Next Article in Journal
The Optimal Dietary Sodium or Chloride Level of Broilers Fed a Corn–Soybean Meal Diet from 22 to 42 Days of Age
Previous Article in Journal
Systematic Review and Meta-Analysis of Thermal Stress Assessment in Poultry Using Infrared Thermography in Specific Body Areas
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 22
10.3390/ani14223172
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Investigation of Virulence Genes of Staphylococcus aureus in Autologous Vaccines Against Sheep Mastitis

by
Erminia Sezzi
1,
Rita Fanelli
1,
Deborah Gobbi
1,
Paolo Scandurra
2,
Valerio Mannucci
2,
Isabella Usai
2,
Giovanni Ragionieri
2,
Ziad Mezher
2 and
Gianluca Fichi
2,*
1
Istituto Zooprofilattico Sperimentale del Lazio e della Toscana M. Aleandri, UOT Lazio Nord, Strada Terme 4/a, 01100 Viterbo, Italy
2
Istituto Zooprofilattico Sperimentale del Lazio e della Toscana M. Aleandri, UOT Toscana Sud, Via Toselli 12, 53100 Siena, Italy
*
Author to whom correspondence should be addressed.
Animals 2024, 14(22), 3172; https://doi.org/10.3390/ani14223172
Submission received: 30 September 2024 / Revised: 3 November 2024 / Accepted: 5 November 2024 / Published: 6 November 2024
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Simple Summary

Staphylococcus aureus is a human and animal pathogen that can cause severe mastitis in sheep. The severity of this disease is influenced by several factors, among which the presence of virulence genes in the bacterium. In the present study, 110 strains, isolated from the milk of sheep with clinical mastitis south of Tuscany, Italy, and with subclinical mastitis in a farm in the same region, were investigated for enterotoxin and hemolysin genes’ presence through molecular analysis. The distribution of the profiles on this territory was analyzed. Twenty different profiles were found, but 43.64% of the tested strains showed the same profile. Considering the enterotoxin genes, four profiles were identified while using hemolysin genes’ presence, 12 genes patterns were found. Several different strains were detected in the farm with subclinical mastitis. Spatial analysis of the overall isolated strains did not show a specific distribution. However, the study highlights the importance of identifying and analyzing virulence genes of this bacterium involved in dairy sheep mastitis, and the presence of different strains in the same farm.

Abstract

Staphylococcus aureus is well known to be the primary causal agent of clinical or subclinical mastitis in dairy sheep. The production of virulence factors allows S. aureus strains to cause mastitis. In the present study, 96 strains isolated from dairy sheep farms used for the production of autologous vaccines were tested for enterotoxin and hemolysin genes by PCR. In addition, 14 strains isolated from half udders of ewes with subclinical mastitis belonging to a single farm were also tested for the same genes. The phylogenetic trees were constructed, and spatial analysis was performed. Overall, 20 gene patterns were identified, but 43.64% of the tested strains showed the same profile (sec+, sel+, hla+, hld+, hlgAC+). Considering only the enterotoxin genes, four profiles were identified while the evaluation of the hemolysin genes revealed the presence of 12 gene patterns. In the farm with subclinical mastitis, six gene profiles were found. Spatial analysis of the isolated strains and their virulence genes did not show a specific pattern. The present study highlights the importance of identifying and analyzing virulence genes of S. aureus strains involved in dairy sheep mastitis, and the presence of different strains in the same farm.

1. Introduction

Staphylococci are a major cause of clinical or subclinical mastitis in dairy sheep, and among them Staphylococcus aureus is well known to be the primary causal agent [1,2].
In small ruminants, especially sheep, S. aureus often causes severe mastitis, and it is the principal cause of gangrenous mastitis [3]. For this reason, small ruminants are often vaccinated against S. aureus with commercial vaccines, but in some countries, autologous vaccines are also used [4]. However, S. aureus can also cause subclinical mastitis in sheep, resulting in long-term infection that can evolve into chronic forms, with the consequent loss of milk production [5].
The severity of staphylococcal infections depends on the relationship between the host’s defense abilities and the strain’s virulence [6]. The production of virulence factors, such as toxins, antigens, and resistance proteins, allows S. aureus strains to cause mastitis [7].
Many virulence factors that allow the bacterium to adapt to the mammary gland environment [8] have been described in S. aureus (Table 1), and several of them have been identified in ruminant mastitis [8,9,10]. These virulence factors include more than 40 known exotoxins that can be classified into three groups based on their known functions: cytotoxins, superantigens, and cytotoxic enzymes [11]. After the adhesion phase, S. aureus produces hemolysins and exoenzyme exotoxins that allow the invasion and destruction of the mammary tissue, with the degradation of the epithelium of the cistern, duct, and alveoli [10].
Most of the staphylococcal enterotoxins (SEA, SEB, SECn, SED, SEE, and SEH) belong to staphylococcal pyrogenic exotoxin (PTSAgs) [9]. They have the ability to inhibit host immune responses to S. aureus [9], but SAgs were originally termed staphylococcal enterotoxins (SEs) for their ability to cause typical symptoms of S. aureus food poisoning, such as vomiting and diarrhea [15]. The α-, β-, γ-, and δ-hemolysins are identified as important virulence factors, produced respectively by hla, hlb, hlg and hld genes, which allow S. aureus to escape the host immune response and the invasion of the mammary tissue [28,29]. They create pores in host cell membranes or dissolve cell wall components, lysing erythrocytes [30]. Among them, α-hemolysin is considered one of the main pathogenicity factors of S. aureus with hemolytic, dermonecrotic, and neurotoxic effects [28]. All these genes can be used to characterize S. aureus strains. Numerous studies investigated virulence factors in bovine mastitis [31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46] and some of them also explored their geographical variability [8,47,48]. In contrast, the presence of S. aureus virulence genes has been less investigated in small ruminants [5,7,49,50,51,52,53], and the studies on their geographical distribution are rare [49].
From an epidemiological point of view, investigating the virulence factors’ profiles of S. aureus isolates involved in the etiology of mastitis is highly relevant, provided that the distribution of the bacterial strains in a given territory is constantly monitored [48]. In parallel, conducting such investigations on isolated S. aureus strains from sheep herds with mastitis could provide relevant information for the development of vaccines [10].
The principal aim of the present study was to characterize S. aureus strains, collected during sheep mastitis episodes in a defined territory and used to produce autologous vaccines, by investigating the toxins’ patterns and their geographical distribution to deepen the knowledge on the circulating genetic lineages among the sheep population with mastitis. A second aim was the characterization of strains isolated from a sheep herd with confirmed subclinical mastitis due to S. aureus to investigate the toxins’ patterns of this bacterium.

2. Materials and Methods

2.1. S. aureus Strains

This study was carried out on 96 strains of S. aureus conserved at −80 °C in the microbank of the Laboratory for vaccine production of Istituto Zooprofilattico Sperimentale del Lazio e della Toscana M. Aleandri, Siena, Tuscany, Italy. The strains were isolated in sheep mastitis outbreaks of herds in Grosseto and Siena provinces, Tuscany, Italy and used to produce autologous vaccines. In addition to the 96 strains, 14 strains of S. aureus, isolated in 2022 from half udders of ewes with subclinical mastitis in a single farm in Grosseto province, during a S. aureus eradication program, were conserved under the same condition and included in the study. The strains were revitalized in brain heart infusion broth (BHI) overnight at 37 °C and tested for vitality and pureness on sheep blood agar after incubation at 37 °C for 24 h. Three ATCC strains of S. aureus, 23235, 19095, 70699, were used as positive control, while the ATCC 12228 of S. epidermidis was used as negative control.

2.2. Strains Isolation and Identification

The S. aureus strains were isolated between 2019 and 2023 from milk samples of sheep with clinical mastitis (Table S1), namely udder or milk alterations. Isolation was conducted by of the Veterinary Diagnostic laboratories located in Grosseto and Siena of the Istituto Zooprofilattico Sperimentale del Lazio e della Toscana M. Aleandri, following standard procedures [54]. Briefly, ten microliters of milk sample were plated onto blood agar medium through a sterilized loop and incubated at 37 °C under aerobic conditions. After 24 h, developed bacterial colonies were examined for taxonomical analyses. For this purpose, bacterial colonies morphologically characteristic for S. aureus on blood agar plates were plated on Baird Parker Agar Base + RPF (BP+RPF) and tested for catalase. Catalase-positive colonies with typical opacity halo on BP+RPF medium were biochemically identified at species level as S. aureus using API 20 STAPH micro-method galleries (BioMereux, Craponne, France).

2.3. DNA Extraction and Genes Amplification

To confirm the S. aureus identification, all isolates were screened by polymerase chain reaction (PCR) for the 23S, coagulase gene (coa), and nuc genes. DNA was extracted using the QIAamp DNA Mini kit following the instruction provided by the manufacturer. Briefly, a colony picked up from culture plate with an inoculation loop was suspended in 180 µL of buffer ATL (supplied in the kit). The extraction continued with the protocol for isolation of genomic DNA from Gram-positive bacteria, which involves three incubations at 37 °C (30 min), 56 °C (30 min), and 95 °C (15 min). Purification and elution followed the protocol for DNA purification from tissue. DNA of the reference samples was isolated from reference bacterial strains (ATCC 19095, ATCC 23235, ATCC 700699—Staphylococcus aureus, ATCC 12228 Staphylococcus epidermidis) following the same instruction. The genes investigated were the staphylococcal enterotoxin producing genes (sea, sec, sed, seg, seh, sei, and sej) and hemolysin genes (hla, hlb, hld, and hlgAC).
Extracted DNA was amplified using one multiplex PCR end point; each reaction contained 25 μL of Qiagen Multiplex Master Mix (Qiagen, Hilden, Germany), 1 μL of each primer (except the pair Sei where 1.5 μL) at 20 pmol/μL concentration and 1 μL of DNA template in 50 μL of total volume (Table 2). Thermal cycling was performed in a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). For 23S, CoA, nuc and enterotoxin genes, thermal cycling consisted of an initial 15 min denaturation step at 95 °C, 30 cycles of 30 s at 94 °C, 1:30 min at the annealing temperature 57 °C, and 1:30 min extension step at 72 °C followed by 10:00 min at 72 °C [55]. For hla and hld genes, there was an initial denaturation step at 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 59°C for 60 s, and 72 °C for 1 min, and a final extension step at 72 °C for 10 min, and for hlb an initial same step of denaturation followed by 45 cycles of 94 °C for 30 s, 65 °C for 30 s, and 72 °C for 30 s and same step of extension [56]. The hlgAC gene was amplified with a thermal cycling consisting of an initial 5 min denaturation step at 94 °C, 35 cycles of 30 s at 94.8 °C, 30 s at the annealing temperature 49.7 °C, a 1:30 min extension step at 72 °C followed by 7 min at 72 °C [42]. The three ATCC strains of S. aureus were used as positive control while the ATCC strain of S. epidermidis was used as negative control during PCR amplification of the investigated virulence factors.
The amplified PCR products were visualized by standard gel electrophoresis in a 4% agarose (Nippon Genetics, Düren, Germany) gel stained with nucleic acid gel stain (Midori Green Advance DNA stain) and molecular size marker (50 bp, Nippon Genetics).

2.4. Phylogenetic Analysis

Virulence gene profiles were analyzed as binary data [46] using the maximum likelihood method [58] by the Kimura 2-parameter model with 1000 bootstrap replicates by MEGA software (Version 11).

2.5. Spatial and Statistical Analysis

Excel spreadsheets (Version 2409 Excel® Microsoft®, 2016) were used to create a dataset, which included all the relevant information about the investigated strains. Simple descriptive statistical analysis was performed by calculating the frequencies and confidence intervals of the strains’ profiles and relative virulence genes. The geographic information system software QGIS (Version 3.24.1) was used to create the distribution maps.

3. Results

All the analyzed strains tested positive for the 23S gene, and coa and nuc genes, confirming the S. aureus identification. Regarding the enterotoxin genes, the presence of sea, sed, and sej genes was not detected in any strain (Table 3). The sec and sel genes were detected in 74.55% of analyzed strains (82 strains), while seg, seh, and sei genes were observed in only one strain (0.91% of prevalence). The hld hemolysin gene was observed in 89.09% of the strains (98 strains), followed by hlgAC with a prevalence of 87.27% (96 strains), and hla 81.82% (90 strains). Only the 15.45% of the strains tested positive for the hlb gene.
Considering all the 110 strains analyzed, 20 virulent gene profiles were found (SA1-SA20) (Table 4). The most common profiles were SA16 (sec+, sel+, hla+, hld+, hlgAC+) with a prevalence of 43.64 % and SA4 (hla+, hld+, hlgAC+) with a prevalence of 17.27%.
The phylogenetic analysis evidenced that SA1, SA2, SA5, SA10, SA11, SA12, SA15, SA16, SA17, SA18, and SA19 clustered together (Figure 1). The ATCC strains (ATCC 23235, 700699, 19095 called respectively SA ATCC21, SA ATCC22, SA ATCC23) clustered with SA3, SA4, SA6, and SA20, while the last strains SA7, SA8, SA9, SA13 and SA14 clustered together.
When only the enterotoxin genes were considered, four profiles were observed (SAET1-SAET4) (Table 5), but SAET 2 (sec+, sej+) and SAET1 (no virulence genes) were the most frequent profiles with a prevalence of 74.55% and 23.64%, respectively, while just one sample resulted for the profile SAET3 (seh+) and SAET4 (seg+, sei+).
The four enterotoxin gene profiles clustered with SA ATCC21, while the SA ATCC22, SA ATCC23 clustered together (Figure 2).
The analysis of the hemolysin genes revealed 12 profiles (Table 6). Most of the profiles clustered in the same group while SAEM10 clustered with ATCC SA22 and ATCC SA23 and SAEM12 clustered with ATCC SA21 (Figure 3). The most representative profile (60.91% of the strains) was SAEM10 (hla+, hld+, hlgAC+).
The 14 strains of S. aureus, isolated from half udders of ewes with subclinical mastitis at the same farm during a S. aureus eradication program, corresponded to six different virulence gene profiles (SA 7, SA9, SA 10, SA11, SA16, SA17). In this case, the most identified profile was SA16 (46.82%), followed by SA10 (21.43%) and SA11 (14.29%) (Table 6). The enterotoxin gene profiles were the same for all isolated strains (SAET 2: sec+, sel+), but not for the hemolysin genes that showed six profiles: SAEM 1 (no hemolysin genes), SAEM3 (hlb+), SAEM4 (hlgAC+), SAEM5 (hlgAC+, hld+), SAEM 10 (hla+, hlgAC+, hld+), and SAEM 11 (hla+, hlb+, hlgAC+). The frequency of the profiles was the same as the corresponding profiles when all genes were considered (Table 7). Not all profiles clustered together (Figure 1 and Figure 3).
The isolated strains were collected from ewes reared in 86 dairy sheep farms located in the provinces of Siena (36/86; 41.86%) and Grosseto (50/86; 58.14%) in central Italy (Figure 4). These provinces are located in the southern part of the region of Tuscany, which is considered the fourth Italian region in terms of dairy sheep herds (219.424; 6.95%) after Sardinia, Sicily, and Lazio (data retrieved from the national farms’ registry). In Tuscany, dairy sheep farming is mainly concentrated in these two provinces (171.105; 77.97%) because of the land’s suitability for extensive sheep farming.
Spatial distribution of the gene profiles and hemolysin gene profiles did not show the presence of specific patterns but only reflected the frequency of the various profiles within each province (Figure 5, Figure 6 and Figure 7).

4. Discussion

Very few studies have investigated the virulence gene profiles of S. aureus in sheep mastitis and its distribution in a geographic area. Considering the possible severity of this udder infection in sheep and the use of commercial and autologous vaccines, more study will be recommended. In the present study, enterotoxin and hemolysin genes were investigated in 96 strains, isolated in clinical mastitis, and distributed in a specific area, and 14 strains were isolated during an eradication program in sheep subclinical mastitis.
There is no consensus on analysis of virulence genes of S. aureus to investigate the relationship with clinical mastitis in cattle. Several studies suggested that enterotoxin genes act as virulence genes and they were used to classify some strains isolated in bovine subclinical mastitis and to correlate them with clinical observation [32,35,36]. The presence of S. aureus, which produces these toxins in the milk, can also have severe consequences for human health because these toxins remain stable in milk, causing food poisoning in humans [5].
Using RS–PCR genotyping of the 16S–23S rRNA intergenic spacer region, Fournier and collaborators associated some genotypes with the presence of some enterotoxin genes [35]. Particularly, genotype B (GTB) was characterized by the presence of the sea, sed, and sej genes, and genotype C (GTC) by sec and seg. The remainder were grouped as other genotypes (GTOG) because they were rarely found [35]. In our study, no profiles corresponded to GTB or GTC. The 74.55% of our strains had sec and sel gene profiles, but no sed gene was detected, and one strain showed the seg gene but in association with sei. However, in the literature, some studies on bovine mastitis found seg and sej genes as the most frequent genes in S. aureus [59] while others found sed, seg, and sei [60], or sea, as in a study on 238 S. aureus isolates from cow milk in two China regions [59]. The comparison with enterotoxin gen’ profiles in sheep is very difficult because the same genes were not amplified in the few studies published in literature. In a study on S. aureus isolated from bulk-tank milk samples of goat and sheep, the only gene in the strains isolated in 30 ewes’ milk was sec [53]. Strains positive for seg and sei genes’ presence were found in 18 goat milk samples, while no strain positive for sec and sej was found [53]. In another study on 20 S. aureus isolated from sheep milk samples with subclinical mastitis, sea and seb were observed in combination in three strains, sea and sec in one strain, and sec alone in another strain, but only sea, seb, sec, and sed enterotoxin genes were amplified [5]. A study conducted in Italy evidenced the combination of seb and sec as the most isolated genetic profile in S. aureus from sheep milk in Italy, but sec was the most frequent gene [61], as it was in a study of sheep milk in Algeria [62]. Another study conducted in Greece confirmed the sec profile as the most frequent in S. aureus strains from sheep milk, and a seg- and sej- positive profile was found in two strains [7]. In a study in Turkey, sell had the highest frequency in sheep milk S. aureus strains, followed by sec, and the sec and sell profile was the unique combination found [50]; additionally, sec and sel were the most detected genes in Switzerland [63].
Few studies investigated hemolysin genes in S. aureus strains isolated from mastitis milk of dairy species and there is no consensus on the genes found in the strains, as for enterotoxin genes. Aslantaş et al. (2022) [50] observed a frequency of hla, hlb, hld, and hlg2 of 100, 95.2, 98.4, and 61.3%, respectively, in strains obtained from mastitic sheep milk. In another study on S. aureus strains from bovine and goat milk, the frequencies of hla and hlb were lower in goat strains (hla 51.85%, hlb 48.15%) respect to bovine strains (hla 95.93%, hlb 93.50%) [49]. In contrast, Moraveij et al. (2014) reported the presence of hlb only in one of 20 isolates of S. aureus from bovine mastitis milk, while the majority of the strains showed hla and hld, and no strains had the hlg gene [64]. In a study on 229 bovine S. aureus isolates in Belgium hla, hlb, hld, and hlg showed respectively a frequency of 98.7, 99.1, 100.0, and 78.6% [42]. In our study, the frequency of hla, hld, and hlgAC was 81.82, 89.09, and 87.27%, respectively, while the hlb gene was found with a lower frequency (15.45%). In contrast, a study conducted in Italy on strains from mastitis sheep milk found a higher frequency of hlb-positive strains (34.9%) and a lower frequency of hlg (2.7%) [61]. However, we observed a greater variability of the frequency of hemolysin genes in S. aureus strains than enterotoxin genes, with 12 and 4 different profiles, respectively. Particularly, in the farm with subclinical mastitis, all the strains showed the same profiles for enterotoxin genes, while six hemolysin gene profiles were observed. The diversity of toxin profiles of strains that cause mastitis is the major obstacle in the development of an effective vaccine [10], and the presence of several strains in the same farm could be a further obstacle.
In human isolates, it has been observed that the prevalence of hemolysin genes in multiple antibiotic-resistant strains was higher than in susceptible strains [65]. For this reason, the identification of isolates with hemolytic genes in mastitis milk samples could have a great importance [65]. However, the level of expression of genes during S. aureus infection is reported to be profoundly different from that of in vitro study [10], and the presence of virulence genes does not always correspond with the toxins’ expression [29]. We found high prevalence of hla, hld, and hlgAC, but further studies should be conducted to investigate the expression of these hemolysin genes during sheep S. aureus mastitis to understand their role in this disease.
It is also important to implement the spatial analysis of gene profiles to identify specific trends and geographical patterns over time. In this study, no specific trend or pattern was detected but profiles were apparently randomly distributed. This might be due to the small number of the analyzed strains in contrast with the prevalence of staphylococcal sheep mastitis or to the considered genes in the present study. However, in a previous study on spatial distribution of the virulence profiles of S. aureus strains isolated from cow and goat milk samples in three different geographical regions of the state Pernambuco, Brazil, no pattern in the frequency was observed by geographical area [49].
Therefore, the collection and analysis of further strains is encouraged to reach an adequate level of representativeness of the dairy sheep population in Tuscany, while the increase of the number of amplified genes could identify different profiles with a spatial pattern.
The antibiotic treatment of small ruminant mastitis is widely spread [66]. This has led to the development of bacterial resistance, and the presence of methicillin-resistant S. aureus (MRSA) strains in animals with the possibility of transferring resistance genes to human strains is an emerging problem [10]. In addition, the use of antibiotics for treating mastitis can lead to residues in milk with risks for human health [66]. The prevention of S. aureus mastitis through vaccination could be a valid alternative to antibiotic treatment [10]. However, the development of a vaccine against S. aureus is a challenge because of its complex pathogenesis, which involves numerous virulence factors [67]. The best vaccine should have an array of virulence factors [68]. The commercially available vaccines against S. aureus mastitis are unable to provide a complete protection [66], for this reason, autologous vaccines, which contain whole bacterial cells, are commonly used in dairy ruminant species [69], and some studies showed the benefit of the use of these vaccines in cow herds [69]. The autologous vaccine is often used in combination with commercial vaccines, especially in those cases where the latter did not provide sufficient protection against S. aureus and a consequent outbreak in the herd has occurred. The study of virulence factors of the strains used to produce these autologous vaccines, as in our study, could help to identify the virulence factors involved in this economically important disease and to develop an effective vaccine for this species. In the present study, the presence of staphylococcal enterotoxins and hemolysins was investigated, but the number of possible virulence factors involved in mastitis is higher and further study should be conducted to extend the number of investigated genes in the studied strains. However, most of the autologous vaccines are produced using a single clonal type of bacteria isolated from farms [70]. In contrast, we evidenced that more than one strain of S. aureus could be present on the same farm. The investigation of this aspect could help to make autologous vaccines more effective.

5. Conclusions

Considering the production of autologous vaccines from strains isolated by small ruminant mastitis in several countries, the study of virulence genes in these strains could help to develop a more efficient vaccine against S. aureus mastitis. In addition, six different hemolysin gene profiles were observed on the same farm with subclinical mastitis. This highlights the importance of testing the entire herd in cases of mastitis due to S. aureus because of the potential concomitant presence of several strains with different virulence characteristics and antibiotic susceptibilities.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani14223172/s1, Table S1. Staphylococcus aures stains isolated from sheep mastitis milk used in the manuscript: coordinates of the place, date of isolation, and the virulence genes’ presence (present: +, assent: −).

Author Contributions

Conceptualization, E.S. and G.F.; methodology, E.S., G.F. and Z.M.; software, Z.M.; validation, G.R., E.S. and G.F.; investigation, P.S., R.F., D.G., V.M. and I.U.; data curation, Z.M.; writing—original draft preparation, E.S. and G.F.; writing—review and editing, Z.M.; visualization, G.R.; supervision, G.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable for this study. The milk samples were collected and brought to the laboratories by clinical veterinarians for routine diagnostic tests.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Vasileiou, N.G.C.; Chatzopoulos, D.C.; Gougoulis, D.A.; Sarrou, S.; Katsafadou, A.I.; Spyrou, V.; Mavrogianni, V.S.; Petinaki, E.; Fthenakis, G.C. Slime-Producing Staphylococci as Causal Agents of Subclinical Mastitis in Sheep. Vet. Microbiol. 2018, 224, 93–99. [Google Scholar] [CrossRef] [PubMed]
  2. Vasileiou, N.G.C.; Chatzopoulos, D.C.; Sarrou, S.; Fragkou, I.A.; Katsafadou, A.I.; Mavrogianni, V.S.; Petinaki, E.; Fthenakis, G.C. Role of Staphylococci in Mastitis in Sheep. J. Dairy Res. 2019, 86, 254–266. [Google Scholar] [CrossRef] [PubMed]
  3. Mørk, T.; Waage, S.; Tollersrud, T.; Kvitle, B.; Sviland, S. Clinical Mastitis in Ewes; Bacteriology, Epidemiology and Clinical Features. Acta Vet. Scand. 2007, 49, 23. [Google Scholar] [CrossRef] [PubMed]
  4. Vasileiou, N.G.C.; Lianou, D.T.; Michael, C.K.; Fthenakis, G.C.; Mavrogianni, V.S. Vaccination against Bacterial Mastitis in Sheep. Vaccines 2022, 10, 2088. [Google Scholar] [CrossRef] [PubMed]
  5. Martins, K.B.; Faccioli-Martins, P.Y.; Riboli, D.F.M.; Pereira, V.C.; Fernandes, S.; Oliveira, A.A.; Dantas, A.; Zafalon, L.F.; de Lourdes Ribeiro de Souza da Cunha, M. Clonal Profile, Virulence and Resistance of Staphylococcus aureus Isolated from Sheep Milk. Braz. J. Microbiol. 2015, 46, 535–543. [Google Scholar] [CrossRef]
  6. Vasileiou, N.G.C.; Giannakopoulos, A.; Cripps, P.J.; Ioannidi, K.S.; Chatzopoulos, D.C.; Gougoulis, D.A.; Billinis, C.; Mavrogianni, V.S.; Petinaki, E.; Fthenakis, G.C. Study of Potential Environmental Factors Predisposing Ewes to Subclinical Mastitis in Greece. Comp. Immunol. Microbiol. Infect. Dis. 2019, 62, 40–45. [Google Scholar] [CrossRef]
  7. Kotzamanidis, C.; Vafeas, G.; Giantzi, V.; Anastasiadou, S.; Mygdalias, S.; Malousi, A.; Loukia, E.; Daniel, S.; Zdragas, A. Staphylococcus aureus Isolated from Ruminants with Mastitis in Northern Greece Dairy Herds: Genetic Relatedness and Phenotypic and Genotypic Characterization. Toxins 2021, 13, 176. [Google Scholar] [CrossRef]
  8. Campos, B.; Pickering, A.C.; Rocha, L.S.; Aguilar, A.P.; Fabres-Klein, M.H.; de Oliveira Mendes, T.A.; Fitzgerald, J.R.; de Oliveira Barros Ribon, A. Diversity and Pathogenesis of Staphylococcus aureus from Bovine Mastitis: Current Understanding and Future Perspectives. BMC Vet. Res. 2022, 18, 115. [Google Scholar] [CrossRef]
  9. Dinges, M.M.; Orwin, P.M.; Schlievert, P.M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 2000, 13, 16–34. [Google Scholar] [CrossRef]
  10. Côté-Gravel, J.; Malouin, F. Symposium Review: Features of Staphylococcus aureus Mastitis Pathogenesis That Guide Vaccine Development Strategies. J. Dairy Sci. 2019, 102, 4727–4740. [Google Scholar] [CrossRef]
  11. Tam, K.; Torres, V.J. Staphylococcus aureus Secreted Toxins and Extracellular Enzymes. Microbiol. Spectr. 2019, 7, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  12. Yehia, F.A.Z.A.; Yousef, N.; Askoura, M. Exploring Staphylococcus aureus Virulence Factors; Special Emphasis on Staphyloxanthin. Microbiol. Biotechnol. Lett. 2021, 49, 467–477. [Google Scholar] [CrossRef]
  13. Lin, T.; Li, Q.; Jin, D.; Liu, W.; Tang, C.; Zhang, X. Investigation of Virulence Genes of Staphylococcus aureus Isolated from Sterile Body Fluid Samples and Their Correlation with Clinical Symptoms and Outcomes. Can. J. Infect. Dis. Med. Microbiol. 2021, 2021, 5354747. [Google Scholar] [CrossRef] [PubMed]
  14. da Costa, L.B.; Rajala-Schultz, P.J.; Hoet, A.; Seo, K.S.; Fogt, K.; Moon, B.S. Genetic Relatedness and Virulence Factors of Bovine Staphylococcus aureus Isolated from Teat Skin and Milk. J. Dairy Sci. 2014, 97, 6907–6916. [Google Scholar] [CrossRef]
  15. Oliveira, D.; Borges, A.; Simões, M. Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins 2018, 10, 252. [Google Scholar] [CrossRef]
  16. Spaan, A.N.; Vrieling, M.; Wallet, P.; Badiou, C.; Reyes-Robles, T.; Ohneck, E.A.; Benito, Y.; De Haas, C.J.C.; Day, C.J.; Jennings, M.P.; et al. The Staphylococcal Toxins γ-Haemolysin AB and CB Differentially Target Phagocytes by Employing Specific Chemokine Receptors. Nat. Commun. 2014, 5, 5438. [Google Scholar] [CrossRef]
  17. Spaan, A.N.; Van Strijp, J.A.G.; Torres, V.J. Leukocidins: Staphylococcal Bi-Component Pore-Forming Toxins Find Their Receptors. Nat. Rev. Microbiol. 2017, 15, 435–447. [Google Scholar] [CrossRef]
  18. Rasheed, N.A.; Hussein, N.R. Staphylococcus aureus: An Overview of Discovery, Characteristics, Epidemiology, Virulence Factors and Antimicrobial Sensitivity Short Title: Methicillin Resistant Staphylococcus aureus: An Overview. Eur. J. Mol. Clin. Med. 2021, 8, 1160–1183. [Google Scholar]
  19. Jahantigh, H.R.; Faezi, S.; Habibi, M.; Mahdavi, M.; Stufano, A.; Lovreglio, P.; Ahmadi, K. The Candidate Antigens to Achieving an Effective Vaccine against Staphylococcus aureus. Vaccines 2022, 10, 199. [Google Scholar] [CrossRef]
  20. Geraci, J.; Neubauer, S.; Pöllath, C.; Hansen, U.; Rizzo, F.; Krafft, C.; Westermann, M.; Hussain, M.; Peters, G.; Pletz, M.W.; et al. The Staphylococcus aureus Extracellular Matrix Protein (Emp) Has a Fibrous Structure and Binds to Different Extracellular Matrices. Sci. Rep. 2017, 7, 13665. [Google Scholar] [CrossRef]
  21. Ghasemian, A.; Peerayeh, S.N.; Bakhshi, B.; Mirzaee, M.S.N. The Microbial Surface Components Recognizing Adhesive Matrix Molecules (MSCRAMMs) Genes among Clinical Isolates of Staphylococcus aureus from Hospitalized Children. Iran. J. Pathol. 2015, 4, 258–264. [Google Scholar]
  22. Risser, F.; López-Morales, J.; Nash, M.A. Adhesive Virulence Factors of Staphylococcus aureus Resist Digestion by Coagulation Proteases Thrombin and Plasmin. ACS Bio. Med. Chem. Au 2022, 2, 586–599. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, X.; Xiong, T.; Gao, L.; Wang, Y.; Liu, L.; Tian, T.; Shi, Y.; Zhang, J.; Zhao, Z.; Lu, D.; et al. Extracellular Fibrinogen-Binding Protein Released by Intracellular Staphylococcus aureus Suppresses Host Immunity by Targeting TRAF3. Nat. Commun. 2022, 13, 586–599. [Google Scholar] [CrossRef] [PubMed]
  24. Sabat, A.; Melles, D.C.; Martirosian, G.; Grundmann, H.; Van Belkum, A.; Hryniewicz, W. Distribution of the Serine-Aspartate Repeat Protein-Encoding Sdr Genes among Nasal-Carriage and Invasive Staphylococcus aureus Strains. J. Clin. Microbiol. 2006, 44, 1135–1138. [Google Scholar] [CrossRef]
  25. Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of Virulence in Enterotoxin-Mediated Staphylococcal Food Poisoning. Front. Microbiol. 2018, 9, 436. [Google Scholar] [CrossRef]
  26. Jarraud, S.; Peyrat, M.A.; Lim, A.; Tristan, A.; Bes, M.; Mougel, C.; Etienne, J.; Vandenesch, F.; Bonneville, M.; Lina, G. Egc, A Highly Prevalent Operon of Enterotoxin Gene, Forms a Putative Nursery of Superantigens in Staphylococcus aureus. J. Immunol. 2001, 166, 669–677. [Google Scholar] [CrossRef]
  27. Munro, P.; Benchetrit, M.; Nahori, M.A.; Stefani, C.; Clément, R.; Michiels, J.F.; Landraud, L.; Dussurget, O.; Lemichez, E. The Staphylococcus aureus Epidermal Cell Differentiation Inhibitor Toxin Promotes Formation of Infection Foci in a Mouse Model of Bacteremia. Infect. Immun. 2010, 78, 3404–3411. [Google Scholar] [CrossRef]
  28. Ariyanti, D.; Isrina, S.; Salasia, O.; Tato, S. Characterization of Haemolysin of Staphylococcus aureus Isolated from Food of Animal Origin. Indones. J. Biotechnol. 2011, 16, 32–37. [Google Scholar]
  29. Zhang, H.; Zheng, Y.; Gao, H.; Xu, P.; Wang, M.; Li, A.; Miao, M.; Xie, X.; Deng, Y.; Zhou, H.; et al. Identification and Characterization of Staphylococcus aureus Strains with an Incomplete Hemolytic Phenotype. Front. Cell Infect. Microbiol. 2016, 6, 146. [Google Scholar] [CrossRef]
  30. Ahmad-Mansour, N.; Loubet, P.; Pouget, C.; Dunyach-Remy, C.; Sotto, A.; Lavigne, J.P.; Molle, V. Staphylococcus aureus Toxins: An Update on Their Pathogenic Properties and Potential Treatments. Toxins 2021, 13, 677. [Google Scholar] [CrossRef]
  31. Addis, M.F.; Pisanu, S.; Monistero, V.; Gazzola, A.; Penati, M.; Filipe, J.; Di Mauro, S.; Cremonesi, P.; Castiglioni, B.; Moroni, P.; et al. Comparative Secretome Analysis of Staphylococcus aureus Strains with Different Within-Herd Intramammary Infection Prevalence. Virulence 2022, 13, 174–190. [Google Scholar] [CrossRef] [PubMed]
  32. Boss, R.; Naskova, J.; Steiner, A.; Graber, H.U. Mastitis Diagnostics: Quantitative PCR for Staphylococcus aureus Genotype B in Bulk Tank Milk. J. Dairy Sci. 2011, 94, 128–137. [Google Scholar] [CrossRef] [PubMed]
  33. Wilson, G.J.; Tuffs, S.W.; Wee, B.A.; Seo, K.S.; Park, N.; Connelley, T.; Guinane, C.M.; Morrison, W.I.; Fitzgerald, J.R. Bovine Staphylococcus aureus Superantigens Stimulate the Entire T Cell Repertoire of Cattle. Infect. Immun. 2018, 86, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  34. Capra, E.; Cremonesi, P.; Pietrelli, A.; Puccio, S.; Luini, M.; Stella, A.; Castiglioni, B. Genomic and Transcriptomic Comparison between Staphylococcus aureus Strains Associated with High and Low within Herd Prevalence of Intra-Mammary Infection. BMC Microbiol. 2017, 17, 21. [Google Scholar] [CrossRef] [PubMed]
  35. Fournier, C.; Kuhnert, P.; Frey, J.; Miserez, R.; Kirchhofer, M.; Kaufmann, T.; Steiner, A.; Graber, H.U. Bovine Staphylococcus aureus: Association of Virulence Genes, Genotypes and Clinical Outcome. Res. Vet. Sci. 2008, 85, 439–448. [Google Scholar] [CrossRef]
  36. Graber, H.U.; Naskova, J.; Studer, E.; Kaufmann, T.; Kirchhofer, M.; Brechbühl, M.; Schaeren, W.; Steiner, A.; Fournier, C. Mastitis-Related Subtypes of Bovine Staphylococcus aureus Are Characterized by Different Clinical Properties. J. Dairy Sci. 2009, 92, 1442–1451. [Google Scholar] [CrossRef]
  37. Hoekstra, J.; Zomer, A.L.; Rutten, V.P.M.G.; Benedictus, L.; Stegeman, A.; Spaninks, M.P.; Bennedsgaard, T.W.; Biggs, A.; De Vliegher, S.; Mateo, D.H.; et al. Genomic Analysis of European Bovine Staphylococcus aureus from Clinical versus Subclinical Mastitis. Sci. Rep. 2020, 10, 18172. [Google Scholar] [CrossRef]
  38. Kot, B.; Szweda, P.; Frankowska-Maciejewska, A.; Piechota, M.; Wolska, K. Virulence Gene Profiles in Staphylococcus aureus Isolated from Cows with Subclinical Mastitis in Eastern Poland. J. Dairy Res. 2016, 83, 228–235. [Google Scholar] [CrossRef]
  39. Liu, K.; Tao, L.; Li, J.; Fang, L.; Cui, L.; Li, J.; Meng, X.; Zhu, G.; Bi, C.; Wang, H. Characterization of Staphylococcus aureus Isolates From Cases of Clinical Bovine Mastitis on Large-Scale Chinese Dairy Farms. Front. Vet. Sci. 2020, 7, 580129. [Google Scholar] [CrossRef]
  40. Majumder, S.; Sackey, T.; Viau, C.; Park, S.; Xia, J.; Ronholm, J.; George, S. Genomic and Phenotypic Profiling of Staphylococcus aureus Isolates from Bovine Mastitis for Antibiotic Resistance and Intestinal Infectivity. BMC Microbiol. 2023, 23, 43. [Google Scholar] [CrossRef]
  41. Neelam; Jain, V.K.; Singh, M.; Joshi, V.G.; Chhabra, R.; Singh, K.; Rana, Y.S. Virulence and Antimicrobial Resistance Gene Profiles of Staphylococcus aureus Associated with Clinical Mastitis in Cattle. PLoS ONE 2022, 17, e0264762. [Google Scholar] [CrossRef]
  42. Ote, I.; Taminiau, B.; Duprez, J.N.; Dizier, I.; Mainil, J.G. Genotypic Characterization by Polymerase Chain Reaction of Staphylococcus aureus Isolates Associated with Bovine Mastitis. Vet. Microbiol. 2011, 153, 285–292. [Google Scholar] [CrossRef] [PubMed]
  43. Somphol, N.; Thamrongyoswittayakul, C.; Wilailuckana, C.; Phuektes, P.; Yeanpet, C. Prevalence and Genetic Profiles of Staphylococcus aureus Isolated from Milk in Mastitic Dairy Cows Based on Conventional and Multiplex PCR Assays in Khon Kaen Province, Thailand. Prawarun Agr. J. 2018, 15, 278–288. [Google Scholar]
  44. Wolf, C.; Kusch, H.; Monecke, S.; Albrecht, D.; Holtfreter, S.; von Eiff, C.; Petzl, W.; Rainard, P.; Bröker, B.M.; Engelmann, S. Genomic and Proteomic Characterization of Staphylococcus aureus Mastitis Isolates of Bovine Origin. Proteomics 2011, 11, 2491–2502. [Google Scholar] [CrossRef]
  45. Zaatout, N.; Ayachi, A.; Kecha, M.; Kadlec, K. Identification of Staphylococci Causing Mastitis in Dairy Cattle from Algeria and Characterization of Staphylococcus aureus. J. Appl. Microbiol. 2019, 127, 1305–1314. [Google Scholar] [CrossRef]
  46. Zhang, L.; Gao, J.; Barkema, H.W.; Ali, T.; Liu, G.; Deng, Y.; Naushad, S.; Kastelic, J.P.; Han, B. Virulence Gene Profiles: Alpha-Hemolysin and Clonal Diversity in Staphylococcus aureus Isolates from Bovine Clinical Mastitis in China. BMC Vet. Res. 2018, 14, 63. [Google Scholar] [CrossRef]
  47. Fursova, K.; Sorokin, A.; Sokolov, S.; Dzhelyadin, T.; Shulcheva, I.; Shchannikova, M.; Nikanova, D.; Artem’eva, O.; Zinovieva, N.; Brovko, F. Virulence Factors and Phylogeny of Staphylococcus aureus Associated With Bovine Mastitis in Russia Based on Genome Sequences. Front. Vet. Sci. 2020, 7, 135. [Google Scholar] [CrossRef]
  48. Monistero, V.; Graber, H.U.; Pollera, C.; Cremonesi, P.; Castiglioni, B.; Bottini, E.; Ceballos-Marquez, A.; Lasso-Rojas, L.; Kroemker, V.; Wente, N.; et al. Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes. Toxins 2018, 10, 247. [Google Scholar] [CrossRef]
  49. Acosta, A.C.; Oliveira, P.R.F.; Albuquerque, L.; Silva, I.F.; Medeiros, E.S.; Costa, M.M.; Pinheiro Junior, J.W.; Mota, R.A. Frequency of Staphylococcus aureus Virulence Genes in Milk of Cows and Goats with Mastitis. Pesqui. Vet. Bras. 2018, 38, 2029–2036. [Google Scholar] [CrossRef]
  50. Aslantaş, Ö.; Keskin, O.; Yücetepe, G. Molecular Characterization of Staphylococcus aureus from Clinical Sheep Mastitis Cases. Isr. J. Vet. Med. 2022, 77, 99–105. [Google Scholar]
  51. Azara, E.; Piras, M.G.; Parisi, A.; Tola, S. Antimicrobial Susceptibility and Genotyping of Staphylococcus aureus Isolates Collected between 1986 and 2015 from Ovine Mastitis. Vet. Microbiol. 2017, 205, 53–56. [Google Scholar] [CrossRef] [PubMed]
  52. Bar-Gal, G.K.; Blum, S.E.; Hadas, L.; Ehricht, R.; Monecke, S.; Leitner, G. Host-Specificity of Staphylococcus aureus Causing Intramammary Infections in Dairy Animals Assessed by Genotyping and Virulence Genes. Vet. Microbiol. 2015, 176, 143–154. [Google Scholar] [CrossRef] [PubMed]
  53. Scherrer, D.; Corti, S.; Muehlherr, J.E.; Zweifel, C.; Stephan, R. Phenotypic and Genotypic Characteristics of Staphylococcus aureus Isolates from Raw Bulk-Tank Milk Samples of Goats and Sheep. Vet. Microbiol. 2004, 101, 101–107. [Google Scholar] [CrossRef] [PubMed]
  54. Adkins, P.R.F.; Middleton, J.R. Methods for Diagnosing Mastitis. Vet. Clin. N. Am.-Food Anim. Pract. 2018, 34, 479–491. [Google Scholar] [CrossRef] [PubMed]
  55. Cremonesi, P.; Luzzana, M.; Brasca, M.; Morandi, S.; Lodi, R.; Vimercati, C.; Agnellini, D.; Caramenti, G.; Moroni, P.; Castiglioni, B. Development of a Multiplex PCR Assay for the Identification of Staphylococcus aureus Enterotoxigenic Strains Isolated from Milk and Dairy Products. Mol. Cell Probes 2005, 19, 299–305. [Google Scholar] [CrossRef]
  56. Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus Genetic Background, Virulence Factors, Agr Groups (Alleles), and Human Disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef]
  57. Akineden, Ö.; Annemüller, C.; Hassan, A.A.; Lämmler, C.; Wolter, W.; Zschöck, M. Toxin Genes and Other Characteristics of Staphylococcus aureus Isolates from Milk of Cows with Mastitis. Clin. Diagn. Lab. Immunol. 2001, 8, 959–964. [Google Scholar] [CrossRef]
  58. Ksibi, B.; Ktari, S.; Ghedira, K.; Othman, H.; Maalej, S.; Mnif, B.; Fabre, L.; Rhimi, F.; Hello, S.L.; Hammami, A. Antimicrobial Resistance Genes, Virulence Markers and Prophage Sequences in Salmonella Enterica Serovar Enteritidis Isolated in Tunisia Using Whole Genome Sequencing. Curr. Res. Microb. Sci. 2022, 3, 100151. [Google Scholar] [CrossRef]
  59. Wang, S.C.; Wu, C.M.; Xia, S.C.; QI, Y.H.; Xia, L.N.; Shen, J.Z. Distribution of Superantigenic Toxin Genes in Staphylococcus aureus Isolates from Milk Samples of Bovine Subclinical Mastitis Cases in Two Major Diary Production Regions of China. Vet. Microbiol. 2009, 137, 276–281. [Google Scholar] [CrossRef]
  60. Zecconi, A.; Cesaris, L.; Liandris, E.; Daprà, V.; Piccinini, R. Role of Several Staphylococcus aureus Virulence Factors on the Inflammatory Response in Bovine Mammary Gland. Microb. Pathog. 2006, 40, 177–183. [Google Scholar] [CrossRef]
