Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Sources and Sample Collection
2.2. RNA Extraction, cDNA Synthesis, and DNA Extraction
2.3. Isolation and Identification of Buffalo SCD
2.4. Molecular Characterization, Structure, and Function Analysis
2.5. Tissue Differential Expression Analysis
2.6. Functional Analyses at the Cellular Level
2.6.1. Cell Culture
2.6.2. Construction of Overexpression Recombinant Vectors
2.6.3. SCD Overexpression in BuMECs
2.6.4. SCD Interference in BuMECs
2.6.5. qPCR Analysis of Genes Related to Milk Fat Synthesis
2.7. Subcellular Localization of SCD in BuMECs
2.8. Polymorphism Detection and Association Analysis
3. Results
3.1. Isolation and Identification of SCD Sequence
3.2. Structure of the Transcript Region
3.3. Physicochemical Characteristics and Functional Modification Sites of Buffalo SCD
3.4. Sequence Identity and Phylogeny, Motif Composition, and Conserved Structural Domain Analysis
3.5. Secondary and Tertiary Structure of Buffalo SCD
3.6. Protein Interactions, Biological Processes, and Molecular Functions
3.7. Tissue Differential Expression
3.8. Subcellular Localization of the Buffalo SCD
3.9. Effects of SCD Overexpression on Lipid Synthesis-Related Genes in BuMECs
3.10. Effects of SCD Knockdown on Lipid Synthesis-Related Genes in BuMECs
3.11. Population Genetic Analysis and Association Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thiede, M.A.; Ozols, J.; Strittmatter, P. Construction and Sequence of cDNA for Rat Liver Stearyl Coenzyme A Desaturase. J. Biol. Chem. 1986, 261, 13230–13235. [Google Scholar] [CrossRef] [PubMed]
- Ntambi, J.M.; Miyazaki, M. Regulation of Stearoyl-CoA Desaturases and Role in Metabolism. Prog. Lipid Res. 2004, 43, 91–104. [Google Scholar] [CrossRef] [PubMed]
- ALJohani, A.M.; Syed, D.N.; Ntambi, J.M. Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends Endocrinol. Metab. TEM 2017, 28, 831–842. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yu, L.; Schmidt, R.E.; Su, C.; Huang, X.; Gould, K.; Cao, G. Characterization of HSCD5, a Novel Human Stearoyl-CoA Desaturase Unique to Primates. Biochem. Biophys. Res. Commun. 2005, 332, 735–742. [Google Scholar] [CrossRef] [PubMed]
- Lengi, A.J.; Corl, B.A. Identification and Characterization of a Novel Bovine Stearoyl-CoA Desaturase Isoform with Homology to Human SCD5. Lipids 2007, 42, 499–508. [Google Scholar] [CrossRef] [PubMed]
- Matosinho, C.G.R.; de S. Fonseca, P.A.; Peixoto, M.G.C.D.; Rosse, I.C.; Lopes, F.C.F.; Zózimo, T.; Filho, A.E.V.; Bruneli, F.Â.T.; Carvalho, M.R.S.; Gama, M.A.S. Phenotypic Variation in Milk Fatty Acid Composition and Its Association with Stearoyl-CoA Desaturase 1 (SCD1) Gene Polymorphisms in Gir Cows. J. Anim. Breed. Genet. Z. Tierz. Zucht. 2023, 140, 532–548. [Google Scholar] [CrossRef]
- Orrù, L.; Cifuni, G.F.; Piasentier, E.; Corazzin, M.; Bovolenta, S.; Moioli, B. Association Analyses of Single Nucleotide Polymorphisms in the LEP and SCD1 Genes on the Fatty Acid Profile of Muscle Fat in Simmental Bulls. Meat Sci. 2011, 87, 344–348. [Google Scholar] [CrossRef]
- Jiang, Z.; Michal, J.J.; Tobey, D.J.; Daniels, T.F.; Rule, D.C.; Macneil, M.D. Significant Associations of Stearoyl-CoA Desaturase (SCD1) Gene with Fat Deposition and Composition in Skeletal Muscle. Int. J. Biol. Sci. 2008, 4, 345–351. [Google Scholar] [CrossRef]
- Campbell, E.M.; Gallagher, D.S.; Davis, S.K.; Taylor, J.F.; Smith, S.B. Rapid Communication: Mapping of the Bovine Stearoyl-Coenzyme A Desaturase (SCD) Gene to BTA261. J. Anim. Sci. 2001, 79, 1954–1955. [Google Scholar] [CrossRef]
- Yuan, X.; Abdul-Rahman, I.I.; Hu, S.; Li, L.; He, H.; Xia, L.; Hu, J.; Ran, M.; Liu, Y.; Abdulai, M.; et al. Mechanism of SCD Participation in Lipid Droplet-Mediated Steroidogenesis in Goose Granulosa Cells. Genes 2022, 13, 1516. [Google Scholar] [CrossRef]
- Otto, J.R.; Mwangi, F.W.; Pewan, S.B.; Adegboye, O.A.; Malau-Aduli, A.E.O. Lipogenic Gene Single Nucleotide Polymorphic DNA Markers Associated with Intramuscular Fat, Fat Melting Point, and Health-Beneficial Omega-3 Long-Chain Polyunsaturated Fatty Acids in Australian Pasture-Based Bowen Genetics Forest Pastoral Angus, Hereford, and Wagyu Beef Cattle. Genes 2022, 13, 1411. [Google Scholar] [CrossRef] [PubMed]
- Warriach, H.M.; McGill, D.M.; Bush, R.D.; Wynn, P.C.; Chohan, K.R. A Review of Recent Developments in Buffalo Reproduction—A Review. Asian-Australas. J. Anim. Sci. 2015, 28, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Aleandri, R.; Buttazzoni, L.G.; Schneider, J.C.; Caroli, A.; Davoli, R. The Effects of Milk Protein Polymorphisms on Milk Components and Cheese-Producing Ability. J. Dairy Sci. 1990, 73, 241–255. [Google Scholar] [CrossRef]
- Garau, V.; Manis, C.; Scano, P.; Caboni, P. Compositional Characteristics of Mediterranean Buffalo Milk and Whey. Dairy 2021, 2, 469–488. [Google Scholar] [CrossRef]
- Månsson, H.L. Fatty acids in bovine milk fat. Food Nutr. Res. 2008, 52, 1821–1823. [Google Scholar] [CrossRef]
- Nie, P.; Pan, B.; Ahmad, M.J.; Zhang, X.; Chen, C.; Yao, Z.; Lv, H.; Wei, K.; Yang, L. Summer Buffalo Milk Produced in China: A Desirable Diet Enriched in Polyunsaturated Fatty Acids and Amino Acids. Foods 2022, 11, 3475. [Google Scholar] [CrossRef]
- GB/T 19477-2004; Operating Procedures of Cattle Slaughtering. China Standards Press: Beijing, China, 2004.
- Psifidi, A.; Dovas, C.I.; Bramis, G.; Lazou, T.; Russel, C.L.; Arsenos, G.; Banos, G. Comparison of Eleven Methods for Genomic DNA Extraction Suitable for Large-Scale Whole-Genome Genotyping and Long-Term DNA Banking Using Blood Samples. PLoS ONE 2015, 10, e0115960. [Google Scholar] [CrossRef]
- Lalitha, S. Primer premier 5. Biotech. Softw. Internet Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Maryam, J.; Babar, M.E.; Bao, Z.; Nadeem, A. A Novel Selection Signature in Stearoyl-Coenzyme A Desaturase (SCD) Gene for Enhanced Milk Fat Content in Bubalus Bubalis. Trop. Anim. Health Prod. 2016, 48, 1343–1349. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” Bioinformatics Platform for Biological Big-Data Mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
- Hu, B.; Jin, J.; Guo, A.-Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An Upgraded Gene Feature Visualization Server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Hochstrasser, D.F. Protein Identification and Analysis Tools in the ExPASy Server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar] [CrossRef]
- Geourjon, C.; Deléage, G. SOPMA: Significant Improvements in Protein Secondary Structure Prediction by Consensus Prediction from Multiple Alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology Modelling of Protein Structures and Complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- de Castro, E.; Sigrist, C.J.A.; Gattiker, A.; Bulliard, V.; Langendijk-Genevaux, P.S.; Gasteiger, E.; Bairoch, A.; Hulo, N. ScanProsite: Detection of PROSITE Signature Matches and ProRule-Associated Functional and Structural Residues in Proteins. Nucleic Acids Res. 2006, 34, W362–W365. [Google Scholar] [CrossRef]
- Nielsen, H.; Tsirigos, K.D.; Brunak, S.; von Heijne, G. A Brief History of Protein Sorting Prediction. Protein J. 2019, 38, 200–216. [Google Scholar] [CrossRef]
- Krogh, A.; Larsson, B.; Von Heijne, G.; Sonnhammer, E.L. Predicting Transmembrane Protein Topology with a Hidden Markov Model: Application to Complete Genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING Database in 2023: Protein-Protein Association Networks and Functional Enrichment Analyses for Any Sequenced Genome of Interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
- Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
- Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A Web Server for Functional Enrichment Analysis and Functional Annotation of Gene Lists (2021 Update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef] [PubMed]
- Fan, X.; Qiu, L.; Teng, X.; Zhang, Y.; Miao, Y. Effect of INSIG1 on the Milk Fat Synthesis of Buffalo Mammary Epithelial Cells. J. Dairy Res. 2020, 87, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Sheng, D.; Fan, X.; Gao, R.; Miao, Y. Molecular Characterization, Function, Tissue Differential Expression, and Single-Nucleotide Polymorphism of Buffalo TP53 Gene. Arch. Anim. Breed. 2024, 67, 217–230. [Google Scholar] [CrossRef]
- Yeh, F.C.; Boyle, T.B.J. Population genetic analysis of co-dominant and dominant marker and quantitative traits. Belg. J. Bot. 1997, 129, 157–163. [Google Scholar]
- Tokarz, J.; Mindnich, R.; Norton, W.; Möller, G.; Hrabé de Angelis, M.; Adamski, J. Discovery of a Novel Enzyme Mediating Glucocorticoid Catabolism in Fish: 20beta-Hydroxysteroid Dehydrogenase Type 2. Mol. Cell. Endocrinol. 2012, 349, 202–213. [Google Scholar] [CrossRef]
- Ntambi, J.M. Regulation of Stearoyl-CoA Desaturase by Polyunsaturated Fatty Acids and Cholesterol. J. Lipid Res. 1999, 40, 1549–1558. [Google Scholar] [CrossRef]
- Paton, C.M.; Ntambi, J.M. Biochemical and Physiological Function of Stearoyl-CoA Desaturase. Am. J. Physiol.-Endocrinol. Metab. 2009, 297, E28–E37. [Google Scholar] [CrossRef]
- Yonezawa, T.; Haga, S.; Kobayashi, Y.; Katoh, K.; Obara, Y. Unsaturated Fatty Acids Promote Proliferation via ERK1/2 and Akt Pathway in Bovine Mammary Epithelial Cells. Biochem. Biophys. Res. Commun. 2008, 367, 729–735. [Google Scholar] [CrossRef]
- Bradley, R.L.; Fisher, F.F.M.; Maratos-Flier, E. Dietary Fatty Acids Differentially Regulate Production of TNF-Alpha and IL-10 by Murine 3T3-L1 Adipocytes. Obes. Silver Spring Md. 2008, 16, 938–944. [Google Scholar] [CrossRef]
- Mele, M.; Conte, G.; Castiglioni, B.; Chessa, S.; Macciotta, N.P.P.; Serra, A.; Buccioni, A.; Pagnacco, G.; Secchiari, P. Stearoyl-Coenzyme A Desaturase Gene Polymorphism and Milk Fatty Acid Composition in Italian Holsteins. J. Dairy Sci. 2007, 90, 4458–4465. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, J.A. Milk Fat Technologies and Markets: A Summary of the Wisconsin Milk Marketing Board 1988 Milk Fat Roundtable. J. Dairy Sci. 1989, 72, 3109–3115. [Google Scholar] [CrossRef]
