Effects of Alanyl-Glutamine Dipeptide Supplementation on Growth Performance, Nutrient Digestibility, Digestive Enzyme Activity, Immunity, and Antioxidant Status in Growing Laying Hens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Birds and Diets
2.2. Growth Performance
2.3. Digestive Enzyme Activity Assay
2.4. Serum Indices
2.5. Determination of Nutrient Digestibility
2.6. Relative Gene mRNA Expression
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Nutrient Digestibility
3.3. Serum Immunoglobulin and Interleukin Content
3.4. Serum Antioxidant Capacity
3.5. Intestinal Digestive Enzyme Activity
3.6. Relative Gene mRNA Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Beski, S.S.M.; Swick, R.A.; Iji, P.A. Specialized Protein Products in Broiler Chicken Nutrition: A Review. Anim. Nutr. 2015, 1, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Réhault-Godbert, S.; Guyot, N.; Nys, Y. The Golden Egg: Nutritional Value, Bioactivities, and Emerging Benefits for Human Health. Nutrients 2019, 11, 684. [Google Scholar] [CrossRef] [PubMed]
- Lang, W.; Hong, P.; Li, R.; Zhang, H.; Huang, Y.; Zheng, X. Growth Performance and Intestinal Morphology of Hyline Chickens Fed Diets with Different Diet Particle Sizes. J. Anim. Physiol. Anim. Nutr. 2019, 103, 518–524. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Li, P.; Wu, G. Amino Acid Nutrition and Metabolism in Chickens. Adv. Exp. Med. Biol. 2021, 1285, 109–131. [Google Scholar] [CrossRef]
- Hanczakowska, E.; Niwińska, B. Glutamine as a Feed Supplement for Piglets: A Review. Ann. Anim. Sci. 2013, 13, 5–15. [Google Scholar] [CrossRef]
- Xue, G.D.; Barekatain, R.; Wu, S.B.; Choct, M.; Swick, R.A. Dietary L-Glutamine Supplementation Improves Growth Performance, Gut Morphology, and Serum Biochemical Indices of Broiler Chickens during Necrotic Enteritis Challenge. Poult. Sci. 2018, 97, 1334–1341. [Google Scholar] [CrossRef]
- Zhu, J.; Yang, W.; Wang, B.; Liu, Q.; Zhong, X.; Gao, Q.; Liu, J.; Huang, J.; Lin, B.; Tao, Y. Metabolic Engineering of Escherichia Coli for Efficient Production of L-Alanyl-l-Glutamine. Microb. Cell Factories 2020, 19, 129. [Google Scholar] [CrossRef]
- Li, P.; Yin, Y.L.; Li, D.; Kim, W.S.; Wu, G. Amino Acids and Immune Function. Br. J. Nutr. 2007, 98, 237–252. [Google Scholar] [CrossRef]
- Calder, P.C.; Kew, S. The Immune System: A Target for Functional Foods? Br. J. Nutr. 2002, 88, S165–S176. [Google Scholar] [CrossRef]
- Katona, P.; Katona-Apte, J. The Interaction between Nutrition and Infection. Clin. Infect. Dis. 2008, 46, 1582–1588. [Google Scholar] [CrossRef]
- Rhoads, J.M.; Argenzio, R.A.; Chen, W.; Graves, L.M.; Licato, L.L.; Blikslager, A.T.; Smith, J.; Gatzy, J.; Brenner, D.A. Glutamine Metabolism Stimulates Intestinal Cell MAPKs by a CAMP- Inhibitable, Raf-Independent Mechanism. Gastroenterology 2000, 118, 90–100. [Google Scholar] [CrossRef]
- Liu, Y.; Hyde, A.S.; Simpson, M.A.; Barycki, J.J. Emerging Regulatory Paradigms in Glutathione Metabolism, 1st ed.; Elsevier: Amsterdam, The Netherlands, 2014; Volume 122, ISBN 9780124201170. [Google Scholar]
- Kim, M.H.; Kim, H. The Roles of Glutamine in the Intestine and Its Implication in Intestinal Diseases. Int. J. Mol. Sci. 2017, 18, 1051. [Google Scholar] [CrossRef] [PubMed]
- Morales, A.; González, F.; Bernal, H.; Camacho, R.L.; Arce, N.; Vásquez, N.; González-Vega, J.C.; Htoo, J.K.; Viana, M.T.; Cervantes, M. Effect of Arginine Supplementation on the Morphology and Function of Intestinal Epithelia and Serum Concentrations of Amino Acids in Pigs Exposed to Heat Stress. J. Anim. Sci. 2021, 99, skab179. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Lin, G.; Dai, Z.; Zhou, T.; Li, T.; Yuan, T.; Wu, Z.; Wu, G.; Wang, J. L-Glutamine Deprivation Induces Autophagy and Alters the MTOR and MAPK Signaling Pathways in Porcine Intestinal Epithelial Cells. Amino Acids 2015, 47, 2185–2197. [Google Scholar] [CrossRef] [PubMed]
- Ji, F.J.; Wang, L.X.; Yang, H.S.; Hu, A.; Yin, Y.L. Review: The Roles and Functions of Glutamine on Intestinal Health and Performance of Weaning Pigs. Animal 2019, 13, 2727–2735. [Google Scholar] [CrossRef]
- Hy-Line Management Guide 2016. In Management Guide; Hy-line: Wilton, IA, USA, 2016.
- Subcommittee on Poultry Nutrition; Committee on Animal Nutrition; Board on Agriculture; National Research Council. NRC Nutrient Requirements of Poultry; National Academy Press: Washington, DC, USA, 1994; ISBN 0309048923. [Google Scholar]
- Sun, Q.; Yang, H.; Yu, J.; Liang, J.; Xu, X.; Wang, Z. Effect of Dietary Vitamin E on Growth Performance, Immunity and Antioxidant Capacity in Male Jiangnan White Goslings from 1 to 28 d of Age. Agriculture 2022, 12, 83. [Google Scholar] [CrossRef]
- Zhang, L.Y. Feed Analysis and Feed Quality Testing Technology. Ph.D. Thesis, China Agricultural University, Beijing, China, 2007; pp. 48–171. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chen, W.; Xu, J.; Tangara, M.; Peng, J. Effects of in Ovo Injecting Disaccharides and Alanyl-Glutamine Dipeptide on the Energy Status in Duck Embryos and Neonates. Anim. Reprod. Sci. 2010, 122, 29–35. [Google Scholar] [CrossRef]
- Jazideh, F.; Farhoomand, P.; Daneshyar, M.; Najafi, G. The Effects of Dietary Glutamine Supplementation on Growth Performance and Intestinal Morphology of Broiler Chickens Reared under Hot Conditions. Turk. J. Vet. Anim. Sci. 2014, 38, 264–270. [Google Scholar] [CrossRef]
- Leite, J.S.M.; Raizel, R.; Hypólito, T.M.; Dos Santos Rosa, T.; Cruzat, V.F.; Tirapegui, J. L-Glutamine and L-Alanine Supplementation Increase Glutamine-Glutathione Axis and Muscle HSP-27 in Rats Trained Using a Progressive High-Intensity Resistance Exercise. Appl. Physiol. Nutr. Metab. 2016, 41, 842–849. [Google Scholar] [CrossRef]
- Petry, É.R.; Cruzat, V.F.; Heck, T.G.; De Bittencourt, P.I.H.; Tirapegui, J. L-Glutamine Supplementations Enhance Liver Glutamine-Glutathione Axis and Heat Shock Factor-1 Expression in Endurance-Exercise Trained Rats. Int. J. Sport Nutr. Exerc. Metab. 2015, 25, 188–197. [Google Scholar] [CrossRef] [PubMed]
- Coqueiro, A.Y.; Raizel, R.; Bonvini, A.; Hypólito, T.; Godois, A.D.M.; Pereira, J.R.R.; Garcia, A.B.d.O.; Lara, R.D.S.B.; Rogero, M.M.; Tirapegui, J. Effects of Glutamine and Alanine Supplementation on Central Fatigue Markers in Rats Submitted to Resistance Training. Nutrients 2018, 10, 119. [Google Scholar] [CrossRef] [PubMed]
- Stern, R.A.; Mozdziak, P.E. Glutamine Synthetase in Avian Muscle Contributes to a Positive Myogenic Response to Ammonia Compared with Mammalian Muscle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2019, 317, R214–R221. [Google Scholar] [CrossRef]
- Zhang, B.; Zhong, Q.; Liu, N.; Song, P.; Zhu, P.; Zhang, C.; Sun, Z. Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals 2022, 12, 1729. [Google Scholar] [CrossRef] [PubMed]
- Bartell, S.M.; Batal, A.B. The Effect of Supplemental Glutamine on Growth Performance, Development of the Gastrointestinal Tract, and Humoral Immune Response of Broilers. Poult. Sci. 2007, 86, 1940–1947. [Google Scholar] [CrossRef]
- Hu, J.; Ying, H.; Zheng, Y.; Ma, H.; Li, L.; Zhao, Y. Alanyl-Glutamine Protects against Lipopolysaccharide-Induced Liver Injury in Mice via Alleviating Oxidative Stress, Inhibiting Inflammation, and Regulating Autophagy. Antioxidants 2022, 11, 1070. [Google Scholar] [CrossRef]
- Zhang, B.; Lin, M.; Yu, C.; Li, J.; Zhang, L.; Zhou, P.; Yang, W.; Gao, F.; Zhou, G. Alanyl-Glutamine Supplementation Regulates MTOR and Ubiquitin Proteasome Proteolysis Signaling Pathways in Piglets. Nutrition 2016, 32, 1123–1131. [Google Scholar] [CrossRef]
- Tan, B.; Liu, H.; He, G.; Xiao, H.; Xiao, D.; Liu, Y.; Wu, J.; Fang, J.; Yin, Y. Alanyl-Glutamine but Not Glycyl-Glutamine Improved the Proliferation of Enterocytes as Glutamine Substitution In Vitro. Amino Acids 2017, 49, 2023–2031. [Google Scholar] [CrossRef]
- Zou, T.D.; Deng, C.X.; Wang, Z.R.; Ye, Y.L.; You, J.M. Dietary Alanyl-Glutamine Improves Growth Performance of Weaned Piglets through Maintaining Intestinal Morphology and Digestion-Absorption Function. Animal 2019, 13, 1826–1833. [Google Scholar] [CrossRef]
- Zhang, X.; Tan, X.; Liu, Y.; You, W.; Liu, G.; Liu, X.; Jin, Q.; Wei, C.; Wan, F.; Zhao, H. Alanyl-Glutamine Ameliorates Lipopolysaccharide-Induced Inflammation and Barrier Function Injury in Bovine Jejunum Epithelial Cells. Biochem. Cell Biol. 2019, 97, 670–680. [Google Scholar] [CrossRef]
- Beccavin, C.; Chevalier, B.; Cogburn, L.A.; Simon, J.; Duclos, M.J. Insulin-like Growth Factors and Body Growth in Chickens Divergently Selected for High or Low Growth Rate. J. Endocrinol. 2001, 168, 297–306. [Google Scholar] [CrossRef] [PubMed]
- Çekmen, N.; Aydimathn, A.; Erdemli, Ö. The Impact of L-Alanyl-L-Glutamine Dipeptide Supplemented Total Parenteral Nutrition on Clinical Outcome in Critically Patients. e-SPEN 2011, 6, 67–70. [Google Scholar] [CrossRef]
- Wu, Q.J.; Jiao, C.; Liu, Z.H.; Cheng, B.Y.; Liao, J.H.; Zhu, D.D.; Ma, Y.; Li, Y.X.; Li, W. Effect of Glutamine on the Growth Performance, Digestive Enzyme Activity, Absorption Function, and MRNA Expression of Intestinal Transporters in Heat-Stressed Chickens. Res. Vet. Sci. 2021, 134, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Liu, Z.; Li, S.; Jiao, C.; Wang, Y. Effects of Glutamine on Digestive Function and Redox Regulation in the Intestines of Broiler Chickens Challenged with Salmonella Enteritidis. Braz. J. Poult. Sci. 2019, 21, eRBCA-2019. [Google Scholar] [CrossRef]
- Abdulkarimi, R.; Shahir, M.H.; Daneshyar, M. Effects of Dietary Glutamine and Arginine Supplementation on Performance, Intestinal Morphology and Ascites Mortality in Broiler Chickens Reared under Cold Environment. Asian-Australas. J. Anim. Sci. 2019, 32, 110–117. [Google Scholar] [CrossRef]
- Moghaddam, H.N.; Alizadeh-Ghamsari, A.H. Improved Performance and Small Intestinal Development of Broiler Chickens by Dietary L-Glutamine Supplementation. J. Appl. Anim. Res. 2013, 41, 1–7. [Google Scholar] [CrossRef]
- Wu, Q.J.; Zhu, L.L.; Zhang, R.K.; Xing, Z.Y.; Wang, C.; Liao, J.H.; Hu, N.Z.; Cheng, B.Y.; Ma, Y.; Wang, Y.Q. Effect of Glutamine on the Systemic Innate Immune Response in Broiler Chickens Challenged with Salmonella Pullorum. BMC Vet. Res. 2023, 19, 275. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.J.; Zhu, D.D.; Wang, D.D.; Zhang, B.B.; Ren, A.; Zhang, Z. Bin Effects of Dietary Supplementation with Glutamine on the Lymphocyte Proliferation and Intestinal Immune Gene Expression in Broiler Chickens Infected with Salmonella Enteritidis. Res. Vet. Sci. 2021, 139, 18–24. [Google Scholar] [CrossRef]
- Shakeri, M.; Zulkifli, I.; Oskoueian, E.; Shakeri, M.; Oskoueian, A.; Ebrahimi, M. Response to Dietary Supplementation of Glutamine in Broiler Chickens Subjected to Transportation Stress. Istanb. Univ. Vet. Fak. Derg. 2016, 42, 122–131. [Google Scholar] [CrossRef]
- Ding, Z.; Li, W.; Huang, J.; Yi, B.; Xu, Y. Dietary Alanyl-Glutamine and Vitamin E Supplements Could Considerably Promote the Expression of GPx and PPARα Genes, Antioxidation, Feed Utilization, Growth, and Improve Composition of Juvenile Cobia. Aquaculture 2017, 470, 95–102. [Google Scholar] [CrossRef]
- Salmanzadeh, M.; Ebrahimnezhad, Y.; Shahryar, H.A.; Ghaleh-Kandi, J.G. The Effects of in Ovo Feeding of Glutamine in Broiler Breeder Eggs on Hatchability, Development of the Gastrointestinal Tract, Growth Performance and Carcass Characteristics of Broiler Chickens. Arch. Anim. Breed. 2016, 59, 235–242. [Google Scholar] [CrossRef]
- Guo, H.; Xiao, S.; Lou, W.; Khan, R.U.; Wu, J.; Huang, B.; Dai, S.; Li, G. Dietary Supplementation of Glutamine Improves Metabolic Functions in 1–14 Days Old Broilers Under Cold Stress. Pak. J. Zool. 2024, 56, 1433–1438. [Google Scholar] [CrossRef]
Ingredients (%) | A | Addition of Aln-Gln Powder | ||
---|---|---|---|---|
B | C | D | ||
Corn | 66.100 | 66.000 | 66.000 | 65.900 |
Soybean | 29.000 | 29.000 | 28.900 | 28.990 |
Wheat Bran | 0.200 | 0.200 | 0.200 | 0.200 |
Alanyl Glutamine Powder | - | 0.100 | 0.200 | 0.300 |
Met | 0.200 | 0.200 | 0.200 | 0.200 |
Lys | 0.200 | 0.200 | 0.200 | 0.200 |
Salt | 0.300 | 0.300 | 0.300 | 0.300 |
Limestone | 1.300 | 1.300 | 1.300 | 1.300 |
CaHPO3 | 1.700 | 1.700 | 1.700 | 1.700 |
Premix | 1 | 1 | 1 | 1 |
Total | 100 | 100 | 100 | 100 |
ME (MJ/Kg) | 11.98 | 11.98 | 11.98 | 11.98 |
CP % | 18.4 | 18.4 | 18.4 | 18.4 |
Lys Dig. % | 1.126 | 1.126 | 1.126 | 1.126 |
Met Dig. % | 0.47 | 0.47 | 0.47 | 0.47 |
Thr Dig. % | 0.68 | 0.68 | 0.68 | 0.68 |
Trp Dig. % | 0.20 | 0.20 | 0.20 | 0.20 |
Arg Dig. % | 1.22 | 1.22 | 1.22 | 1.22 |
Ile Dig. % | 0.74 | 0.74 | 0.74 | 0.74 |
Val Dig. % | 0.84 | 0.84 | 0.84 | 0.84 |
CF % | 2.78 | 2.78 | 2.78 | 2.78 |
Ca % | 1.078 | 1.078 | 1.078 | 1.078 |
P Av. % | 0.45 | 0.45 | 0.45 | 0.45 |
Na % | 0.023 | 0.023 | 0.023 | 0.023 |
Cl % | 0.041 | 0.041 | 0.041 | 0.041 |
Name | Details | Gene ID | Product Length | Primer |
---|---|---|---|---|
IL1 | interleukin 1 | 100861585 | 136 | F: GGATGGTTCCTCTGCACCTC R: GGGAGCAGAGCGCCTTTATT |
IL2 | interleukin 2 | 395294 | 109 | F: CCGACCGGCTACAATAAGCA R: CGCTGTCATTGGTACATGGC |
IL6 | interleukin 6 receptor | 693252 | 92 | F: CAGCCACGACAAAGATGTGC R: TGAACCTGCGCTTCATCCAT |
IGF-1 | insulin like growth factor 1 | 395889 | 83 | F: GCAGTAGACGCTTACACCACAAGG R: ACAGTACATCTCCAGCCTCCTCAG |
IGFBP-5 | insulin-like growth factor binding protein5 | 424220 | 128 | F: GCGACCGAAAGGGATTCTACAAGAG R: CAGGTCTCCGCTCAGGTAGTCAG |
SOD | superoxide dismutase 1 | 395938 | 73 | F: CTTACCGGACCACACTGCAT R: CCCCTCTACCCAGGTCATCA |
CAT | catalase | 423600 | 142 | F: TGCATCATTGGCCGTACCAT R: ACAACGGTTAGCACTTGGCT |
GSH-Px1 | Glntathione peroxidase | 130713843 | 124 | F: TCACCATGTTCGAGAAGTGC R: ATGTACTGCGGGTTGGTCAT |
β-actin | actin, beta | 396526 | 144 | F: CTACACACGGACACTTCAAG R: ACAAACATGGGGGCATCAG |
Period | Groups | SEM | p-Value | |||
---|---|---|---|---|---|---|
A | B | C | D | |||
Intial BW (g) | ||||||
1 day | 38.72 | 38.80 | 39.01 | 38.74 | 2.331 | 0.821 |
BW (g) | ||||||
2 wk | 117.54 c | 122.66 b | 131.97 a | 134.08 a | 1.240 | 0.021 |
4 wk | 257.50 c | 271.32 b | 286.62 a | 288.31 a | 2.258 | 0.012 |
6 wk | 437.54 c | 481.41 b | 514.58 a | 518.47 a | 5.831 | 0.025 |
ADFI (g/bird/d) | ||||||
0–2 wk | 17.26 | 17.28 | 17.31 | 17.33 | 0.041 | 0.980 |
3–4 wk | 26.31 | 26.57 | 26.66 | 26.78 | 0.046 | 0.593 |
5–6 wk | 37.74 | 37.81 | 38.04 | 38.19 | 0.641 | 0.312 |
0–6 wk | 27.11 | 27.27 | 27.31 | 27.43 | 1.310 | 0.074 |
ADG (g/bird/d) | ||||||
0–2 wk | 5.63 c | 5.99 b | 6.64 a | 6.81 a | 0.875 | 0.010 |
3–4 wk | 7.23 b | 7.86 b | 8.12 a | 8.38 a | 0.079 | 0.021 |
5–6 wk | 10.09 c | 12.24 b | 13.51 a | 13.65 a | 0.258 | 0.005 |
0–6 wk | 9.49 c | 10.54 b | 11.33 a | 11.42 a | 0.138 | 0.017 |
FCR | ||||||
0–2 wk | 3.06 a | 2.88 a | 2.60 b | 2.54 b | 0.039 | 0.019 |
3–4 wk | 3.64 a | 3.38 b | 3.28 c | 3.19 c | 0.331 | 0.032 |
5–6 wk | 3.74 a | 3.08 b | 2.80 c | 2.79 c | 0.678 | 0.013 |
0–6 wk | 2.85 a | 2.58 b | 2.41 c | 2.40 c | 1.173 | 0.041 |
Parameters | Groups | SEM | p-Value | |||
---|---|---|---|---|---|---|
A | B | C | D | |||
Dry matter | 72.35 | 71.51 | 73.16 | 72.87 | 4.24 | 1.060 |
Organic matter | 70.12 | 71.33 | 71.11 | 69.90 | 1.39 | 0.733 |
Crude Protein | 56.10 b | 63.97 a | 62.44 a | 60.01 ab | 0.92 | 0.021 |
Crude Fat | 76.44 | 75.87 | 78.21 | 77.91 | 6.43 | 0.982 |
Gross Energy | 65.11 b | 71.22 a | 69.95 a | 71.90 a | 5.32 | 0.040 |
Parameters | Groups | SEM | p-Value | |||
---|---|---|---|---|---|---|
A | B | C | D | |||
CAT (U/mL) | 1.20 | 1.25 | 1.21 | 1.27 | 0.01 | 0.268 |
MDA (nmol/mL) | 3.11 | 3.23 | 3.19 | 3.17 | 0.39 | 0.103 |
GSH-Px (U/mL) | 210.40 | 212.01 | 213.48 | 209.91 | 0.21 | 0.090 |
GSH (U/mL) | 6.78 | 6.68 | 6.59 | 6.67 | 0.24 | 0.981 |
SOD (U/mL) | 271.33 | 272.42 | 269.65 | 270.20 | 9.80 | 0.271 |
Items | Groups | SEM | p-Value | |||
---|---|---|---|---|---|---|
A | B | C | D | |||
Trypsin activity (U/mg prot) | 615.04 c | 633.89 b | 649.05 a | 644.54 ab | 17.40 | 0.020 |
Chymotrypsin activity (U/mg prot) | 2.27 b | 3.51 a | 3.39 a | 3.42 a | 0.95 | 0.031 |
Lipase Actvity (U/mg prot) | 4.78 | 4.81 | 4.58 | 4.27 | 1.23 | 0.446 |
Amylase Activity (U/mg prot) | 0.21 | 0.19 | 0.23 | 0.18 | 0.01 | 1.347 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nazir, U.; Fu, Z.; Zheng, X.; Zafar, M.H.; Chen, Y.; Yang, Z.; Wang, Z.; Yang, H. Effects of Alanyl-Glutamine Dipeptide Supplementation on Growth Performance, Nutrient Digestibility, Digestive Enzyme Activity, Immunity, and Antioxidant Status in Growing Laying Hens. Animals 2024, 14, 2934. https://doi.org/10.3390/ani14202934
Nazir U, Fu Z, Zheng X, Zafar MH, Chen Y, Yang Z, Wang Z, Yang H. Effects of Alanyl-Glutamine Dipeptide Supplementation on Growth Performance, Nutrient Digestibility, Digestive Enzyme Activity, Immunity, and Antioxidant Status in Growing Laying Hens. Animals. 2024; 14(20):2934. https://doi.org/10.3390/ani14202934
Chicago/Turabian StyleNazir, Usman, Zhenming Fu, Xucheng Zheng, Muhammad Hammad Zafar, Yuanjing Chen, Zhi Yang, Zhiyue Wang, and Haiming Yang. 2024. "Effects of Alanyl-Glutamine Dipeptide Supplementation on Growth Performance, Nutrient Digestibility, Digestive Enzyme Activity, Immunity, and Antioxidant Status in Growing Laying Hens" Animals 14, no. 20: 2934. https://doi.org/10.3390/ani14202934
APA StyleNazir, U., Fu, Z., Zheng, X., Zafar, M. H., Chen, Y., Yang, Z., Wang, Z., & Yang, H. (2024). Effects of Alanyl-Glutamine Dipeptide Supplementation on Growth Performance, Nutrient Digestibility, Digestive Enzyme Activity, Immunity, and Antioxidant Status in Growing Laying Hens. Animals, 14(20), 2934. https://doi.org/10.3390/ani14202934