  61. Azara, E.; Longheu, C.; Sanna, G.; Tola, S. Biofilm Formation and Virulence Factor Analysis of Staphylococcus aureus Isolates Collected from Ovine Mastitis. J. Appl. Microbiol. 2017, 123, 372–379. [Google Scholar] [CrossRef] [PubMed]
  62. Achek, R.; El-Adawy, H.; Hotzel, H.; Tomaso, H.; Ehricht, R.; Hamdi, T.M.; Azzi, O.; Monecke, S. Short Communication: Diversity of Staphylococci Isolated from Sheep Mastitis in Northern Algeria. J. Dairy Sci. 2020, 103, 890–897. [Google Scholar] [CrossRef] [PubMed]
  63. Merz, A.; Stephan, R.; Johler, S. Staphylococcus aureus Isolates from Goat and Sheep Milk Seem to Be Closely Related and Differ from Isolates Detected from Bovine Milk. Front. Microbiol. 2016, 7, 319. [Google Scholar] [CrossRef]
  64. Moraveji, Z.; Tabatabaei; Aski, S.; Khoshbakht, R. Characterization of Hemolysins of Staphylococcus Strains Isolated from Human and Bovine, Southern Iran. Iran. J. Vet. Res. Shiraz Univ. 2014, 15, 326–330. [Google Scholar]
  65. Motamedi, H.; Asghari, B.; Tahmasebi, H.; Arabestani, M. Identification of Hemolysine Genes and Their Association with Antimicrobial Resistance Pattern among Clinical Isolates of Staphylococcus aureus in West of Iran. Adv. Biomed. Res. 2018, 7, 153. [Google Scholar] [CrossRef]
  66. Madhava, P.; Prameela, R.; Sreedevi, B.; Rao, M. Evaluation of Autovaccine against Mastitis Causing Staphylococcus aureus in and around Tirupati, Chittoor District, Andhra Pradesh. Pharma Innov. J. 2020, 9, 144–151. [Google Scholar]
  67. Scafa-Udriste, A.; Popa, M.I.; Popa, G.L. Updates on Staphylococcal Vaccines. Microbiol. Res. 2024, 15, 137–151. [Google Scholar] [CrossRef]
  68. Middleton, J.R. Staphylococcus aureus Antigens and Challenges in Vaccine Development. Expert. Rev. Vaccines 2008, 7, 805–815. [Google Scholar] [CrossRef]
  69. Ismail, Z.B. Mastitis Vaccines in Dairy Cows: Recent Developments and Recommendations of Application. Vet. World 2017, 10, 1057–1062. [Google Scholar] [CrossRef]
  70. Czernomysy-Furowicz, D.; Fijałkowski, K.; Silecka, A.; Karakulska, J.; Nawrotek, P.; Drozd, R.; Ferlas, M.; Borkowski, J.; Jankowiak, D. Herd-Specific Autovaccine and Antibiotic Treatment in Elimination of Staphylococcus aureus Mastitis in Dairy Cattle. Turk. J. Vet. Anim. Sci. 2014, 38, 496–500. [Google Scholar] [CrossRef]
Animals 14 03172 g001
Figure 1. Analysis of 20 virulence gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Figure 1. Analysis of 20 virulence gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Animals 14 03172 g001
Animals 14 03172 g002
Figure 2. Analysis of four enterotoxin gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Figure 2. Analysis of four enterotoxin gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Animals 14 03172 g002
Animals 14 03172 g003
Figure 3. Analysis of 12 hemolysin gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Figure 3. Analysis of 12 hemolysin gene profiles (SA1–SA20) of 110 Staphylococcus aureus isolates from sheep with clinical and subclinical mastitis and ATCC strain profiles. The dendrogram was generated based on the presence/absence of virulence genes using the maximum likelihood method by the Kimura 2-parameter model with 1000 bootstrap replicates. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test are shown next to the branches. Green boxes indicate the presence and yellow boxes the absence of the corresponding virulence genes.
Animals 14 03172 g003
Animals 14 03172 g004
Figure 4. Position of investigated dairy sheep farms.
Figure 4. Position of investigated dairy sheep farms.
Animals 14 03172 g004
Animals 14 03172 g005
Figure 5. Spatial distribution of gene profiles in dairy sheep farms.
Figure 5. Spatial distribution of gene profiles in dairy sheep farms.
Animals 14 03172 g005
Animals 14 03172 g006
Figure 6. Spatial distribution of enterotoxin gene profiles in dairy sheep farms.
Figure 6. Spatial distribution of enterotoxin gene profiles in dairy sheep farms.
Animals 14 03172 g006
Animals 14 03172 g007
Figure 7. Spatial distribution of hemolysin gene profiles in dairy sheep farms.
Figure 7. Spatial distribution of hemolysin gene profiles in dairy sheep farms.
Animals 14 03172 g007
Table 1. Virulence factors of Staphylococcus aureus reported in literature.
Table 1. Virulence factors of Staphylococcus aureus reported in literature.
Virulence FactorsReference
Collagen-binding protein (Cna)[12]
Fibronectin-binding proteins (FnBPA, FnBPB)[12]
Clumping factors (ClfA, ClfB)[12]
Serine–aspartate repeat proteins (Sdr A, Sdr B, Sdr C)[12]
Iron-regulated surface determinant proteins (IsdA, IsdB, IsdH)[12]
S. aureus surface protein (G SASG)[12]
S. aureus capsular polysaccharides (13 serotypes)[12]
Staphylokinase (SAK)[12]
Extracellular fibrinogen binding protein (Efb)[12]
Chemotaxis inhibitory protein of S. aureus (CHIPS)[12]
Staphylococcal complement inhibitor (SCIN)[12]
Formyl peptide receptor-like-1 inhibitory protein (FPRL1)[12]
Extracellular adherence protein (Eap)[12]
Hemolysins (αHL, βHL, δHL, γHL: HlgAB and HlgCB)[13,14,15]
Leukocidins (LukAB, LukED, LukMFʹ, LukPQ)[13,14,16]
Panton–Valentine leukocidins (LukSF–PV) [17,18]
Hyaluronidase (hysA)[13]
Staphylokinase (Sak)[13]
Lipase (SAL1, SAL2)[19]
Nuclease (Nuc)[13]
Staphyloxanthin (STX)[13]
Clumping factors (ClfA, ClfB)[13]
Extracellular matrix protein (Emp)[20]
Fibronectin binding proteins (FnBPA, FnBPB)[21,22]
Fibrinogen binding protein (Efb)[14,22,23]
Fibronectin-binding protein (FbpA)[14]
Serine-aspartate repeat proteins (SdrC, SdrD, SdrE)[22,24]
Anchored collagen adhesin (Cna)[22]
Staphylococcal enterotoxins (SEA, SEB, SEC1, SEC2, SEC3, SED, SEE, SEG, SEH, SEI, SElJ, SEK, SEL, SEM, SEN, SEP, SEQ, SER, SES, SET, SEU, SElW, SEV, SElX, SelY)[25]
Toxic shock syndrome toxin (TSST-1)[15]
Exfoliative toxins (ETA, ETB, ETC, ETD)[15,26]
Epidermal cell differentiation inhibitor exotoxins (EDIN-A, EDIN-B, EDIN-C)[27]
Phenol-soluble modulins (PSMα, PSMβ, PSMγ)[15]
Table 2. Primer and amplicon sizes of the target genes of S. aureus.
Table 2. Primer and amplicon sizes of the target genes of S. aureus.
Target GeneOligonucleotide Sequence (5′-3′)Amplicon Size (bp)Reference
23S rRnaF: AGC TGT GGA TTG TCC TTT GG499[55]
R: TCG CTC GCTBCAC CTT AGA AT
coaF: CCG CTT CAA CTT CAG CCT AC204[55]
R: TTA GGT GCT ACA GGG GCA AT
nucF: AGT TCA GCA AAT GCA TCA CA400[55]
R: TAG CCA AGC CTT GAC GAA CT
seaF: TAA GGA GGT GGT GCC TAT GG180[55]
R: CAT CGA AAC CAG CCA AAG TT
secF: ACC AGA CCC TAT GCC AGA TG371[55]
R: TCC CAT TAT CAA AGT GGT TTC C
sedF: TCA ATT CAA AAG AAA TGG CTC A339[55]
R: TTT TTC CGC GCT GTA TTT TT
sejF: GGT TTT CAA TGT TCT GGT GGT306[55]
R: AAC CAA CGG TTC TTT TGA GG
selF: CAC CAG AAT CAC ACC GCT TA240[55]
R: CTG TTT GAT GCT TGC CAT TG
segF: CCA CCT GTT GAA GGA AGA GG432[55]
R: TGC AGA ACC ATC AAA CTC GT
sehF: TCA CAT CAT ATG CGA AAG CAG463[55]
R: TCG GAC AAT ATT TTT CTG ATC TTT
seiF: CTC AAG GTG ATA TTG GTG TAG G529[57]
R: CAG GCA GTC CAT CTC CTG TA[55]
hlaF: CTGATTACTATCCAAGAAATTCGATTG209[56]
R: CTTTCCAGCCTACTTTTTTATCAGT
hlbF: GTGCACTTACTGACAATAGTGC309[56]
R: GTTGATGAGTAGCTACCTTCAGT
hldF: AAGAATTTTTATCTTAATTAAGGAAGGAGTG111[56]
R: TTAGTGAATTTGTTCACTGTGTCGA
hlgACF: AATTCATTTGTTACACCGAATG1245[42]
R: GCCATCGCATAGCTTTAACA
Table 3. Prevalence and 95% confidence interval (95% C.I.) of tested genes in 110 strains of S. aureus isolated from sheep with mastitis.
Table 3. Prevalence and 95% confidence interval (95% C.I.) of tested genes in 110 strains of S. aureus isolated from sheep with mastitis.
GenesNumberFrequence (%)95% C.I. (%)
sea000.00–0.34
sec8274.5565.35–82.37
sed000.00–0.34
seg10.910.00–4.96
seh10.910.00–4.96
sei10.910.00–4.96
sel8274.5565.35–82.37
sej000.00–0.34
hla9081.8273.33–88.53
hlb1715.459.27–23.59
hld9889.0981.72–94.23
hlgAC9687.2779.57–92.86
Table 4. Prevalence and 95% confidence interval (95% C.I.) of virulence gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
Table 4. Prevalence and 95% confidence interval (95% C.I.) of virulence gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
ProfilesGenesNumberPrevalence95% C.I.
seasecsedsegsehseiselsejhlahlbhldhlg AC %%
SA1----------++21.820.22–6.41
SA2---------+++10.910.00–4.96
SA3--------+-+-10.910.00–4.96
SA4--------+-++1917.2710.21–24.34
SA5--------++-+10.910.00–4.96
SA6--------++++21.820.22–5.14
SA7-+----+-----10.910.00–4.96
SA8-+----+---+-21.820.22–6.41
SA9-+----+--+--10.910.00–4.96
SA10-+----+----+43.641.00–9.05
SA11-+----+---++65.452.03–11.49
SA12-+----+--+++21.820.22–6.41
SA13-+----+-+-+-65.452.03–11.49
SA14-+----+-+++-32.730.57–7.76
SA15-+----+-+--+32.730.57–7.76
SA16-+----+-+-++4843.643420–5342
SA17-+----+-++-+10.910.00–4.96
SA18-+----+-++++54.551.49–10.29
SA19----+------+10.910.00–4.96
SA20---+-+--++++10.910.00–4.96
SA ATCC21--++-+-+++++
SA ATCC22++-+-++-+-++
SA ATCC23-+-++++-+-++
Table 5. Prevalence and 95% confidence interval (95% C.I.) of enterotoxin gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
Table 5. Prevalence and 95% confidence interval (95% C.I.) of enterotoxin gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
ProfilesGenesNumberPrevalence95% C.I.
seasecsedsegsehseiselsej %%
SAET1--------2623.616.06–32.68
SAET2-+-----+8274.665.35–82.37
SAET3----+---10.910.00–4.96
SAET4---+-+--10.910.00–4.96
SA ATCC21--++-++-
SA ATCC22++-+-+-+
SA ATCC23-+-+++-+
Table 6. Prevalence and 95% confidence interval (95% C.I.) of hemolysin gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
Table 6. Prevalence and 95% confidence interval (95% C.I.) of hemolysin gene profiles in 110 strains of S. aureus isolated from sheep with mastitis.
ProfilesGenesNumberPrevalence95% C.I.
hlahlbhldhlgAC%%
SAEM1----10.910.00–4.96
SAEM2--+-21.820.22–6.41
SAEM3-+--10.910.00–4.96
SAEM4---+54.551.49–10.29
SAEM5--++87.273.19–13.83
SAEM6-+++32.730.57–7.76
SAEM7+-+-76.362.60–12.67
SAEM8+++-32.730.57–7.76
SAEM9+--+32.730.57–7.76
SAEM10+-++6760.9151.14–70.07
SAEM11++-+21.820.22–6.41
SAEM12++++87.273.19–13.83
SA ATCC21++++
SA ATCC22+-++
SA ATCC23+-++
Table 7. Prevalence and 95% confidence interval (95% C.I.) of gene profiles and hemolysin profiles of S. aureus isolated from milk samples with subclinical mastitis in the same farm.
Table 7. Prevalence and 95% confidence interval (95% C.I.) of gene profiles and hemolysin profiles of S. aureus isolated from milk samples with subclinical mastitis in the same farm.
Gene ProfileHemolysin ProfileNumberPrevalence95% C.I.
SA7SAEM117.140.18–33.87
SA9SAEM317.140.18–33.87
SA10SAEM4321.434.66–50.80
SA11SAEM5214.291.78–42.81
SA16SAEM10642.8617.66–71.14
SA17SAEM1117.140.18–33.87
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sezzi, E.; Fanelli, R.; Gobbi, D.; Scandurra, P.; Mannucci, V.; Usai, I.; Ragionieri, G.; Mezher, Z.; Fichi, G. An Investigation of Virulence Genes of Staphylococcus aureus in Autologous Vaccines Against Sheep Mastitis. Animals 2024, 14, 3172. https://doi.org/10.3390/ani14223172

AMA Style

Sezzi E, Fanelli R, Gobbi D, Scandurra P, Mannucci V, Usai I, Ragionieri G, Mezher Z, Fichi G. An Investigation of Virulence Genes of Staphylococcus aureus in Autologous Vaccines Against Sheep Mastitis. Animals. 2024; 14(22):3172. https://doi.org/10.3390/ani14223172

Chicago/Turabian Style

Sezzi, Erminia, Rita Fanelli, Deborah Gobbi, Paolo Scandurra, Valerio Mannucci, Isabella Usai, Giovanni Ragionieri, Ziad Mezher, and Gianluca Fichi. 2024. "An Investigation of Virulence Genes of Staphylococcus aureus in Autologous Vaccines Against Sheep Mastitis" Animals 14, no. 22: 3172. https://doi.org/10.3390/ani14223172

APA Style

Sezzi, E., Fanelli, R., Gobbi, D., Scandurra, P., Mannucci, V., Usai, I., Ragionieri, G., Mezher, Z., & Fichi, G. (2024). An Investigation of Virulence Genes of Staphylococcus aureus in Autologous Vaccines Against Sheep Mastitis. Animals, 14(22), 3172. https://doi.org/10.3390/ani14223172

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop