S.J.; Katz, M.E.; Renz, K.G.; Walkden-Brown, S.W. Prevalence of Marek’s Disease Virus in Different Chicken Populations in Iraq and Indicative Virulence Based on Sequence Variation in the ecoRI-q (Meq) Gene. Avian Dis. 2013, 57, 562–568. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, Y.-P.; Lv, H.-C.; Bao, K.-Y.; Gao, Y.-L.; Gao, H.-L.; le Qi, X.-; Cui, H.-Y.; Wang, Y.-Q.; Li, K.; Gao, L.; et al. Molecular and Pathogenicity Characterization of Gallid Herpesvirus 2 Newly Isolated in China from 2009 to 2013. Virus Genes 2016, 52, 51–60. [Google Scholar] [CrossRef] [PubMed]
  50. Murata, S.; Hashiguchi, T.; Hayashi, Y.; Yamamoto, Y.; Matsuyama-Kato, A.; Takasaki, S.; Isezaki, M.; Onuma, M.; Konnai, S.; Ohashi, K. Characterization of Meq Proteins from Field Isolates of Marek’s Disease Virus in Japan. Infect. Genet. Evol. 2013, 16, 137–143. [Google Scholar] [CrossRef] [PubMed]
  51. Padhi, A.; Parcells, M.S. Positive Selection Drives Rapid Evolution of the Meq Oncogene of Marek’s Disease Virus. PLoS ONE 2016, 11, e0162180. [Google Scholar] [CrossRef]
  52. Brown, A.C.; Smith, L.P.; Kgosana, L.; Baigent, S.J.; Nair, V.; Allday, M.J. Homodimerization of the Meq Viral Oncoprotein Is Necessary for Induction of T-Cell Lymphoma by Marek’s Disease Virus. J. Virol. 2009, 83, 11142–11151. [Google Scholar] [CrossRef]
  53. Lee, L.F.; Liu, J.-L.; Cui, X.-P.; Kung, H.-J. Marek’s Disease Virus Latent Protein MEQ: Delineation of an Epitope in the BR1 Domain Involved in Nuclear Localization. Virus Genes. 2003, 27, 211–218. [Google Scholar] [CrossRef]
  54. Sun, B.; Wang, Y.; Wang, Z.; Lu, S.; Xia, C. Structural and Immunological Identification and Antiviral Infection Experiment of the Dominant Cytotoxic T Lymphocyte Epitopes of the Oncogenic Marek’s Disease Virus. bioRxiv 2021. [Google Scholar] [CrossRef]
  55. Chacón, J.L.; Chacón, R.D.; Sánchez-Llatas, C.J.; Morín, J.G.; Astolfi-Ferreira, C.S.; Piantino Ferreira, A.J. Antigenic and Molecular Characterization of Isolates of the Brazilian Genotype BR-I (GI-11) of Infectious Bronchitis Virus Supports Its Recognition as BR-I Serotype. Avian Pathol. 2023, 52, 323–338. [Google Scholar] [CrossRef] [PubMed]
  56. Chacón, R.D.; Sánchez-Llatas, C.J.; Diaz Forero, A.J.; Guimarães, M.B.; Pajuelo, S.L.; Astolfi-Ferreira, C.S.; Ferreira, A.J.P. Evolutionary Analysis of a Parrot Bornavirus 2 Detected in a Sulphur-Crested Cockatoo (Cacatua Galerita) Suggests a South American Ancestor. Animals 2023, 14, 47. [Google Scholar] [CrossRef] [PubMed]
  57. Cecchinato, M.; Comin, A.; Bonfanti, L.; Terregino, C.; Monne, I.; Lorenzetto, M.; Marangona, S. Epidemiology and Control of Low Pathogenicity Avian Influenza Infections in Rural Poultry in Italy. Avian Dis. 2011, 55, 13–20. [Google Scholar] [CrossRef]
Animals 14 02867 g001
Figure 1. PCR amplification of the meq gene in the studied cases. Lanes: M (100 bp DNA Ladder, Invitrogen, Carlsbad, CA, USA); 1 (USP-386); 2 (USP-1171); 3 (USP-1540); 4 (USP-1790); 5 (USP-1873); 6 (USP-2429); 7 (USP-2583); 8 (negative control); 9 (positive control, CVI988 vaccine). In lines 1, 6, and 9, a PCR artifact of approximately 600 bp was observed.
Figure 1. PCR amplification of the meq gene in the studied cases. Lanes: M (100 bp DNA Ladder, Invitrogen, Carlsbad, CA, USA); 1 (USP-386); 2 (USP-1171); 3 (USP-1540); 4 (USP-1790); 5 (USP-1873); 6 (USP-2429); 7 (USP-2583); 8 (negative control); 9 (positive control, CVI988 vaccine). In lines 1, 6, and 9, a PCR artifact of approximately 600 bp was observed.
Animals 14 02867 g001
Animals 14 02867 g002
Figure 2. Maximum-likelihood phylogenetic tree of 387 complete meq gene sequences, including six strains from this study. The tree was inferred using a GTR + R substitution model with support values based on 1000 bootstrap replicates indicated on the branches. Additional annotations include phylogenetic cluster (inner ring), isolation country (middle ring), and number of PRRs (outer bars). The MDV strains from this study are highlighted in bold. The scale bar represents the number of substitutions per site.
Figure 2. Maximum-likelihood phylogenetic tree of 387 complete meq gene sequences, including six strains from this study. The tree was inferred using a GTR + R substitution model with support values based on 1000 bootstrap replicates indicated on the branches. Additional annotations include phylogenetic cluster (inner ring), isolation country (middle ring), and number of PRRs (outer bars). The MDV strains from this study are highlighted in bold. The scale bar represents the number of substitutions per site.
Animals 14 02867 g002
Table 2. Molecular detection of oncogenic viruses in the studied cases.
Table 2. Molecular detection of oncogenic viruses in the studied cases.
CaseIDMDVALVREV
1USP-386+−+
2USP-1171+−−
3USP-1540+−−
4USP-1790+−−
5USP-1873+−−
6USP-2429+−−
7USP-2583+−−
Table 3. Molecular characteristics and amino acid substitutions of the meq protein of the studied strains compared with those of the MDV reference strains.
Table 3. Molecular characteristics and amino acid substitutions of the meq protein of the studied strains compared with those of the MDV reference strains.
meq Domain ➔BRZIPTAD
Amino Acid Site A ➔717780110115119139151153176180182194216217277283320326337
StrainPathotypeSize B (aa)PRRs N(N°)AEYCACATPPTEPPPLAITG
814att3987SKD***T*****-*******
CVI988att3987S*D*V*T*****-*****I*
CU-2mMDV3987S*D*V*T*****-*******
BC-1vMDV3987SAD***T*****-*******
FT158vMDV3985SAA***T*****-*A*****
MPF57vMDV3985SAA***T*****-*A*****
02LARvMDV3985SAD***T*****-*A*****
JM/102WvMDV3997**D*V*T******S******
04CREvMDV3985SAD***T*****-*A*****
GAvMDV3395*KD*V*T*************
571vMDV3394******T**H**********
617AvMDV3394****VRT*******A*****
Woodlans1vvMDV3985SAA***T*****-*A*****
Md5vvMDV3394*KD*V*T*******A*VT**
549vvMDV3392*KD*VRT*QAA***A*****
595vvMDV3392*KD*VRT*QAA***A*****
643PvvMDV3392*KD*VRT*QAA***AF****
RB-1BvvMDV3395*KD*V*T*************
Wvv+MDV3394*KD*V*T*******A*VT**
Newvv+MDV3392*KD*VRT*QA****A*VT**
Xvv+MDV3392*KD*VRT*QAA***A*****
648Avv+MDV3392*KD*VRT*QAA***AP****
USP-386 3395******T*************
USP-1171 2982***SV*TI*AA----*****
USP-1540 3987S*D*V*T*****-*******
USP-1790 3987S*V***T*****-******E
USP-1873 3987S*D*V*T*****-*******
USP-2429 3393***SV*TI*AAD**A*****
USP-1015 (G. I) 3383*KD***T*L***-*******
USP-1284 (G. II) 3395******T*************
USP-1328 (G. III) 3394*KD***T*L***********
USP-1879 (G. IV) 3987S*D*V*T*****-*****I*
A Amino acid position according to the 339 aa-standard meq isoform of the strain Md5 (NC_002229). B The size of meq in amino acids does not account for the final codon (stop codon).
Table 4. Sites under positive and negative selection pressure in the meq gene.
Table 4. Sites under positive and negative selection pressure in the meq gene.
Positive SelectionNegative Selection
Codon PositionFUBAR A
Probability α < β		SLAC B
P-[dN/dS > 1]		FEL B
p Value		MEME B
p Value		Codon PositionFUBAR A
Probability α > β		SLAC B
P-[dN/dS < 1]		FEL B
p Value
3 0.00490.9990.001370.0013
710.966 0.04480.0651 0.0311
770.968 55 0.0561
800.952 76 0.0741
880.987 0.02390.0281 0.0932
1010.905 106 0.0922
1100.971 0.08270.071140.923 0.0904
1390.920 135 0.0419
1510.907 0.0849 1820.9660.03430.0329
1760.9990.01770.00130.002080.9700.03700.0176
1800.963 0.05890.08225 0.0778
1940.928 0.07240.092530.9750.03700.0080
203 0.032690.9950.01530.0031
205 0.002980.9970.006910.0009
2170.9950.08780.01180.00333 0.0659
277 0.08
285 0.01
329 0.00
3390.927 0.07140.09
A FUBAR (p > 0.9). B MEME, FEL, SLAC (p < 0.1).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chacón, R.D.; Sánchez-Llatas, C.J.; Astolfi-Ferreira, C.S.; Raso, T.F.; Piantino Ferreira, A.J. Diversity of Marek’s Disease Virus Strains in Infections in Backyard and Ornamental Birds. Animals 2024, 14, 2867. https://doi.org/10.3390/ani14192867

AMA Style

Chacón RD, Sánchez-Llatas CJ, Astolfi-Ferreira CS, Raso TF, Piantino Ferreira AJ. Diversity of Marek’s Disease Virus Strains in Infections in Backyard and Ornamental Birds. Animals. 2024; 14(19):2867. https://doi.org/10.3390/ani14192867

Chicago/Turabian Style

Chacón, Ruy D., Christian J. Sánchez-Llatas, Claudete S. Astolfi-Ferreira, Tânia Freitas Raso, and Antonio J. Piantino Ferreira. 2024. "Diversity of Marek’s Disease Virus Strains in Infections in Backyard and Ornamental Birds" Animals 14, no. 19: 2867. https://doi.org/10.3390/ani14192867

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop