Next Article in Journal
Multi-View Fusion-Based Automated Full-Posture Cattle Body Size Measurement
Previous Article in Journal
Association of Equine Squamous and Glandular Gastric Disease with Dental Status in 54 Horses
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis

1
College of Animal Science and Technology, Yunnan Agricultural University, Kunming 650201, China
2
Institute of Animal Genetics and Breeding, Yunnan Agricultural University, Kunming 650201, China
3
Science and Technology Innovation Center of Dehong Prefecture, Mangshi 678400, China
4
Mangshi Animal Husbandry Station, Mangshi 678400, China
5
College of Veterinary Medicine, Yunnan Agricultural University, Kunming 650201, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2024, 14(22), 3191; https://doi.org/10.3390/ani14223191
Submission received: 26 September 2024 / Revised: 30 October 2024 / Accepted: 5 November 2024 / Published: 7 November 2024
(This article belongs to the Section Animal Genetics and Genomics)

Simple Summary

SCD plays a crucial role in the synthesis of monounsaturated fatty acids in dairy cows; however, its role in the mammary gland of buffalo is not well understood. In this study, the buffalo SCD gene CDS was isolated and characterized, and its molecular characterization, tissue expression, functions, and polymorphisms were analyzed. The results showed that the molecular characterization of buffalo SCD was similar to that of other Bovidae species, and its expression level in the mammary gland during lactation was significantly higher than during dry-off period period. Functional experiments revealed that SCD plays an important role in the endoplasmic reticulum of BuMECs for fatty acid synthesis in milk. Additionally, we found that c.-605A>C in the SCD gene was associated with milk yield in buffalo. These findings provide new perspectives for comprehending the mechanism of milk fat synthesis in buffalo and provide the basis for the selection of buffalo lactation traits.

Abstract

The SCD is a rate-limiting enzyme that catalyzes the synthesis of monounsaturated fatty acids (MUFAs) in dairy cows; however, its role in the mammary gland of buffalo is not well understood. In this study, we isolated and characterized the complete coding sequence (CDS) of the buffalo SCD gene from mammary gland tissue and investigated its effects on milk fat synthesis using bioinformatics analyses, tissue differential expression detection, and cellular functional experiments. The cloned SCD gene has a CDS length of 1080 bp, encoding a protein of 359 amino acids. This protein is hydrophilic, lacks a signal peptide, and contains four transmembrane domains, including 10 conserved motifs and a Delta9-FADS domain, characteristic of the fatty acid desaturase family involved in unsaturated fatty acid biosynthesis within the endoplasmic reticulum. Molecular characterization revealed that the physicochemical properties, conserved domains, structures, and functions of buffalo SCD are highly similar to those in other Bovidae species. Among the tissues analyzed, SCD expression was highest in the mammary gland during lactation and in the cerebellum during dry-off period. Notably, SCD expression in the mammary gland was significantly higher during lactation compared to the dry-off period. Subcellular localization experiments confirmed that SCD functions in the endoplasmic reticulum of buffalo mammary epithelial cells (BuMECs). Functional overexpression and interference experiments in BuMECs demonstrated that SCD promotes milk fat synthesis by affecting the expression of lipid synthesis-related genes such as ACACA, FASN, and DGAT1, as well as milk fat regulatory genes like SREBFs and PPARG, thereby influencing intracellular triglyceride (TAG) content. Additionally, 18 single-nucleotide polymorphisms (SNPs) were identified in the buffalo SCD gene, with a specific SNP at c.-605, showing potential as molecular markers for improving milk production traits. These findings highlight that the SCD gene is a key gene in buffalo milk fat synthesis, involved in the de novo synthesis of milk fatty acids.

1. Introduction

SCD, also known as delta-9 desaturase, fatty acid desaturase 5 (FADS5), stearoyl-CoA desaturase 1 (SCD1), or stearoyl-CoA desaturase opposite strand (SCDOS) (as referenced in the GeneCards database: https://www.genecards.org/, accessed on 28 June 2024), belongs to the family of fatty acid desaturases. The SCD gene was first identified in the liver of rats [1]. The enzyme it encodes, SCD, resides in the endoplasmic reticulum, where it catalyzes the formation of a cis-double bond at the delta-9 position of substrates, making it the rate-limiting enzyme in the de novo synthesis of MUFA [2,3]. In humans, SCD is expressed in adipose tissue, heart, brain, liver, and lungs, with the highest expression observed in adipose tissue [4]. In cattle, the highest expression of the SCD gene is also found in adipose tissue, followed by the heart, brain, and muscle [5]. In cattle mammary glands, SCD exhibits higher catalytic activity towards the substrate of long-chain saturated fatty acids than other substrates, and a total of 14 SNPs have been identified in the promoter region, intron 1, exon 5, and 3’UTR of this gene, in which the milk from cows carrying the rs523411937 CT genotype had significantly lower levels of C15:0 than that from individuals with the CC genotype [6]. Furthermore, at the g.10329C>T locus of the SCD gene in Angus cattle, the intermuscular monounsaturated fatty acid content of individuals carrying the C allele was significantly higher than that of individuals carrying the T allele [7].
To date, the SCD gene has been isolated in several domesticated bovids, including sheep, goats, cattle, and buffalo. The cattle SCD gene is located on BAT26 and spans 17,088 bp, comprising six exons and five introns, with an mRNA length of 5287 bp and a CDS of 1080 bp encoding 359 amino acids [8,9]. In buffalo, the SCD gene is located on BBU23, with a total length of 15,166 bp, which also includes six exons and five introns, with an mRNA length of 5082 bp and a CDS length of 1080 bp (https://www.ncbi.nlm.nih.gov/, accessed on 28 June 2024). In goat, the SCD gene is located on CHI26, with a full gene length of 1138 bp and a CDS length of 1080 bp (https://www.ncbi.nlm.nih.gov/, accessed on 28 June 2024). SCD plays a crucial role in various physiological processes related to lipid metabolism [10,11], and it has the potential to be a candidate gene for improving milk and meat quality. However, the specific role and mechanisms of the SCD gene in milk fat synthesis in buffalo remain unclear.
The buffalo (Bubalus bubalis) is an important source of meat, milk, and draft power in many tropical and subtropical countries [12]. Domestic buffalo are categorized into river and swamp types, with the river type primarily used for milk production and the swamp type mainly for draft purposes. Compared to Holstein cow milk, buffalo milk contains higher levels of total solids, fat, and protein [13]. The fatty acid composition of buffalo milk is approximately 70.49% saturated fatty acids (SFAs), 25.95% monounsaturated fatty acids (MUFAs), and 3.54% polyunsaturated fatty acids (PUFAs), with palmitic acid (C16:0), oleic acid (C18:1), myristic acid (C14:0), and stearic acid (C18:0) as the main fatty acids [14]. In dairy cow milk, SFAs, MUFAs, and PUFAs account for approximately 70%, 25%, and 2.3%, respectively, with similar main fatty acids [15]. Due to the nutritional advantages of buffalo milk, buffalo have become the second-largest source of milk worldwide [16]. Investigating the functions and molecular mechanisms of lactation-related genes in buffalo will provide a foundation for breeding and nutritional regulation. In this study, the SCD gene of buffalo was isolated and identified, and the gene was further studied using bioinformatics analysis, tissue differential expression detection, cell function testing, and association analysis between variation and traits, in order to reveal the role and mechanism of the SCD gene in the synthesis of buffalo milk fat and provide a basis for the breeding of lactation traits in buffalo.

2. Materials and Methods

2.1. Animal Sources and Sample Collection

Sample collection for gene cloning and tissue differential expression analysis involved six healthy adult female Binglangjiang buffalo, three in lactation (about 60 d postpartum) and three in dry-off (about 60 d before parturition), which were approximately 5 years old and were selected from a Binglangjiang Buffalo Farm in Tengchong, Yunnan Province, China. The buffalo, all unrelated by blood and maintained under identical conditions, were subjected to tissue sample collection post-slaughter. The buffalo slaughtering was carried out in accordance with the Operating Procedures of Cattle Slaughtering (GB/T 19477-2004) [17]. Tissue samples from the heart, liver, spleen, lungs, kidneys, muscles, brain, cerebellum, mammary gland, pituitary gland, small intestine, rumen, skin, and ovary were immediately frozen in liquid nitrogen and transported to the laboratory for RNA extraction.
Blood samples for population variation detection were collected from 184 Binglangjiang buffalo (river type) and 40 Dehong buffalo (swamp type) from farms in Tengchong and Mangshi, Yunnan Province, China, respectively. All buffalo were adult and unrelated by blood. About 5 mL of blood were drawn from the jugular vein, placed in EDTA-anticoagulated tubes, and transported to the lab at a low temperature for DNA extraction.

2.2. RNA Extraction, cDNA Synthesis, and DNA Extraction

RNA extraction from tissue samples was performed using Trizol reagent (Invitrogen, USA). RNA concentration and purity assessment utilized a NanoDrop 2000 UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), with RNA integrity confirmation via 1% agarose gel electrophoresis. The synthesis of cDNA employed the PrimeScript™ RT reagent Kit (TaKaRa, Dalian, China), with dilution to 100 ng/µL and storage at −20 °C for subsequent use.
Genomic DNA extraction from blood samples was conducted using the phenol/chloroform method [18], with concentration and purity measurement performed by a NanoDrop 2000 UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The extracted DNA was diluted to 100 ng/µL in TE buffer (Servicebio, Wuhan, China) and stored at 4 °C.