- Nakamura, M.T.; Nara, T.Y. Structure, Function, and Dietary Regulation of Delta6, Delta5, and Delta9 Desaturases. Annu. Rev. Nutr. 2004, 24, 345–376. [Google Scholar] [CrossRef] [PubMed]
- Yao, D.; Luo, J.; He, Q.; Shi, H.; Li, J.; Wang, H.; Xu, H.; Chen, Z.; Yi, Y.; Loor, J.J. SCD1 Alters Long-Chain Fatty Acid (LCFA) Composition and Its Expression Is Directly Regulated by SREBP-1 and PPARγ 1 in Dairy Goat Mammary Cells: SCD1 AND FATTY ACID METABOLISM. J. Cell. Physiol. 2017, 232, 635–649. [Google Scholar] [CrossRef] [PubMed]
- Chu, K.; Miyazaki, M.; Man, W.C.; Ntambi, J.M. Stearoyl-Coenzyme A Desaturase 1 Deficiency Protects against Hypertriglyceridemia and Increases Plasma High-Density Lipoprotein Cholesterol Induced by Liver X Receptor Activation. Mol. Cell. Biol. 2006, 26, 6786–6798. [Google Scholar] [CrossRef]
- Shi, H.B.; Luo, J.; Yao, D.W.; Zhu, J.J.; Xu, H.F.; Shi, H.P.; Loor, J.J. Peroxisome Proliferator-Activated Receptor-γ Stimulates the Synthesis of Monounsaturated Fatty Acids in Dairy Goat Mammary Epithelial Cells via the Control of Stearoyl-Coenzyme A Desaturase. J. Dairy Sci. 2013, 96, 7844–7853. [Google Scholar] [CrossRef]
- Salmani Izadi, M.; Naserian, A.A.; Nasiri, M.R.; Majidzadeh Heravi, R.; Valizadeh, R. Evaluation of SCD and FASN Gene Expression in Baluchi, Iran-Black, and Arman Sheep. Rep. Biochem. Mol. Biol. 2016, 5, 33–39. [Google Scholar]
- Schwarz, D.S.; Blower, M.D. The Endoplasmic Reticulum: Structure, Function and Response to Cellular Signaling. Cell. Mol. Life Sci. CMLS 2016, 73, 79–94. [Google Scholar] [CrossRef]
- Man, W.C.; Miyazaki, M.; Chu, K.; Ntambi, J. Colocalization of SCD1 and DGAT2: Implying Preference for Endogenous Monounsaturated Fatty Acids in Triglyceride Synthesis. J. Lipid Res. 2006, 47, 1928–1939. [Google Scholar] [CrossRef]
- Tian, Z.; Zhang, Y.; Zhang, H.; Sun, Y.; Mao, Y.; Yang, Z.; Li, M. Transcriptional Regulation of Milk Fat Synthesis in Dairy Cattle. J. Funct. Foods 2022, 96, 105208. [Google Scholar] [CrossRef]
- Bionaz, M.; Loor, J.J. Gene Networks Driving Bovine Milk Fat Synthesis during the Lactation Cycle. BMC Genom. 2008, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Xing, X.; Wang, H.; Wan, K.; Fan, R.; Liu, C.; Wang, Y.; Wu, W.; Wang, Y.; Wang, R. SCD1 Is the Critical Signaling Hub to Mediate Metabolic Diseases: Mechanism and the Development of Its Inhibitors. Biomed. Pharmacother. 2024, 170, 115586. [Google Scholar] [CrossRef] [PubMed]
- Ricoult, S.J.H.; Yecies, J.L.; Ben-Sahra, I.; Manning, B.D. Oncogenic PI3K and K-Ras Stimulate de Novo Lipid Synthesis through mTORC1 and SREBP. Oncogene 2016, 35, 1250–1260. [Google Scholar] [CrossRef] [PubMed]
- Roe, N.D.; Handzlik, M.K.; Li, T.; Tian, R. The Role of Diacylglycerol Acyltransferase (DGAT) 1 and 2 in Cardiac Metabolism and Function. Sci. Rep. 2018, 8, 4983. [Google Scholar] [CrossRef]
- Lunzer, M.A.; Manning, J.A.; Ockner, R.K. Inhibition of Rat Liver Acetyl Coenzyme A Carboxylase by Long Chain Acyl Coenzyme A and Fatty Acid. Modulation by Fatty Acid-Binding Protein. J. Biol. Chem. 1977, 252, 5483–5487. [Google Scholar] [CrossRef]
- Danielli, M.; Perne, L.; Jarc Jovičić, E.; Petan, T. Lipid Droplets and Polyunsaturated Fatty Acid Trafficking: Balancing Life and Death. Front. Cell Dev. Biol. 2023, 11, 1104725. [Google Scholar] [CrossRef]
- Terry, A.R.; Nogueira, V.; Rho, H.; Ramakrishnan, G.; Li, J.; Kang, S.; Pathmasiri, K.C.; Bhat, S.A.; Jiang, L.; Kuchay, S.; et al. CD36 Maintains Lipid Homeostasis via Selective Uptake of Monounsaturated Fatty Acids during Matrix Detachment and Tumor Progression. Cell Metab. 2023, 35, 2060–2076. [Google Scholar] [CrossRef]
- Flowers, M.T.; Ntambi, J.M. Role of Stearoyl-Coenzyme A Desaturase in Regulating Lipid Metabolism. Curr. Opin. Lipidol. 2008, 19, 248–256. [Google Scholar] [CrossRef]
- Yang, J.; Craddock, L.; Hong, S.; Liu, Z.-M. AMP-Activated Protein Kinase Suppresses LXR-Dependent Sterol Regulatory Element-Binding Protein-1c Transcription in Rat Hepatoma McA-RH7777 Cells. J. Cell. Biochem. 2009, 106, 414–426. [Google Scholar] [CrossRef]
- Shi, H.; Luo, J.; Zhu, J.; Li, J.; Sun, Y.; Lin, X.; Zhang, L.; Yao, D.; Shi, H. PPAR γ Regulates Genes Involved in Triacylglycerol Synthesis and Secretion in Mammary Gland Epithelial Cells of Dairy Goats. PPAR Res. 2013, 2013, 310948. [Google Scholar] [CrossRef]
- Liu, Y.; Sun, D.; Li, X.; Ge, M.; Hou, Z. Research Note: Identification of Core Promoter Region of the Polyunsaturated Fatty Acid Synthesis-Related Gene Family in Chicken. Poult. Sci. 2023, 102, 102857. [Google Scholar] [CrossRef] [PubMed]
- Tumino, S.; Bognanno, M.; Chessari, G.; Tolone, M.; Bordonaro, S.; Mangano, F.; Marletta, D.; Avondo, M. Polymorphisms at Candidate Genes for Fat Content and Fatty Acids Composition: Effects on Sheep Milk Production and Fatty Acid Profile Using Two Dietary Supplementations. Animal 2023, 13, 2533. [Google Scholar] [CrossRef]
- Li, C.; Sun, D.; Zhang, S.; Liu, L.; Alim, M.A.; Zhang, Q. A Post-GWAS Confirming the SCD Gene Associated with Milk Medium- and Long-Chain Unsaturated Fatty Acids in Chinese Holstein Population. Anim. Genet. 2016, 47, 483–490. [Google Scholar] [CrossRef] [PubMed]
- Brzáková, M.; Rychtářová, J.; Čítek, J.; Sztankóová, Z. A Candidate Gene Association Study for Economically Important Traits in Czech Dairy Goat Breeds. Animal 2021, 11, 1796. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhang, T.; Xian, M.; Zhang, R.; Yang, W.; Su, B.; Yang, G.; Sun, L.; Xu, W.; Xu, S.; et al. A Draft Genome of Drung Cattle Reveals Clues to Its Chromosomal Fusion and Environmental Adaptation. Commun. Biol. 2022, 5, 353. [Google Scholar] [CrossRef]
- Du, C.; Deng, T.; Zhou, Y.; Ye, T.; Zhou, Z.; Zhang, S.; Shao, B.; Wei, P.; Sun, H.; Khan, F.A.; et al. Systematic Analyses for Candidate Genes of Milk Production Traits in Water Buffalo (Bubalus bubalis). Anim. Genet. 2019, 50, 207–216. [Google Scholar] [CrossRef]
- Gu, M.; Cosenza, G.; Iannaccone, M.; Macciotta, N.P.P.; Guo, Y.; Di Stasio, L.; Pauciullo, A. The Single Nucleotide Polymorphism g.133A>C in the Stearoyl CoA Desaturase Gene (SCD) Promoter Affects Gene Expression and Quali-Quantitative Properties of River Buffalo Milk. J. Dairy Sci. 2019, 102, 442–451. [Google Scholar] [CrossRef]
Serial Number of Templates | Primer Sequence (5′→3′) | Product Length (bp) | Annealing Temperature (°C) | Extension Time (s) | Efficiency | Purpose | |
---|---|---|---|---|---|---|---|
SCD | NM_001290915 | F: TCAGGAACTAGTCTACACTCA | 1292 | 59.70 | 65 | / | Gene isolation |
R: GTACTGTAATGGGTTAACGT | |||||||
SCD | PP950448 | F: ctcgagATGCCGGCCCACTTGCTGCA | 1093 | 59.70 | 65 | / | Construction of recombinant vector |
R: gaattcCGCCACTCTTGTAGCTTTCCT | |||||||
siRNA1-SCD | PP950448 | F: GAAAAGAACUGGAGAGGAATT | / | / | / | / | Gene interference |
R: UUCCUCUCCAGUUCUUUUCTT | |||||||
siRNA2-SCD | PP950448 | F: GGAGUCACCGAACCUACAATT | / | / | / | / | Gene interference |
R: UUGUAGGUUCGGUGACUCCTT | |||||||
siRNA-NC | / | F: UUCUCCGAACGUGUCACGUTT | / | / | / | / | Negative control |
R: ACGUGACACGUUCGGAGAATT | |||||||
SCD | NM_001290915 | F: CGTGCCGTGGTATCTGTGG | 217 | 60.00 | 20 | 2.10 | Expression-level detection |
R: AAAGGTGTGGTGGTAGTTGTGG | |||||||
SREBF2 | XM_025282779 | F: GCCAAGATGCACAAGTCTGGTGTT | 136 | 56.50 | 30 | 1.98 | Expression-level detection |
R: TGCCCTTCAGGAGCTTGCTCT | |||||||
CD36 | NM_001290838 | F: CTTACAATAATACTGCAGATG | 162 | 55.00 | 30 | 2.08 | Expression-level detection |
R: AAGGTGGAAATGAGGCTG | |||||||
SREBF1 | XM_025280442 | F: GCACCGAGGCCAAGTTGAATAA | 146 | 57.00 | 30 | 2.14 | Expression-level detection |
R: CAGGTCCTTCAGTGATTTGCTT | |||||||
SP1 | XM_025284254 | F: CAGGATGGTTCAGGTCAGATAC | 109 | 60.00 | 30 | 2.00 | Expression-level detection |
R: GCTGGAGTAGGTTTGGCATAG | |||||||
ACACA | XM_025281124 | F: CCTCTTCAGACAGGTTCAAGC | 234 | 55.00 | 30 | 1.97 | Expression-level detection |
R: TTCACCGCACACTGTTCCA | |||||||
FASN | XM_006061793 | F: AGGCCAGCTCCGAAGGCAACA | 209 | 64.30 | 30 | 2.01 | Expression-level detection |
R: TACCACGTCGGCCACTTGTGTC | |||||||
DGAT1 | NM_001290902 | F: ACAGACAAGGACGGAGACG | 268 | 55.00 | 30 | 2.04 | Expression-level detection |
R: CCACAATGACCAGGCACA | |||||||
PPARG | NM_001290893 | F: GCTCCAAGAGTACCAAAGTG | 204 | 53.70 | 30 | 2.03 | Expression-level detection |
R: GTCCTCCGGAAGAAACCCTT | |||||||
INSIG1 | NM_001290924 | F: ACGTTCAGCTCTCCTTGACATT | 239 | 55.00 | 30 | 2.11 | Expression-level detection |
R: CTGTCGTCCTATGTTTCCCAC | |||||||
ACTB | NM_001290932 | F: TGGGCATGGAATCCTG | 196 | 60.00 | 30 | 2.05 | Internal reference |
R: GGCGCGATGATCTTGAT | |||||||
Exon 1–2 | FN395259 | F: TGGACTGCCCCGAACTCCG | 1077 | 61.00 | 60 | / | SNP detection |
R: TGCATCCCAACCCCCCTAG | |||||||
Exon 3 | FN395259 | F: CAAAGGAGCCTAAGAGAT | 532 | 52.30 | 60 | / | SNP detection |
R: AACAGAGGTTCAAAAATG | |||||||
Exon 4 | FN395259 | F: CTCACCACATAACCCTCG | 761 | 54.10 | 60 | / | SNP detection |
R: TCCTTCCACTCCCCAGTA | |||||||
Exon 5 | FN395259 | F: AGTGGAAAATCAGGTAGG | 587 | 59.80 | 60 | / | SNP detection |
R: TCAGAGATGACTGGGAAG | |||||||
Exon 6 | FN395259 | F: AGAGTTTAAAAGACGAGC | 580 | 50.80 | 60 | / | SNP detection |
R: TAATGGGAACAGAAGAGA | |||||||
Promoter | NC_059179 | F: CCCAGTGCCCATCCATTTGC | 557 | 53.30 | 60 | / | SNP detection |
R: CGGACCCGACCTGCTGTGCT |
Species | Accession Number | Length (bp) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
5′UTR | E1 | E2 | E3 | E4 | E5 | E6 | CDS | 3′UTR | ||
Buffalo | NM_001290915.1 | 144 | 171 | 283 | 131 | 206 | 233 | 4060 | 1080 | 3863 |
Cattle | NM_173959.4 | 144 | 171 | 283 | 131 | 206 | 233 | 4073 | 1080 | 3876 |
Yak | XM_005892055.2 | 400 | 427 | 283 | 131 | 206 | 233 | 1963 | 1080 | 1766 |
Hybrid cattle | XM_027529175.1 | 432 | 459 | 283 | 131 | 206 | 233 | 4074 | 1080 | 3877 |
Bison | XM_010859526.1 | 395 | 422 | 283 | 131 | 206 | 233 | 4074 | 1080 | 3877 |
Goat | NM_001285619.1 | 0 | 27 | 283 | 131 | 206 | 233 | 200 | 1080 | 3 |
Sheep | NM_001009254.1 | 197 | 224 | 283 | 131 | 206 | 233 | 884 | 1080 | 687 |
Camel | XM_010974437.3 | 446 | 473 | 283 | 131 | 206 | 233 | 3967 | 1080 | 3767 |
Alpaca | XM_006210520.3 | 183 | 210 | 283 | 131 | 206 | 233 | 3965 | 1080 | 3768 |
Pig | NM_213781.1 | 176 | 203 | 283 | 131 | 206 | 233 | 4051 | 1080 | 3854 |
Rat | NM_139192.2 | 48 | 72 | 283 | 131 | 206 | 233 | 3550 | 1077 | 3353 |
Human | NM_005063.5 | 272 | 299 | 283 | 131 | 206 | 233 | 4093 | 1080 | 3896 |
Species | Number of Amino Acids | Molecular Weight (kDa) | Isoelectric Point (PI) | Instability Index (II) | Aliphatic Index (AI) | Negatively (Asp + Glu)/Positively (Arg + Lys) Charged Residues | Grand Average of Hydropathicity (GRAVY) |
---|---|---|---|---|---|---|---|
Buffalo_this study | 359 | 41.70 | 9.23 | 47.21 | 87.24 | 32/41 | –0.19 |
Cattle | 359 | 41.71 | 9.22 | 43.99 | 86.43 | 33/42 | –0.23 |
Yak | 359 | 41.73 | 9.22 | 44.41 | 86.96 | 33/42 | –0.23 |
Hybrid cattle | 359 | 41.71 | 9.22 | 43.99 | 86.43 | 33/42 | –0.23 |
Bison | 359 | 41.73 | 9.22 | 45.64 | 86.96 | 33/42 | –0.23 |
Goat | 359 | 41.58 | 9.19 | 45.66 | 87.49 | 33/42 | –0.18 |
Sheep | 359 | 41.67 | 9.24 | 44.83 | 87.21 | 33/42 | –0.20 |
Camel | 359 | 41.51 | 9.23 | 43.82 | 87.49 | 32/42 | –0.17 |
Alpaca | 359 | 41.65 | 9.23 | 46.68 | 86.16 | 32/42 | –0.18 |
Pig | 359 | 41.38 | 9.23 | 47.35 | 89.16 | 32/42 | –0.17 |
Rat | 358 | 41.47 | 9.30 | 48.06 | 86.40 | 32/42 | –0.24 |
Human | 359 | 41.52 | 9.07 | 44.84 | 84.79 | 33/40 | –0.19 |
Functional Modification Sites | Serial No. | Location (AA) and Amino Composition |
---|---|---|
Casein kinase II phosphorylation site | PS00006 | 58–61: TyqD, 164–167: SetD, 166–169: TdaD, 309–312: SasE, 351–354: TgeE |
Protein kinase C phosphorylation site | PS00005 | 95–97: TcK, 124–126: ShR, 127–129: TyK, 173–175: SrR, 355–357: SyK |
N-myristoylation site | PS00008 | 85–90: GAlyGI, 114–119: GItaGA, 141–146: GNtmAF, 197–202: GstlNL, 257–262: GLnvTW |
N-glycosylation site | PS00001 | 201–204: NLSD, 259–262: NVTW, 318–321: NFTT |
cAMP- and cGMP-dependent protein kinase phosphorylation | PS00004 | 337–340: KKvS |
Tyrosine kinase phosphorylation site 2 | PS00007 | 349–356: KrtgEesY |
Structures | Buffalo_This Study | Cattle | Yak | Hybrid Cattle | Bison | Goat | Sheep |
---|---|---|---|---|---|---|---|
Random coil (%) | 47.63 | 48.75 | 45.96 | 48.75 | 48.19 | 48.75 | 48.75 |
Alpha helix (%) | 37.05 | 35.93 | 37.88 | 35.93 | 36.49 | 37.05 | 37.05 |
Beta turn (%) | 4.74 | 4.46 | 5.01 | 4.46 | 5.01 | 3.34 | 3.34 |
Extended strand (%) | 10.58 | 10.86 | 11.14 | 10.86 | 10.31 | 10.86 | 10.86 |
Population | SNPs | Genotype/Individual Number | Allele Frequency | Expected Heterozygosity | p Value 1 | |||
---|---|---|---|---|---|---|---|---|
WW | Wm | mm | W | m | ||||
River buffalo | c.-603G>A | 83 | 77 | 24 | 0.6604 | 0.3396 | 0.4528 | 0.3768 |
c.-605A>C | 167 | 17 | 0 | 0.9528 | 0.0472 | 0.0907 | 0.1030 | |
c.609C>T | 178 | 6 | 0 | 0.9828 | 0.0172 | 0.0341 | 0.8940 | |
c.617G>A | 142 | 36 | 6 | 0.8678 | 0.1322 | 0.2307 | 0.1450 | |
c.621C>T | 171 | 11 | 2 | 0.9598 | 0.0402 | 0.0777 | 0.0089 | |
c.633G>A | 80 | 80 | 24 | 0.6552 | 0.3448 | 0.4545 | 0.7148 | |
c.867A>C | 129 | 17 | 38 | 0.7500 | 0.2500 | 0.3846 | 0.0005 | |
c.878T>C | 36 | 17 | 131 | 0.2417 | 0.7583 | 0.3577 | 0.0001 | |
c.987C>A | 17 | 74 | 93 | 0.3000 | 0.7000 | 0.4308 | 0.7405 | |
Swamp buffalo | c.-603G>A | 23 | 15 | 2 | 0.7625 | 0.2375 | 0.3668 | 0.0211 |
c.-605A>C | 36 | 4 | 0 | 0.9625 | 0.0375 | 0.0731 | 0.0400 | |
c.504T>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.507T>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.581T>A | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.594T>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.609C>T | 31 | 7 | 2 | 0.8529 | 0.1471 | 0.2585 | 0.1488 | |
c.702G>A | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.716G>A | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.778A>G | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.819T>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.842G>A | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.867A>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 | |
c.878T>C | 38 | 0 | 2 | 0.9412 | 0.0588 | 0.0816 | 0.0000 |
Haplotype | Alleles | Actual Frequency | Expected Frequency |
---|---|---|---|
Buffalo_hap1 | TTTTCACGGGATGATC | 0.0549 | 0.0195 |
Buffalo_hap2 | TTTTCACGGGATGATA | 0.0797 | 0.0173 |
Buffalo_hap3 | TTTTCACGGGATGACC | 0.0201 | 0.0124 |
Buffalo_hap4 | TTTTCACGGGATGCTC | 0.0094 | 0.0064 |
Buffalo_hap5 | TTTTCACGGGATGCCA | 0.0060 | 0.0079 |
Buffalo_hap6 | TTTTCACAGGATGATC | 0.2698 | 0.0725 |
Buffalo_hap7 | TTTTCACAGGATGATA | 0.0671 | 0.0365 |
Buffalo_hap8 | TTTTCACAGGATGCTC | 0.0193 | 0.0195 |
Buffalo_hap9 | TTTTCACAGGATGCTA | 0.0115 | 0.0128 |
Buffalo_hap10 | TTTTCACAGGATGCCC | 0.1413 | 0.0621 |
Buffalo_hap11 | TTTTCATAGGATGATC | 0.0089 | 0.0074 |
Buffalo_hap12 | TTTTCGCGGGATGATC | 0.1960 | 0.0078 |
Buffalo_hap13 | TTTTCGCGGGATGATA | 0.0053 | 0.0053 |
Buffalo_hap14 | TTTTCGCAGGATGATC | 0.0032 | 0.0027 |
Buffalo_hap15 | TTTTCGTGGGATGATC | 0.0147 | 0.0035 |
Buffalo_hap16 | TTTTTGCGGGATGATC | 0.0378 | 0.0021 |
Buffalo_hap17 | CCACCGCGAAGCACCC | 0.0094 | 0.0005 |
Population | SNP | Genotype | Milk Yield (kg/d) | Milk Fat Rate (%) | Milk Protein Rate (%) | Lactose Rate (%) |
---|---|---|---|---|---|---|
River buffalo | c.-603G>A | GG (83) | 5.4567 ± 0.3401 | 6.3540 ± 0.2311 | 4.2387 ± 0.0949 | 5.0844 ± 0.0556 |
GA (76) | 5.8084 ± 0.3785 | 6.7888 ± 0.2571 | 4.3900 ± 0.1056 | 5.0355 ± 0.0618 | ||
AA (25) | 5.5943 ± 0.6555 | 6.2468 ± 0.4453 | 4.2324 ± 0.1829 | 5.1578 ± 0.1071 | ||
c.-605A>C | AA (166) | 5.5179 ± 0.2462 A | 6.5361 ± 0.1734 | 4.2965 ± 0.0702 | 5.0827 ± 0.0409 | |
AC (18) | 7.6644 ± 0.7629 B | 6.4773 ± 0.5373 | 4.0449 ± 0.2175 | 5.1626 ± 0.1266 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dao, W.; Fan, X.; Liang, J.; Chen, T.; Chang, Z.; Zhang, Y.; Miao, Y. Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals 2024, 14, 3191. https://doi.org/10.3390/ani14223191
Dao W, Fan X, Liang J, Chen T, Chang Z, Zhang Y, Miao Y. Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals. 2024; 14(22):3191. https://doi.org/10.3390/ani14223191
Chicago/Turabian StyleDao, Wenbin, Xinyang Fan, Jianping Liang, Tao Chen, Zaoshang Chang, Yongyun Zhang, and Yongwang Miao. 2024. "Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis" Animals 14, no. 22: 3191. https://doi.org/10.3390/ani14223191
APA StyleDao, W., Fan, X., Liang, J., Chen, T., Chang, Z., Zhang, Y., & Miao, Y. (2024). Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals, 14(22), 3191. https://doi.org/10.3390/ani14223191