2.3. Isolation and Identification of Buffalo SCD

Primers for isolating the buffalo SCD CDS were designed using Primer Premier 5 software [19] based on the buffalo mRNA sequence (NM_001290915 [20]) (Table 1). The PCR reaction (20 μL) included 1 μL of mammary cDNA template, 1 μL of each primer, 12 μL of 2 × PCR Master Mix (CWBIO, Beijing, China), and 5 μL of ddH2O. The reaction involved pre-denaturation at 94 °C for 5 min, followed by 34 cycles of denaturation at 94 °C for 30 s, annealing at 59.7 °C for 30 s, and extension at 72 °C for 65 s, with a final extension at 72 °C for 8 min and termination at 4 °C. PCR products were detected via 1% agarose gel electrophoresis. The target band was excised and purified using the TIANgel kit (TIANGEN, Beijing, China). The purified products were ligated into the pMD-18T vector (TaKaRa, Dalian, China) and cloned. Thirty monoclonal colonies were selected for bidirectional sequencing.
Sequence proofreading employed SeqMan within the Lasergene software package version 7.1 (DNAStar, Inc., Madison, WI, USA), with Open Reading Frame (ORF) identification conducted using the ORF Finder program (https://www.ncbi.nlm.nih.gov/orffinder/, last accessed on 5 May 2024). Verification of the SCD gene sequence was conducted through a homology search using the NCBI BLAST program (https://blast.ncbi.nlm.nih.gov/Blast.cgi, last accessed on 5 May 2024).

2.4. Molecular Characterization, Structure, and Function Analysis

To elucidate the sequence characterization of the buffalo SCD gene, the SCD gene and its encoded protein sequences of 12 species were retrieved from the NCBI database for comparative analysis (Table 2). Gene structure determination employed GTF files from the NCBI database (https://www.ncbi.nlm.nih.gov/datasets/, last accessed on 28 June 2024), which were processed using TBtools [21] and visualized using the Gene Structure Display Server 2.0 [22]. Analysis of SCD consistency and divergence was conducted using MegaAlign within the Lasergene 7 software package (DNAStar, Inc., Madison, WI, USA). Phylogenetic analysis of the SCD protein utilized the maximum likelihood method (JTT+G matrix model) in MEGA7 [23]. Identification of conserved motifs was performed using the MEME website [24], and conserved domains were analyzed using the NCBI Batch Web Search tool (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi, last accessed on 28 June 2024), with results visualized using TBtools. Prediction of the physicochemical properties of the SCD protein was carried out using ProtParam [25]. Prediction of secondary and three-dimensional structures was carried out using SOPMA [26] and SWISS-MODEL [27], respectively. Prediction of SCD amino acid modification sites was conducted using Prosite Scan [28]. The hydrophilicity, signal peptide, and transmembrane domain of SCD were predicted using the online software ProtScale 1.0 [25], the SignalP5.0 server [29], and the TMHMM 2.0 server [30], respectively. Protein interaction prediction employed STRING [31], and subcellular localization prediction was carried out using ProtComp (http://www.softberry.com/, accessed on 28 June 2024). Functional and biological process analysis was performed using InterProScan [32] and the DAVID [33].

2.5. Tissue Differential Expression Analysis

SCD gene expression across various tissues was quantified using an iQ5 Real-Time PCR instrument (Bio-Rad, Hercules, CA, USA). Primers were designed with Primer Premier 5, as shown in Table 1. RT-qPCR was performed using SYBR Green Real-Time PCR Mix (Takara, Dalian, China) according to the manufacturer’s instructions. The β-actin (ACTB) gene served as the internal reference for normalizing gene expression. Amplification efficiency was assessed using the LinRegPCR program, with all experiments performed in triplicate. Data analysis and visualization were conducted using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA, USA). RT-qPCR data were analyzed using the 2−∆∆Ct method. Statistical analysis was performed using one-way ANOVA and Tukey’s method, with a significance threshold set at p < 0.05.

2.6. Functional Analyses at the Cellular Level

2.6.1. Cell Culture

BuMECs previously isolated and characterized in our laboratory [34] were used in this study. The BuMECs were cultured in DMEM (Gibco, New York, NY, USA) supplemented with 5 μg/mL hydrocortisone (Sigma, St. Louis, MO, USA), 5 μg/mL insulin (Sigma, St. Louis, MO, USA), 1 μg/mL epidermal growth factor (Sigma, St. Louis, MO, USA), 2% penicillin/streptomycin (Gibco, USA), and 10% fetal bovine serum (Gibco, USA). Incubation occurred at 37 °C in a humidified atmosphere containing 5% CO2, with medium changes every 48 h. Lactation induction was performed with 3 µg/mL prolactin (Sigma, St. Louis, MO, USA) prior to the experiment [35].

2.6.2. Construction of Overexpression Recombinant Vectors

Buffalo mammary tissue cDNA was used to amplify the SCD gene CDS without a stop codon (primer details shown in Table 1). PCR systems and procedures are described in Section 2.3. The amplified product was ligated into the pMD18-T vector (TaKaRa, Dalian, China) for cloning. Following dual enzymatic digestion, it was ligated into the pEGFP-N1 vector, and the recombinant vector pEGFP-N1-SCD was constructed. All vector constructs were verified by restriction digestion and sequencing.

2.6.3. SCD Overexpression in BuMECs

Culturing of BuMECs in six-well plates proceeded until cell confluence reached 70–80%. The transfection of the pEGFP-N1-SCD recombinant vector into the BuMECs was executed following the instructions provided with the TransIntro® EL Transfection Reagent (TransGen Biotech, Beijing, China). The transfection of pEGFP-N1 served as a negative control. Forty-eight hours post-transfection, the BuMECs were collected for subsequent RT-qPCR analysis.

2.6.4. SCD Interference in BuMECs

The design and synthesis of two siRNAs targeting the SCD CDS (siRNA1-SCD and siRNA2-SCD), along with a non-specific control (NC) siRNA, were carried out by Shanghai Bioengineering Co., with details provided in Table 1. The transfection of the siRNA with the highest interference efficiency (100 nM) into BuMECs was performed when the cultured cells reached 70–80% confluence in a six-well plate, following the instructions for the TransIntro® EL Transfection Reagent (TransGen Biotech, Beijing, China). Forty-eight hours post-transfection, the BuMECs were harvested for RT-qPCR analysis.

2.6.5. qPCR Analysis of Genes Related to Milk Fat Synthesis

RT-qPCR was used to detect the expression of genes related to milk fat synthesis in BuMECs, with ACTB as an internal reference. Primer details are provided in Table 1, and all target gene amplification products were verified by sequencing. RT-qPCR data were analyzed using the 2−∆∆Ct method. All data are expressed as means ± SEM. Statistical analysis was performed using Student’s t-test, with significance thresholds of p < 0.05 (significant) and p < 0.01 (highly significant).

2.7. Subcellular Localization of SCD in BuMECs

After transfecting the BuMECs after 48 h with the constructed pEGFP-N1-SCD recombinant vector, mitochondria and nuclei were stained with 200 nM Mito-Tracker Red CMXRos (Beyotime, Shanghai, China) and Hoechst 33342 (Beyotime, Shanghai, China), respectively. Observation of SCD protein localization was carried out using a confocal laser scanning microscope (OLYMPUS, Tokyo, Japan).

2.8. Polymorphism Detection and Association Analysis

Primers were designed using Primer Premier 5 to detect polymorphisms in the SCD CDS and promoter region (−565–−41, recorded with the first nucleotide of the start codon in the buffalo SCD gene coding sequence as +1) using sequences FN395259 and NC_059179 as templates (Table 1). The PCR reaction system (total volume 25 µL) consisted of 1 µL of DNA template (100 ng/µL), 2.5 µL of PCR buffer (Mg2+ Plus), 0.4 µL of each primer (10 μM), 2.0 µL of dNTP (2.5 mM), 0.3 µL of rTaq enzyme (5 U/µL), and 18.4 µL of ddH2O. The PCR protocol included an initial denaturation at 95 °C for 5 min, followed by 34 cycles of denaturation at 95 °C for 40 s, annealing at 50.8–61 °C (Table 1) for 40 s, and extension at 72 °C for 60 s, with a final extension at 72 °C for 5 min and termination at 4 °C. Detection of PCR products was achieved by 1% agarose gel electrophoresis, followed by bidirectional sequencing at Shanghai Sangong Biological Engineering Co.
Sequence analysis involved comparison, mutation site identification, and output using SeqMan in the Lasergene 7 software package (DNAStar, Inc., Madison, WI, USA). Estimations of genotype and gene frequencies, along with Hardy–Weinberg equilibrium tests, were conducted using PopGen 32 software [36]. Prediction of the impact of amino acid substitutions on protein function was performed using the PANTHER program (http://www.pantherdb.org/, last accessed on 28 June 2024).
The association analysis between SNP genotypes within the SCD gene CDS and promoter region and observed lactation traits in buffalo was conducted using the following model: Yijm = μ + Gi + eijm; where Yijm represents the observed value of the lactation trait, μ is the population mean, Gi is the effect of the i-type of the SNP locus, and eijm is the random error. Statistical analysis was conducted using the General Linear Model (GLM) procedure in SAS 9.3 software (SAS Inc., Cary, NC, USA). Results were expressed as least square means ± standard error, with statistical significance determined at p < 0.05 (significant) and p < 0.01 (highly significant).

3. Results

3.1. Isolation and Identification of SCD Sequence

The PCR product had a length of 1293 bp (Figure 1), and sequencing of the positive monoclonal bacterial liquid revealed only a single transcript. The ORF Finder program identified the CDS as 1080 bp. A homology search in the NCBI database revealed that this CDS shares over 98.15% similarity with the SCD CDS of other Bovidae species. Consequently, the sequence was confirmed as the buffalo SCD sequence and has been submitted to the NCBI database under accession number PP950448. The nucleotide composition of the SCD gene CDS is as follows: A accounts for 24.35%, T for 24.54%, C for 27.41%, and G for 23.70%. The G+C content is 51.11%, and the A + T content is 48.89% (Figure 2).

3.2. Structure of the Transcript Region

To investigate the structural characteristics of the buffalo SCD transcript region, we aligned the buffalo SCD sequence with homologous sequences from 11 other mammals (Figure 3). To date, only a single SCD mRNA sequence has been reported for each Bovidae species, including buffalo, cattle, yak, hybrid cattle (zebu × cattle), bison, goat, and sheep, all of which consist of six exons, with a CDS length of 1080 bp (Table 2). With the exception of exon 1 and exon 6, the exon lengths were conserved across Bovidae species (Table 2). Additionally, the UTR lengths varied between buffalo and most other species (Table 2, Figure 3). Notably, the SCD gene in buffalo, cattle, sheep, camel, pig, and human are located on the sense strand, whereas in bison, yak, hybrid cattle, alpaca, goat, and rat, they are found on the antisense strand (Figure 3). Overall, the buffalo SCD gene has a similar transcript structure to other mammals, particularly in its coding region (Figure 3).

3.3. Physicochemical Characteristics and Functional Modification Sites of Buffalo SCD

To reveal the physicochemical characteristics of buffalo SCD, the protein sequence encoded by the buffalo SCD gene was analyzed using bioinformatics and compared with SCD proteins from other Bovidae species. The results showed that the physicochemical characteristics of buffalo SCD are similar to those of other Bovidae species (Table 3). The instability index and overall average hydrophilicity of the buffalo SCD protein were 47.21 and −0.193, respectively, indicating that the protein is unstable and hydrophilic. The buffalo SCD protein lacks a signal peptide but contains four transmembrane domains (TMhelix1: AA71–93, TMhelix2: AA98–120, TMhelix3: AA221–238, TMhelix4: AA251–273). Both buffalo’s and other Bovidae species’ SCD proteins have six potential functional modification sites: casein kinase II phosphorylation sites (AA58–61, 164–167, 166–169, 309–312, 351–354), protein kinase C phosphorylation sites (AA95–97, 124–126, 127–129, 173–175, 355–357), N–myristoylation sites (AA85–90, 114–119, 141–146, 197–202, 257–262), N–glycosylation sites (AA201–204, 259–262, 318–321), cAMP– and cGMP–dependent protein kinase phosphorylation sites (AA337–340), and tyrosine kinase phosphorylation site 2 (AA349–356) (Table 4).

3.4. Sequence Identity and Phylogeny, Motif Composition, and Conserved Structural Domain Analysis

Sequence analysis showed that the amino acid sequences of buffalo SCD identified closely with those of other Bovidae species, which ranged from 94.2% to 99.7%. Among them, the SCD of buffalo in this study showed 97.5% similarity with that of cattle, and 98.1% similarity with that of yak and bison (Figure 4). Phylogenetic analysis based on SCD amino acid sequences showed that buffalo and other Bovidae species clustered in a single branch, suggesting that SCD sequences among Bovidae species differ little and are functionally similar (Figure 5A). Further analysis showed that both buffalo and other mammals contain ten similar motifs (except for rat, which is missing motif 10, Figure 5B) and a conserved structural domain of Delta9-FADS (Figure 5C), which is part of the fatty acid desaturase family. The Delta9-FADS-like domain contains motif 1, motif 2, motif 4, and motif 7 (Figure 5).

3.5. Secondary and Tertiary Structure of Buffalo SCD

The predicted secondary structure of the buffalo SCD protein closely resembles that of SCD proteins from other Bovidae species (Table 5). The random coil content of buffalo SCD differs from that of bison by only 0.56%. The α-helix content in buffalo is identical to that of goats and sheep, with all having a value of 37.05%. The β-turn content in buffalo varies by only 0.27% compared to bison and yak, while the extended strand content differs from bison by only 0.28%. The three-dimensional (3D) structure of the buffalo SCD protein, constructed using homology modeling, is shown in Figure 6. The template for this model is A0A1S3F9W9.1.A (Ord’s kangaroo rat), with a sequence identity of 81.51% and 100% coverage. The 3D structure of the buffalo SCD protein is highly similar to that of other Bovidae species (Figure 6).

3.6. Protein Interactions, Biological Processes, and Molecular Functions

The prediction results indicate that buffalo SCD protein is primarily involved in the biological process (BP) of the monounsaturated fatty acid biosynthetic process (GO:1903966, https://www.ebi.ac.uk/QuickGO/, accessed on 28 June 2024). Its interacting proteins include acetyl-CoA carboxylase alpha (ACACA), fatty acid synthase (FASN), elovl fatty acid elongase 6 (ELOVL6), stearoyl-CoA desaturase 5 (SCD5), 3-hydroxyacyl-CoA dehydratase 2 (HACD2), 3-hydroxyacyl-CoA dehydratase 2 (HACD3), 3-hydroxyacyl-CoA dehydratase 4 (HACD4), hydroxysteroid 17-beta dehydrogenase 12 (HSD17B12), estradiol 17-beta-dehydrogenase 12-like (LOC508455 [37]), and trans-2-enoyl-CoA reductase (TECR). These interacting proteins are all lipid metabolism-related proteins. In terms of cellular component (CC), buffalo SCD is classified as an endoplasmic reticulum membrane protein (GO:0005789, GO:0016020, GO:0030176, https://www.ebi.ac.uk/QuickGO/, accessed on 28 June 2024). Its molecular functions (MFs) include stearoyl-CoA 9-desaturase activity (GO:0004768, https://www.ebi.ac.uk/QuickGO/, accessed on 28 June 2024), oxidoreductase activity acting on paired donors to reduce molecular oxygen to two water molecules (GO:0016717, https://www.ebi.ac.uk/QuickGO/, accessed on 28 June 2024), and metal ion binding (GO:0046872, https://www.ebi.ac.uk/QuickGO/, accessed on 28 June 2024). In addition, SCD is involved in the PPAR and AMPK signaling pathways.

3.7. Tissue Differential Expression

In the 15 tissues of lactating buffalo examined, the SCD gene expression was highest in the mammary gland, followed by the muscle, brain, skin, cerebellum, and liver, with the lowest expression in the small intestine, spleen, and rumen (Figure 7A). In the 15 tissues of dry-off period buffalo examined, the highest expression of the SCD gene was found in the cerebellum, followed by the brain, heart, abomasum, muscle, and liver, with the lowest expression in the spleen, mammary gland, kidney, and rumen (Figure 7B). Compared to other tissues, the SCD gene showed higher expression levels in the brain, muscle, and liver in both physiological periods, and lower expression levels in the spleen, kidney and rumen. It is noteworthy that the expression level of the SCD gene in the mammary gland of buffalo was significantly higher in lactation than in dry-off period (Figure 7C).

3.8. Subcellular Localization of the Buffalo SCD

Subcellular localization predictions indicated that the buffalo SCD protein primarily functions in the endoplasmic reticulum membrane (score of 9.12), followed by the cell membrane (score of 0.83) and the nucleus (score of 0.05). To verify the distribution of SCD in BuMECs, we conducted subcellular localization experiments. After transfecting BuMECs with the constructed recombinant vector pEGFP-N1-SCD, the results showed that the green fluorescent protein (GFP) mainly overlapped with the red fluorescence of the mitochondria in the cytoplasm, while it did not overlap with the blue fluorescence of the nucleus (Figure 8), indicating that the buffalo SCD protein primarily functions in the cytoplasm.

3.9. Effects of SCD Overexpression on Lipid Synthesis-Related Genes in BuMECs

The recombinant vector pEGFP-N1-SCD was transfected into the BuMECs, with pEGFP-N1 used as the negative control. qPCR results showed that the abundance of SCD mRNA in BuMECs increased significantly (~87-fold, p < 0.001) compared to the control group (Figure 9A). At the same time, SCD overexpression led to an increase in the mRNA abundance of ACACA (~3.43-fold), FASN (~2.22-fold), and diacylglycerol O-acyltransferase 1 (DGAT1) (~2.74-fold), which are involved in de novo fatty acid synthesis and fatty acid esterification. However, the mRNA abundance of CD36, which is involved in fatty acid uptake and transport, decreased by 85% (Figure 9B), indicating that SCD overexpression positively impacts the expression of genes related to de novo milk fat synthesis. Furthermore, the mRNA abundance of key regulatory genes in milk fat synthesis, including sterol regulatory element-binding transcription factor 1 (SREBF1) (~2.13-fold), sterol regulatory element-binding transcription factor 2 (SREBF2) (~3.68-fold), peroxisome proliferator-activated receptor gamma (PPARG) (~2.78-fold), and SP1 transcription factor (~1.94-fold), also increased, while insulin-induced gene 1 (INSIG1) mRNA abundance significantly decreased by 65% (Figure 9C). This suggests that SCD overexpression affects the expression of core genes regulating milk fat synthesis. To determine the effect of SCD overexpression on TAG accumulation in the BuMECs, we measured the changes in TAG content. Accompanying SCD overexpression, the TAG levels in the BuMECs significantly increased by ~1.34-fold (p < 0.01) (Figure 9D).

3.10. Effects of SCD Knockdown on Lipid Synthesis-Related Genes in BuMECs

To assess the interference efficiency of two siRNAs targeting the SCD gene, siRNA-NC (negative control), siRNA1-SCD, and siRNA2-SCD were transfected into the BuMECs. The results showed that compared to the siRNA-NC control group, the mRNA abundance of SCD decreased by 87% after transfection with siRNA1-SCD (p < 0.001) and by 92% after transfection with siRNA2-SCD (p < 0.001) (Figure 10A). Since siRNA2-SCD exhibited higher interference efficiency, it was selected for subsequent cell transfection experiments.
siRNA2-SCD was transfected into the BuMECs to achieve SCD knockdown. The expression levels of genes related to milk fat synthesis were further analyzed following SCD knockdown. The mRNA abundance of ACACA and FASN, which are involved in de novo milk fat synthesis; CD36, which is involved in fatty acid uptake; DGAT1, which is associated with fatty acid esterification; and SREBF1, SREBF2, PPARG, and SP1, which regulate milk fat synthesis, decreased by 59%, 90%, 57%, 6%, 62%, 53%, 39%, and 33%, respectively, compared to the control group (p < 0.01 or p < 0.05). In contrast, the mRNA abundance of INSIG1 increased by 1.89-fold (p < 0.01). Notably, SCD knockdown resulted in a 30% reduction in TAG content in the BuMECs (p < 0.01; Figure 10D).

3.11. Population Genetic Analysis and Association Analysis

A total of 16 SNPs were detected in the CDS of the SCD gene in both types of buffalo, and 2 SNPs were identified in the promoter region. Detailed results of the population genetic analysis are shown in Table 6. Among these SNPs, c.-603 (recorded with the first nucleotide of the start codon in the buffalo SCD gene-coding sequence as +1, NC_059179: g.21481146G>A), c.-605 (NC_059179: g.21481148A>C), c.609, c.867, and c.878 are shared between the two buffalo types. SNPs c.617, c.621, c.633, and c.987 are specific to river buffalo, while c.504, c.507, c.581, c.594, c.702, c.716, c.778, c.819, and c.842 are specific to swamp buffalo (Table 6). The SNPs c.581, c.617, c.716, c.778, c.842, and c.878 are nonsynonymous, resulting in amino acid changes p.Lys194Ile, p.Arg206Lys, p.Asp239Gly, p.Val260Ile, p.Asn281Ser, and p.Ala293Val, respectively. Analysis indicates that these nonsynonymous substitutions do not affect protein function. Additionally, in river buffalo, the SNPs at c.-605, c.609, and c.621 tend to be homozygous, while in swamp buffalo, all SNPs except at c.-603 and c.609 tend to be homozygous.
Based on the SNPs identified in the buffalo SCD CDS, a total of 17 haplotypes were defined, named Buffalo_hap1 through Buffalo_hap17 (Table 7). Among these, Buffalo_hap6 was the predominant haplotype, with a frequency of 0.2698, while Buffalo_hap14 had the lowest haplotype frequency, at 0.0032. To investigate the sequence variation characteristics of the buffalo SCD CDS, the buffalo haplotype sequences were compared with homologous sequences from other Bovidae species published in the NCBI database. The results revealed that c.108, c.149, and c.239 are nucleotide sites distinguishing buffalo from other Bovidae species (Figure S1), with c.149 and c.239 (p.50Thr and p.80Phe) also contributing to differences in the SCD amino acid sequences between buffalo and other Bovidae species (Figure 11).
Bioinformatics analysis confirmed that the six non-synonymous substitutions found in the CDS of buffalo SCD do not affect protein function and may not alter codon usage bias (Table S1). Therefore, this study focused solely on the association between variants in the SCD promoter region and buffalo lactation traits. The association analysis results (Table 8) indicate that in river buffalo, the AC genotype at the c.-605 site was associated with a significant 38.90% increase in milk yield compared to the AA genotype (p < 0.01), suggesting that the variation at this site has a potential impact on milk yield traits. Additionally, the genotype at the c.-603 site was not associated with buffalo lactation traits in this study.

4. Discussion

Milk, as a kind of human food with comprehensive nutrition, appropriate proportions, and ease of digestion and absorption, has seen increasing demand in recent years. SCD is a rate-limiting enzyme that catalyzes the conversion of SFAs (C16:0 and C18:0) into MUFAs (C16:1 and C18:1). Specifically, this reaction is aerobic, involving oxygen molecules, NAD(P)-cytochrome b5 reductase, and the electron acceptor cytochrome b5 [38]. The preferred substrates of SCD are palmitoyl-CoA and stearoyl-CoA, which are converted to palmitoleoyl-CoA and oleoyl-CoA, respectively [38]. MUFAs produced by SCD (such as phospholipids, TAG, cholesterol esters, wax esters, conjugated linoleic acid (CLA), and diacylglycerols) not only serve as key substrates for lipid synthesis [39] but also play important roles in signal transduction and cell differentiation (including neuronal differentiation) [40,41]. About 70% of the CLA in milk is synthesized by SCD, and CLA has anti-atherosclerotic, anti-cancer, and immune-regulatory functions [42]. From a human health perspective, the Wisconsin Milk Marketing Board (WMMB) suggests that the ideal fatty acid composition of milk should consist of 8% SFAs, 82% MUFAs, and 10% PUFAs [43]. This indicates that SCD plays a key role in the nutritional composition of milk and in maintaining human health. However, the role of the SCD gene during lactation in buffalo is still unclear.
In this study, the SCD gene was cloned and characterized from buffalo mammary tissue, with a CDS length of 1080 bp encoding 359 amino acids. The protein encoded by this gene plays a crucial role in fatty acid metabolism, particularly in the desaturation of fatty acids, and it also regulates cell membrane fluidity [44]. In terms of its molecular characteristics, such as transcript region structure, physicochemical properties, secondary structure, and tertiary structure, the buffalo SCD exhibits high similarity to that of other Bovidae species. Notably, phylogenetic analysis showed that buffalo clustered with other Bovidae, all of which share the conserved Delta9-FADS-like domain. This suggests that buffalo SCD is functionally similar to that of other Bovidae, i.e., SCD catalyzes the desaturation of fatty acids [45].
SCD is expressed and plays a functional role in organs associated with lipid metabolism in a variety of mammals. In mice, SCD is expressed in the liver, where it regulates the ratio of saturated to monounsaturated fatty acids as well as plasma TAG content [46]. In goats, SCD gene expression levels in mammary tissue are higher during lactation compared to dry-off periods [47,48]. In this study, we observed that SCD expression levels varied across 15 tissues in buffalo during lactation and dry-off periods, and the expression level of SCD in the mammary gland was higher during lactation than during dry-off, suggesting that SCD may be involved in the lactation process, particularly in milk fat synthesis in buffalo. Studies have shown that the endoplasmic reticulum (ER) is an important site for lipid metabolism [49], and Man et al. [50] found that SCD interacts with neighboring proteins on the ER in Hela cells, increasing the efficiency of TAG synthesis. Our subcellular localization and cellular function experiments in this study indicate that SCD functions within the ER of BuMECs.
De novo fatty acid synthesis is currently the main pathway for milk fat synthesis in cows [51]. Bionaz et al. [52] highlighted that SCD plays a pivotal role in de novo milk TAG synthesis in cows, which can be directly regulated by the transcription factors SREBFs and PPAR. Moreover, studies have shown that the AMP-activated protein kinase (AMPK)/mammalian target of rapamycin (mTOR) and phosphoinositide 3-kinase (PI3K)/protein kinase B (PKB) signaling pathways can enhance SCD expression [53,54]. In cow mammary epithelial cells, milk fat de novo synthesis is initially catalyzed by ACACA and FASN, which synthesize palmitic acid from acetyl-CoA and malonyl-CoA. Palmitic acid is then desaturated by SCD and catalyzed by DGAT1 to form TAG [52,55]. Functional experiments in this study showed that overexpression or knockdown of the SCD gene in BuMECs led to corresponding changes in the mRNA abundance of genes (ACACA and FASN) involved in de novo milk fat synthesis, as well as in intracellular TAG content, indicating that the SCD gene is involved in de novo TAG synthesis in BuMECs. Palmitoyl-CoA is considered an inhibitor of ACACA, while palmitic acid is catalyzed to form TAG [56]. In this study, overexpression of SCD significantly increased TAG content in cells, suggesting that this process reduced palmitic acid levels, thereby alleviating the inhibitory effect of palmitoyl-CoA, ultimately leading to an increase in ACACA and FASN expression. This suggests a regulatory mechanism balancing lipid synthesis and breakdown in cells [57]. CD36 promotes the preferential uptake of MUFAs in a p38- and AMPK-dependent manner, maintaining the balance between SFAs and MUFAs [58]. However, in this study, SCD overexpression was accompanied by a decrease in CD36 expression, suggesting that overexpression of SCD may disrupt this balance.
SCD plays a crucial role in maintaining the balance of MUFAs. Even under MUFA-deficient dietary conditions, SCD can still synthesize MUFAs in the mouse liver [59]. The synthesis of sufficient amounts of MUFAs from scratch via dietary intake or SCD is closely associated with the activation of SREBF1 and its downstream target genes ACACA, FASN, and SCD, and these activation processes further promote the synthesis of MUFAs and TAG [59]. In addition, SCD gene could not be activated by SREBF1 after SREBF1 was inhibited by AMPK [60]. In this study, we observed that SREBF1 and SREBF2 expression levels, as well as intracellular TAG content, were significantly altered following SCD overexpression or knockdown in BuMECs, suggesting that SCD indirectly affects the expression of SREBFs. In goat mammary epithelial cells, PPARG activation significantly increased SCD expression, while PPARG knockdown reduced SCD expression by 65% [61]. In this study, SCD overexpression or knockdown resulted in corresponding changes in PPARG expression and TAG content, indicating that SCD indirectly affects PPARG expression. Additionally, research has shown that chicken SP1 binds to the core promoter region of SCD, directly regulating SCD synthesis of polyunsaturated fatty acids [62]. This study found that SCD overexpression or knockdown also led to corresponding changes in SP1 expression and intracellular TAG content, indicating that SCD is involved in lipid metabolism in BuMECs by indirectly affecting SP1 expression. In summary, SCD indirectly influences SREBFs, PPARG, and SP1 by catalyzing MUFA synthesis, activating downstream target genes related to lipid synthesis, and enhancing de novo TAG synthesis in BuMECs.
To date, SNPs in the SCD gene have been found to be closely associated with milk yield and milk fat composition in various Bovidae species [6,63]. In Holstein cows, the content of medium and long-chain unsaturated fatty acids (C14:1, C16:1, C18:2n6, and CLA) in the milk of individuals carrying the CT and TT genotypes was significantly higher than that of individuals carrying the CC genotype at the g.10329C>T locus of the SCD gene [64]. In cattle, buffalo, and goats, SCD has been identified as a candidate gene for lactation traits [65,66,67]. Gu et al. [68] found that the SNP at the g.133A>C locus in the promoter region of the river buffalo SCD gene was associated with its milk yield. In this study, a total of 18 SNPs were identified in the SCD gene of two types of buffalo, among which the SNPs at c.108, c.149, and c.239 could be used as specific markers distinguishing buffalo from other Bovidae species, while the SNP at the c.-605A>C locus resulted in significantly higher milk yield in individuals of Binglangjiang buffalo carrying the AC genotype than in individuals with the AA genotype. This finding suggests that the C allele at this locus is significantly associated with milk production in buffalo.

5. Conclusions

This study successfully cloned and characterized the SCD gene from buffalo, revealing its key role in fatty acid metabolism and milk fat synthesis. The expression of SCD in the mammary gland was higher during lactation than dry-off period, suggesting its involvement in milk fat synthesis. Functional experiments demonstrated that SCD influences the expression of key lipid synthesis genes, such as ACACA and FASN, and plays a role in regulating TAG content in BuMECs. This study also identified three SNPs (c.108, c.149, and c.239) in the SCD gene that could be used as specific loci to differentiate buffalo from other Bovidae species, and the SNP at the c.-605 site could be used as a marker to improve milk production traits in buffalo. These findings contribute to understanding the molecular mechanisms of milk fat synthesis in buffalo and may provide a basis for improving the productive performance of dairy buffalo through marker-assisted selection.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14223191/s1, Figure S1: Differences between the haplotype sequences of the buffalo SCD CDS and homologous nucleotide sequences from other Bovidae species; Table S1: Sequence relative synonymous codon usage (RSCU) values after nonsynonymous substitution.

Author Contributions

Conceptualization, W.D., X.F. and Y.M.; methodology, W.D., X.F. and Y.M.; software, W.D., X.F. and Z.C.; validation, W.D. and X.F.; formal analysis, W.D. and Z.C.; investigation, W.D., X.F. and Y.M.; resources, J.L., T.C. and Y.Z.; data curation, J.L., T.C. and Y.Z.; writing—original draft preparation, W.D. and Y.M.; writing—review and editing, X.F. and Y.M.; visualization, W.D.; supervision, Y.M.; project administration, Y.M.; funding acquisition, Y.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant Nos. 32260822, 31760659, and 31460582) and the Natural Science Foundation Key Project of Yunnan Province, China (grant Nos. 2014FA032 and 2007C0003Z).

Institutional Review Board Statement

The execution of all animal experiments complied strictly with the guidelines established by the Experimental Animal Use and Ethics Committee of Yunnan Agricultural University, with ethical approval granted under contract number YNAU2019llwyh019.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data analyzed during the current study are available from the corresponding authors upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Thiede, M.A.; Ozols, J.; Strittmatter, P. Construction and Sequence of cDNA for Rat Liver Stearyl Coenzyme A Desaturase. J. Biol. Chem. 1986, 261, 13230–13235. [Google Scholar] [CrossRef] [PubMed]
  2. Ntambi, J.M.; Miyazaki, M. Regulation of Stearoyl-CoA Desaturases and Role in Metabolism. Prog. Lipid Res. 2004, 43, 91–104. [Google Scholar] [CrossRef] [PubMed]
  3. ALJohani, A.M.; Syed, D.N.; Ntambi, J.M. Insights into Stearoyl-CoA Desaturase-1 Regulation of Systemic Metabolism. Trends Endocrinol. Metab. TEM 2017, 28, 831–842. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, J.; Yu, L.; Schmidt, R.E.; Su, C.; Huang, X.; Gould, K.; Cao, G. Characterization of HSCD5, a Novel Human Stearoyl-CoA Desaturase Unique to Primates. Biochem. Biophys. Res. Commun. 2005, 332, 735–742. [Google Scholar] [CrossRef] [PubMed]
  5. Lengi, A.J.; Corl, B.A. Identification and Characterization of a Novel Bovine Stearoyl-CoA Desaturase Isoform with Homology to Human SCD5. Lipids 2007, 42, 499–508. [Google Scholar] [CrossRef] [PubMed]
  6. Matosinho, C.G.R.; de S. Fonseca, P.A.; Peixoto, M.G.C.D.; Rosse, I.C.; Lopes, F.C.F.; Zózimo, T.; Filho, A.E.V.; Bruneli, F.Â.T.; Carvalho, M.R.S.; Gama, M.A.S. Phenotypic Variation in Milk Fatty Acid Composition and Its Association with Stearoyl-CoA Desaturase 1 (SCD1) Gene Polymorphisms in Gir Cows. J. Anim. Breed. Genet. Z. Tierz. Zucht. 2023, 140, 532–548. [Google Scholar] [CrossRef]
  7. Orrù, L.; Cifuni, G.F.; Piasentier, E.; Corazzin, M.; Bovolenta, S.; Moioli, B. Association Analyses of Single Nucleotide Polymorphisms in the LEP and SCD1 Genes on the Fatty Acid Profile of Muscle Fat in Simmental Bulls. Meat Sci. 2011, 87, 344–348. [Google Scholar] [CrossRef]
  8. Jiang, Z.; Michal, J.J.; Tobey, D.J.; Daniels, T.F.; Rule, D.C.; Macneil, M.D. Significant Associations of Stearoyl-CoA Desaturase (SCD1) Gene with Fat Deposition and Composition in Skeletal Muscle. Int. J. Biol. Sci. 2008, 4, 345–351. [Google Scholar] [CrossRef]
  9. Campbell, E.M.; Gallagher, D.S.; Davis, S.K.; Taylor, J.F.; Smith, S.B. Rapid Communication: Mapping of the Bovine Stearoyl-Coenzyme A Desaturase (SCD) Gene to BTA261. J. Anim. Sci. 2001, 79, 1954–1955. [Google Scholar] [CrossRef]
  10. Yuan, X.; Abdul-Rahman, I.I.; Hu, S.; Li, L.; He, H.; Xia, L.; Hu, J.; Ran, M.; Liu, Y.; Abdulai, M.; et al. Mechanism of SCD Participation in Lipid Droplet-Mediated Steroidogenesis in Goose Granulosa Cells. Genes 2022, 13, 1516. [Google Scholar] [CrossRef]
  11. Otto, J.R.; Mwangi, F.W.; Pewan, S.B.; Adegboye, O.A.; Malau-Aduli, A.E.O. Lipogenic Gene Single Nucleotide Polymorphic DNA Markers Associated with Intramuscular Fat, Fat Melting Point, and Health-Beneficial Omega-3 Long-Chain Polyunsaturated Fatty Acids in Australian Pasture-Based Bowen Genetics Forest Pastoral Angus, Hereford, and Wagyu Beef Cattle. Genes 2022, 13, 1411. [Google Scholar] [CrossRef] [PubMed]
  12. Warriach, H.M.; McGill, D.M.; Bush, R.D.; Wynn, P.C.; Chohan, K.R. A Review of Recent Developments in Buffalo Reproduction—A Review. Asian-Australas. J. Anim. Sci. 2015, 28, 451–455. [Google Scholar] [CrossRef] [PubMed]
  13. Aleandri, R.; Buttazzoni, L.G.; Schneider, J.C.; Caroli, A.; Davoli, R. The Effects of Milk Protein Polymorphisms on Milk Components and Cheese-Producing Ability. J. Dairy Sci. 1990, 73, 241–255. [Google Scholar] [CrossRef]
  14. Garau, V.; Manis, C.; Scano, P.; Caboni, P. Compositional Characteristics of Mediterranean Buffalo Milk and Whey. Dairy 2021, 2, 469–488. [Google Scholar] [CrossRef]
  15. Månsson, H.L. Fatty acids in bovine milk fat. Food Nutr. Res. 2008, 52, 1821–1823. [Google Scholar] [CrossRef]
  16. Nie, P.; Pan, B.; Ahmad, M.J.; Zhang, X.; Chen, C.; Yao, Z.; Lv, H.; Wei, K.; Yang, L. Summer Buffalo Milk Produced in China: A Desirable Diet Enriched in Polyunsaturated Fatty Acids and Amino Acids. Foods 2022, 11, 3475. [Google Scholar] [CrossRef]
  17. GB/T 19477-2004; Operating Procedures of Cattle Slaughtering. China Standards Press: Beijing, China, 2004.
  18. Psifidi, A.; Dovas, C.I.; Bramis, G.; Lazou, T.; Russel, C.L.; Arsenos, G.; Banos, G. Comparison of Eleven Methods for Genomic DNA Extraction Suitable for Large-Scale Whole-Genome Genotyping and Long-Term DNA Banking Using Blood Samples. PLoS ONE 2015, 10, e0115960. [Google Scholar] [CrossRef]
  19. Lalitha, S. Primer premier 5. Biotech. Softw. Internet Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
  20. Maryam, J.; Babar, M.E.; Bao, Z.; Nadeem, A. A Novel Selection Signature in Stearoyl-Coenzyme A Desaturase (SCD) Gene for Enhanced Milk Fat Content in Bubalus Bubalis. Trop. Anim. Health Prod. 2016, 48, 1343–1349. [Google Scholar] [CrossRef]
  21. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” Bioinformatics Platform for Biological Big-Data Mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
  22. Hu, B.; Jin, J.; Guo, A.-Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An Upgraded Gene Feature Visualization Server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
  23. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  24. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  25. Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Hochstrasser, D.F. Protein Identification and Analysis Tools in the ExPASy Server. Methods Mol. Biol. 1999, 112, 531–552. [Google Scholar] [CrossRef]
  26. Geourjon, C.; Deléage, G. SOPMA: Significant Improvements in Protein Secondary Structure Prediction by Consensus Prediction from Multiple Alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef]
  27. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology Modelling of Protein Structures and Complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
  28. de Castro, E.; Sigrist, C.J.A.; Gattiker, A.; Bulliard, V.; Langendijk-Genevaux, P.S.; Gasteiger, E.; Bairoch, A.; Hulo, N. ScanProsite: Detection of PROSITE Signature Matches and ProRule-Associated Functional and Structural Residues in Proteins. Nucleic Acids Res. 2006, 34, W362–W365. [Google Scholar] [CrossRef]
  29. Nielsen, H.; Tsirigos, K.D.; Brunak, S.; von Heijne, G. A Brief History of Protein Sorting Prediction. Protein J. 2019, 38, 200–216. [Google Scholar] [CrossRef]
  30. Krogh, A.; Larsson, B.; Von Heijne, G.; Sonnhammer, E.L. Predicting Transmembrane Protein Topology with a Hidden Markov Model: Application to Complete Genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef]
  31. Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING Database in 2023: Protein-Protein Association Networks and Functional Enrichment Analyses for Any Sequenced Genome of Interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
  32. Paysan-Lafosse, T.; Blum, M.; Chuguransky, S.; Grego, T.; Pinto, B.L.; Salazar, G.A.; Bileschi, M.L.; Bork, P.; Bridge, A.; Colwell, L.; et al. InterPro in 2022. Nucleic Acids Res. 2023, 51, D418–D427. [Google Scholar] [CrossRef] [PubMed]
  33. Sherman, B.T.; Hao, M.; Qiu, J.; Jiao, X.; Baseler, M.W.; Lane, H.C.; Imamichi, T.; Chang, W. DAVID: A Web Server for Functional Enrichment Analysis and Functional Annotation of Gene Lists (2021 Update). Nucleic Acids Res. 2022, 50, W216–W221. [Google Scholar] [CrossRef] [PubMed]
  34. Fan, X.; Qiu, L.; Teng, X.; Zhang, Y.; Miao, Y. Effect of INSIG1 on the Milk Fat Synthesis of Buffalo Mammary Epithelial Cells. J. Dairy Res. 2020, 87, 349–355. [Google Scholar] [CrossRef] [PubMed]
  35. Huang, L.; Sheng, D.; Fan, X.; Gao, R.; Miao, Y. Molecular Characterization, Function, Tissue Differential Expression, and Single-Nucleotide Polymorphism of Buffalo TP53 Gene. Arch. Anim. Breed. 2024, 67, 217–230. [Google Scholar] [CrossRef]
  36. Yeh, F.C.; Boyle, T.B.J. Population genetic analysis of co-dominant and dominant marker and quantitative traits. Belg. J. Bot. 1997, 129, 157–163. [Google Scholar]
  37. Tokarz, J.; Mindnich, R.; Norton, W.; Möller, G.; Hrabé de Angelis, M.; Adamski, J. Discovery of a Novel Enzyme Mediating Glucocorticoid Catabolism in Fish: 20beta-Hydroxysteroid Dehydrogenase Type 2. Mol. Cell. Endocrinol. 2012, 349, 202–213. [Google Scholar] [CrossRef]
  38. Ntambi, J.M. Regulation of Stearoyl-CoA Desaturase by Polyunsaturated Fatty Acids and Cholesterol. J. Lipid Res. 1999, 40, 1549–1558. [Google Scholar] [CrossRef]
  39. Paton, C.M.; Ntambi, J.M. Biochemical and Physiological Function of Stearoyl-CoA Desaturase. Am. J. Physiol.-Endocrinol. Metab. 2009, 297, E28–E37. [Google Scholar] [CrossRef]
  40. Yonezawa, T.; Haga, S.; Kobayashi, Y.; Katoh, K.; Obara, Y. Unsaturated Fatty Acids Promote Proliferation via ERK1/2 and Akt Pathway in Bovine Mammary Epithelial Cells. Biochem. Biophys. Res. Commun. 2008, 367, 729–735. [Google Scholar] [CrossRef]
  41. Bradley, R.L.; Fisher, F.F.M.; Maratos-Flier, E. Dietary Fatty Acids Differentially Regulate Production of TNF-Alpha and IL-10 by Murine 3T3-L1 Adipocytes. Obes. Silver Spring Md. 2008, 16, 938–944. [Google Scholar] [CrossRef]
  42. Mele, M.; Conte, G.; Castiglioni, B.; Chessa, S.; Macciotta, N.P.P.; Serra, A.; Buccioni, A.; Pagnacco, G.; Secchiari, P. Stearoyl-Coenzyme A Desaturase Gene Polymorphism and Milk Fatty Acid Composition in Italian Holsteins. J. Dairy Sci. 2007, 90, 4458–4465. [Google Scholar] [CrossRef] [PubMed]
  43. O’Donnell, J.A. Milk Fat Technologies and Markets: A Summary of the Wisconsin Milk Marketing Board 1988 Milk Fat Roundtable. J. Dairy Sci. 1989, 72, 3109–3115. [Google Scholar] [CrossRef]
  44. Nakamura, M.T.; Nara, T.Y. Structure, Function, and Dietary Regulation of Delta6, Delta5, and Delta9 Desaturases. Annu. Rev. Nutr. 2004, 24, 345–376. [Google Scholar] [CrossRef] [PubMed]
  45. Yao, D.; Luo, J.; He, Q.; Shi, H.; Li, J.; Wang, H.; Xu, H.; Chen, Z.; Yi, Y.; Loor, J.J. SCD1 Alters Long-Chain Fatty Acid (LCFA) Composition and Its Expression Is Directly Regulated by SREBP-1 and PPARγ 1 in Dairy Goat Mammary Cells: SCD1 AND FATTY ACID METABOLISM. J. Cell. Physiol. 2017, 232, 635–649. [Google Scholar] [CrossRef] [PubMed]
  46. Chu, K.; Miyazaki, M.; Man, W.C.; Ntambi, J.M. Stearoyl-Coenzyme A Desaturase 1 Deficiency Protects against Hypertriglyceridemia and Increases Plasma High-Density Lipoprotein Cholesterol Induced by Liver X Receptor Activation. Mol. Cell. Biol. 2006, 26, 6786–6798. [Google Scholar] [CrossRef]
  47. Shi, H.B.; Luo, J.; Yao, D.W.; Zhu, J.J.; Xu, H.F.; Shi, H.P.; Loor, J.J. Peroxisome Proliferator-Activated Receptor-γ Stimulates the Synthesis of Monounsaturated Fatty Acids in Dairy Goat Mammary Epithelial Cells via the Control of Stearoyl-Coenzyme A Desaturase. J. Dairy Sci. 2013, 96, 7844–7853. [Google Scholar] [CrossRef]
  48. Salmani Izadi, M.; Naserian, A.A.; Nasiri, M.R.; Majidzadeh Heravi, R.; Valizadeh, R. Evaluation of SCD and FASN Gene Expression in Baluchi, Iran-Black, and Arman Sheep. Rep. Biochem. Mol. Biol. 2016, 5, 33–39. [Google Scholar]
  49. Schwarz, D.S.; Blower, M.D. The Endoplasmic Reticulum: Structure, Function and Response to Cellular Signaling. Cell. Mol. Life Sci. CMLS 2016, 73, 79–94. [Google Scholar] [CrossRef]
  50. Man, W.C.; Miyazaki, M.; Chu, K.; Ntambi, J. Colocalization of SCD1 and DGAT2: Implying Preference for Endogenous Monounsaturated Fatty Acids in Triglyceride Synthesis. J. Lipid Res. 2006, 47, 1928–1939. [Google Scholar] [CrossRef]
  51. Tian, Z.; Zhang, Y.; Zhang, H.; Sun, Y.; Mao, Y.; Yang, Z.; Li, M. Transcriptional Regulation of Milk Fat Synthesis in Dairy Cattle. J. Funct. Foods 2022, 96, 105208. [Google Scholar] [CrossRef]
  52. Bionaz, M.; Loor, J.J. Gene Networks Driving Bovine Milk Fat Synthesis during the Lactation Cycle. BMC Genom. 2008, 9, 366. [Google Scholar] [CrossRef] [PubMed]
  53. Sun, Q.; Xing, X.; Wang, H.; Wan, K.; Fan, R.; Liu, C.; Wang, Y.; Wu, W.; Wang, Y.; Wang, R. SCD1 Is the Critical Signaling Hub to Mediate Metabolic Diseases: Mechanism and the Development of Its Inhibitors. Biomed. Pharmacother. 2024, 170, 115586. [Google Scholar] [CrossRef] [PubMed]
  54. Ricoult, S.J.H.; Yecies, J.L.; Ben-Sahra, I.; Manning, B.D. Oncogenic PI3K and K-Ras Stimulate de Novo Lipid Synthesis through mTORC1 and SREBP. Oncogene 2016, 35, 1250–1260. [Google Scholar] [CrossRef] [PubMed]
  55. Roe, N.D.; Handzlik, M.K.; Li, T.; Tian, R. The Role of Diacylglycerol Acyltransferase (DGAT) 1 and 2 in Cardiac Metabolism and Function. Sci. Rep. 2018, 8, 4983. [Google Scholar] [CrossRef]
  56. Lunzer, M.A.; Manning, J.A.; Ockner, R.K. Inhibition of Rat Liver Acetyl Coenzyme A Carboxylase by Long Chain Acyl Coenzyme A and Fatty Acid. Modulation by Fatty Acid-Binding Protein. J. Biol. Chem. 1977, 252, 5483–5487. [Google Scholar] [CrossRef]
  57. Danielli, M.; Perne, L.; Jarc Jovičić, E.; Petan, T. Lipid Droplets and Polyunsaturated Fatty Acid Trafficking: Balancing Life and Death. Front. Cell Dev. Biol. 2023, 11, 1104725. [Google Scholar] [CrossRef]
  58. Terry, A.R.; Nogueira, V.; Rho, H.; Ramakrishnan, G.; Li, J.; Kang, S.; Pathmasiri, K.C.; Bhat, S.A.; Jiang, L.; Kuchay, S.; et al. CD36 Maintains Lipid Homeostasis via Selective Uptake of Monounsaturated Fatty Acids during Matrix Detachment and Tumor Progression. Cell Metab. 2023, 35, 2060–2076. [Google Scholar] [CrossRef]
  59. Flowers, M.T.; Ntambi, J.M. Role of Stearoyl-Coenzyme A Desaturase in Regulating Lipid Metabolism. Curr. Opin. Lipidol. 2008, 19, 248–256. [Google Scholar] [CrossRef]
  60. Yang, J.; Craddock, L.; Hong, S.; Liu, Z.-M. AMP-Activated Protein Kinase Suppresses LXR-Dependent Sterol Regulatory Element-Binding Protein-1c Transcription in Rat Hepatoma McA-RH7777 Cells. J. Cell. Biochem. 2009, 106, 414–426. [Google Scholar] [CrossRef]
  61. Shi, H.; Luo, J.; Zhu, J.; Li, J.; Sun, Y.; Lin, X.; Zhang, L.; Yao, D.; Shi, H. PPAR γ Regulates Genes Involved in Triacylglycerol Synthesis and Secretion in Mammary Gland Epithelial Cells of Dairy Goats. PPAR Res. 2013, 2013, 310948. [Google Scholar] [CrossRef]
  62. Liu, Y.; Sun, D.; Li, X.; Ge, M.; Hou, Z. Research Note: Identification of Core Promoter Region of the Polyunsaturated Fatty Acid Synthesis-Related Gene Family in Chicken. Poult. Sci. 2023, 102, 102857. [Google Scholar] [CrossRef] [PubMed]
  63. Tumino, S.; Bognanno, M.; Chessari, G.; Tolone, M.; Bordonaro, S.; Mangano, F.; Marletta, D.; Avondo, M. Polymorphisms at Candidate Genes for Fat Content and Fatty Acids Composition: Effects on Sheep Milk Production and Fatty Acid Profile Using Two Dietary Supplementations. Animal 2023, 13, 2533. [Google Scholar] [CrossRef]
  64. Li, C.; Sun, D.; Zhang, S.; Liu, L.; Alim, M.A.; Zhang, Q. A Post-GWAS Confirming the SCD Gene Associated with Milk Medium- and Long-Chain Unsaturated Fatty Acids in Chinese Holstein Population. Anim. Genet. 2016, 47, 483–490. [Google Scholar] [CrossRef] [PubMed]
  65. Brzáková, M.; Rychtářová, J.; Čítek, J.; Sztankóová, Z. A Candidate Gene Association Study for Economically Important Traits in Czech Dairy Goat Breeds. Animal 2021, 11, 1796. [Google Scholar] [CrossRef] [PubMed]
  66. Chen, Y.; Zhang, T.; Xian, M.; Zhang, R.; Yang, W.; Su, B.; Yang, G.; Sun, L.; Xu, W.; Xu, S.; et al. A Draft Genome of Drung Cattle Reveals Clues to Its Chromosomal Fusion and Environmental Adaptation. Commun. Biol. 2022, 5, 353. [Google Scholar] [CrossRef]
  67. Du, C.; Deng, T.; Zhou, Y.; Ye, T.; Zhou, Z.; Zhang, S.; Shao, B.; Wei, P.; Sun, H.; Khan, F.A.; et al. Systematic Analyses for Candidate Genes of Milk Production Traits in Water Buffalo (Bubalus bubalis). Anim. Genet. 2019, 50, 207–216. [Google Scholar] [CrossRef]
  68. Gu, M.; Cosenza, G.; Iannaccone, M.; Macciotta, N.P.P.; Guo, Y.; Di Stasio, L.; Pauciullo, A. The Single Nucleotide Polymorphism g.133A>C in the Stearoyl CoA Desaturase Gene (SCD) Promoter Affects Gene Expression and Quali-Quantitative Properties of River Buffalo Milk. J. Dairy Sci. 2019, 102, 442–451. [Google Scholar] [CrossRef]
Figure 1. RT-PCR gel electrophoresis of buffalo SCD gene CDS. Lane M shows the DL2000 DNA marker, and lanes 1 and 2 show the PCR products of buffalo SCD gene CDS.
Figure 1. RT-PCR gel electrophoresis of buffalo SCD gene CDS. Lane M shows the DL2000 DNA marker, and lanes 1 and 2 show the PCR products of buffalo SCD gene CDS.
Animals 14 03191 g001
Figure 2. The CDS of buffalo SCD gene and its corresponding amino acid sequence. The yellow-highlighted region represents the conserved domain of the buffalo SCD protein (Delta9-FADS-like, amino acids (AAs) 97-337), and the stop codon is denoted by “*”.
Figure 2. The CDS of buffalo SCD gene and its corresponding amino acid sequence. The yellow-highlighted region represents the conserved domain of the buffalo SCD protein (Delta9-FADS-like, amino acids (AAs) 97-337), and the stop codon is denoted by “*”.
Animals 14 03191 g002
Figure 3. Structure of the transcribed region of the SCD gene in buffalo and other mammals.
Figure 3. Structure of the transcribed region of the SCD gene in buffalo and other mammals.
Animals 14 03191 g003
Figure 4. Sequence conservation and divergence of SCD proteins between buffalo and 11 other mammalian species. The values above the diagonal indicate consistency, and those below represent divergence.
Figure 4. Sequence conservation and divergence of SCD proteins between buffalo and 11 other mammalian species. The values above the diagonal indicate consistency, and those below represent divergence.
Animals 14 03191 g004
Figure 5. Phylogenetic relationships, motif composition, and conserved structural domains. (A) Phylogenetic relationships constructed on the basis of 12 mammalian SCD sequences; (B) motif composition of SCD for each species; (C) conserved structural domains of SCD across species. Colored boxes indicate different conserved motifs and conserved structural domains in SCD.
Figure 5. Phylogenetic relationships, motif composition, and conserved structural domains. (A) Phylogenetic relationships constructed on the basis of 12 mammalian SCD sequences; (B) motif composition of SCD for each species; (C) conserved structural domains of SCD across species. Colored boxes indicate different conserved motifs and conserved structural domains in SCD.
Animals 14 03191 g005
Figure 6. The 3D structure of the SCD proteins in buffalo and other Bovidae species.
Figure 6. The 3D structure of the SCD proteins in buffalo and other Bovidae species.
Animals 14 03191 g006
Figure 7. Differential expression of the SCD gene across multiple tissues in buffalo. (A) Differential expression of the SCD gene in 15 tissues during the lactation period; (B) differential expression of the SCD gene in 15 tissues during the dry-off period; (C) differential expression of the SCD gene in the mammary gland during lactation and dry-off periods. Different letters (a, b, c, d, e, f, g) indicate significant differences between groups (p < 0.05).
Figure 7. Differential expression of the SCD gene across multiple tissues in buffalo. (A) Differential expression of the SCD gene in 15 tissues during the lactation period; (B) differential expression of the SCD gene in 15 tissues during the dry-off period; (C) differential expression of the SCD gene in the mammary gland during lactation and dry-off periods. Different letters (a, b, c, d, e, f, g) indicate significant differences between groups (p < 0.05).
Animals 14 03191 g007
Figure 8. Subcellular localization of buffalo SCD in BuMECs observed using confocal microscopy. (A) Nuclei stained with Hoechst 33342; (B) mitochondria stained with Mito Tracker; (C) the green fluorescence of GFP encoded by recombinant pEGFP-N1-SCD; (D) the overlay of GFP and Hoechst-stained nuclei; (E) the overlay of GFP and Mito Tracker-stained mitochondria; (F) the combined overlay of GFP, nuclei, and mitochondria.
Figure 8. Subcellular localization of buffalo SCD in BuMECs observed using confocal microscopy. (A) Nuclei stained with Hoechst 33342; (B) mitochondria stained with Mito Tracker; (C) the green fluorescence of GFP encoded by recombinant pEGFP-N1-SCD; (D) the overlay of GFP and Hoechst-stained nuclei; (E) the overlay of GFP and Mito Tracker-stained mitochondria; (F) the combined overlay of GFP, nuclei, and mitochondria.
Animals 14 03191 g008
Figure 9. Effects of SCD overexpression on milk fat synthesis-related genes in BuMECs. (A) Differences in SCD expression in BuMECs after transfection with pEGFP-N1-SCD and pEGFP-N1; (B) expression differences in genes involved in de novo fatty acid synthesis (ACACA, FASN), fatty acid esterification (DGAT1), and fatty acid extracellular transport and uptake (CD36) following SCD overexpression; (C) changes in the expression of regulatory genes related to fatty acid synthesis (SREBF1, SREBF2, PPARG, INSIG1, SP1) due to SCD overexpression; (D) overexpression of SCD increased intracellular TAG content. Values are presented as means ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 9. Effects of SCD overexpression on milk fat synthesis-related genes in BuMECs. (A) Differences in SCD expression in BuMECs after transfection with pEGFP-N1-SCD and pEGFP-N1; (B) expression differences in genes involved in de novo fatty acid synthesis (ACACA, FASN), fatty acid esterification (DGAT1), and fatty acid extracellular transport and uptake (CD36) following SCD overexpression; (C) changes in the expression of regulatory genes related to fatty acid synthesis (SREBF1, SREBF2, PPARG, INSIG1, SP1) due to SCD overexpression; (D) overexpression of SCD increased intracellular TAG content. Values are presented as means ± SEM; * p < 0.05, ** p < 0.01, *** p < 0.001.
Animals 14 03191 g009
Figure 10. Effects of SCD knockdown on milk fat synthesis-related genes in BuMECs. (A) Interference efficiency of siRNA1-SCD and siRNA2-SCD compared to the negative control group (siRNA-NC); (B) effects of SCD knockdown on the expression of genes involved in fatty acid synthesis (ACACA, FASN), fatty acid esterification (DGAT1), and fatty acid extracellular transport and uptake (CD36); (C) effects of SCD knockdown on the expression of genes regulating milk fat metabolism (SREBF1, SREBF2, PPARG, INSIG1, SP1); (D) SCD knockdown reduced intracellular TAG content. Values are presented as means ± SEM.; ** p < 0.01; *** p < 0.001.
Figure 10. Effects of SCD knockdown on milk fat synthesis-related genes in BuMECs. (A) Interference efficiency of siRNA1-SCD and siRNA2-SCD compared to the negative control group (siRNA-NC); (B) effects of SCD knockdown on the expression of genes involved in fatty acid synthesis (ACACA, FASN), fatty acid esterification (DGAT1), and fatty acid extracellular transport and uptake (CD36); (C) effects of SCD knockdown on the expression of genes regulating milk fat metabolism (SREBF1, SREBF2, PPARG, INSIG1, SP1); (D) SCD knockdown reduced intracellular TAG content. Values are presented as means ± SEM.; ** p < 0.01; *** p < 0.001.
Animals 14 03191 g010
Figure 11. Differences in the SCD amino acid sequences between buffalo and other Bovidae species. The numbers represent the positions of the mature peptide. Dots (.) indicate identity with SCD, while amino acid substitutions are represented by different letters.
Figure 11. Differences in the SCD amino acid sequences between buffalo and other Bovidae species. The numbers represent the positions of the mature peptide. Dots (.) indicate identity with SCD, while amino acid substitutions are represented by different letters.
Animals 14 03191 g011
Table 1. The information of the primers utilized in this study.
Table 1. The information of the primers utilized in this study.
Serial Number of TemplatesPrimer Sequence (5′→3′)Product
Length (bp)
Annealing
Temperature (°C)
Extension Time (s)EfficiencyPurpose
SCDNM_001290915F: TCAGGAACTAGTCTACACTCA129259.7065/Gene isolation
R: GTACTGTAATGGGTTAACGT
SCDPP950448F: ctcgagATGCCGGCCCACTTGCTGCA 109359.7065/Construction of
recombinant vector
R: gaattcCGCCACTCTTGTAGCTTTCCT
siRNA1-SCDPP950448F: GAAAAGAACUGGAGAGGAATT////Gene interference
R: UUCCUCUCCAGUUCUUUUCTT
siRNA2-SCDPP950448F: GGAGUCACCGAACCUACAATT////Gene interference
R: UUGUAGGUUCGGUGACUCCTT
siRNA-NC/F: UUCUCCGAACGUGUCACGUTT////Negative control
R: ACGUGACACGUUCGGAGAATT
SCDNM_001290915F: CGTGCCGTGGTATCTGTGG21760.00202.10 Expression-level detection
R: AAAGGTGTGGTGGTAGTTGTGG
SREBF2XM_025282779F: GCCAAGATGCACAAGTCTGGTGTT13656.50301.98Expression-level detection
R: TGCCCTTCAGGAGCTTGCTCT
CD36NM_001290838F: CTTACAATAATACTGCAGATG16255.00302.08Expression-level detection
R: AAGGTGGAAATGAGGCTG
SREBF1XM_025280442F: GCACCGAGGCCAAGTTGAATAA14657.00302.14Expression-level detection
R: CAGGTCCTTCAGTGATTTGCTT
SP1XM_025284254F: CAGGATGGTTCAGGTCAGATAC10960.00302.00 Expression-level detection
R: GCTGGAGTAGGTTTGGCATAG
ACACAXM_025281124F: CCTCTTCAGACAGGTTCAAGC23455.00301.97Expression-level detection
R: TTCACCGCACACTGTTCCA
FASNXM_006061793F: AGGCCAGCTCCGAAGGCAACA20964.30302.01Expression-level detection
R: TACCACGTCGGCCACTTGTGTC
DGAT1NM_001290902F: ACAGACAAGGACGGAGACG26855.00302.04Expression-level detection
R: CCACAATGACCAGGCACA
PPARGNM_001290893F: GCTCCAAGAGTACCAAAGTG20453.70302.03Expression-level detection
R: GTCCTCCGGAAGAAACCCTT
INSIG1NM_001290924F: ACGTTCAGCTCTCCTTGACATT23955.00302.11Expression-level detection
R: CTGTCGTCCTATGTTTCCCAC
ACTBNM_001290932F: TGGGCATGGAATCCTG19660.00302.05Internal reference
R: GGCGCGATGATCTTGAT
Exon 1–2FN395259F: TGGACTGCCCCGAACTCCG107761.0060/SNP detection
R: TGCATCCCAACCCCCCTAG
Exon 3FN395259F: CAAAGGAGCCTAAGAGAT53252.3060/SNP detection
R: AACAGAGGTTCAAAAATG
Exon 4FN395259F: CTCACCACATAACCCTCG76154.1060/SNP detection
R: TCCTTCCACTCCCCAGTA
Exon 5FN395259F: AGTGGAAAATCAGGTAGG58759.8060/SNP detection
R: TCAGAGATGACTGGGAAG
Exon 6FN395259F: AGAGTTTAAAAGACGAGC58050.8060/SNP detection
R: TAATGGGAACAGAAGAGA
PromoterNC_059179F: CCCAGTGCCCATCCATTTGC55753.3060/SNP detection
R: CGGACCCGACCTGCTGTGCT
Note: Lowercase in the primer sequence indicates the enzyme cutting site (F: Xho1, R: EcoR1).
Table 2. Structural information on the SCD transcribed region of buffalo and other mammals.
Table 2. Structural information on the SCD transcribed region of buffalo and other mammals.
SpeciesAccession NumberLength (bp)
5′UTRE1E2E3E4E5E6CDS3′UTR
BuffaloNM_001290915.1144171283131206233406010803863
CattleNM_173959.4144171283131206233407310803876
YakXM_005892055.2400427283131206233196310801766
Hybrid cattleXM_027529175.1432459283131206233407410803877
BisonXM_010859526.1395422283131206233407410803877
GoatNM_001285619.102728313120623320010803
SheepNM_001009254.11972242831312062338841080687
CamelXM_010974437.3446473283131206233396710803767
AlpacaXM_006210520.3183210283131206233396510803768
PigNM_213781.1176203283131206233405110803854
RatNM_139192.24872283131206233355010773353
HumanNM_005063.5272299283131206233409310803896
Table 3. Physicochemical characteristics of SCD proteins in buffalo and other mammals.
Table 3. Physicochemical characteristics of SCD proteins in buffalo and other mammals.
SpeciesNumber of Amino AcidsMolecular Weight (kDa)Isoelectric Point (PI)Instability Index (II)Aliphatic Index (AI)Negatively (Asp + Glu)/Positively (Arg + Lys) Charged ResiduesGrand Average of Hydropathicity (GRAVY)
Buffalo_this study35941.709.2347.2187.2432/41–0.19
Cattle35941.719.2243.9986.4333/42–0.23
Yak35941.739.2244.4186.9633/42–0.23
Hybrid cattle35941.719.2243.9986.4333/42–0.23
Bison35941.739.2245.6486.9633/42–0.23
Goat35941.589.1945.6687.4933/42–0.18
Sheep35941.679.2444.8387.2133/42–0.20
Camel35941.519.2343.8287.4932/42–0.17
Alpaca35941.659.2346.6886.1632/42–0.18
Pig35941.389.2347.3589.1632/42–0.17
Rat35841.479.3048.0686.4032/42–0.24
Human35941.529.0744.8484.7933/40–0.19
Table 4. Functional modification sites of SCD proteins in buffalo and other Bovidae.
Table 4. Functional modification sites of SCD proteins in buffalo and other Bovidae.
Functional Modification SitesSerial No.Location (AA) and Amino Composition
Casein kinase II phosphorylation sitePS0000658–61: TyqD, 164–167: SetD, 166–169: TdaD, 309–312: SasE, 351–354: TgeE
Protein kinase C phosphorylation sitePS0000595–97: TcK, 124–126: ShR, 127–129: TyK, 173–175: SrR, 355–357: SyK
N-myristoylation sitePS0000885–90: GAlyGI, 114–119: GItaGA, 141–146: GNtmAF, 197–202: GstlNL, 257–262: GLnvTW
N-glycosylation sitePS00001201–204: NLSD, 259–262: NVTW, 318–321: NFTT
cAMP- and cGMP-dependent protein kinase phosphorylation PS00004337–340: KKvS
Tyrosine kinase phosphorylation site 2PS00007349–356: KrtgEesY
Table 5. Secondary structure of SCD proteins in Bovidae species.
Table 5. Secondary structure of SCD proteins in Bovidae species.
StructuresBuffalo_This StudyCattleYakHybrid CattleBisonGoatSheep
Random coil (%)47.6348.7545.9648.7548.1948.7548.75
Alpha helix (%)37.0535.9337.8835.9336.4937.0537.05
Beta turn (%)4.744.465.014.465.013.343.34
Extended strand (%)10.5810.8611.1410.8610.3110.8610.86
Table 6. Polymorphic sites of the SCD gene in two types of buffalo and their allele frequencies.
Table 6. Polymorphic sites of the SCD gene in two types of buffalo and their allele frequencies.
PopulationSNPsGenotype/Individual NumberAllele FrequencyExpected Heterozygosityp Value 1
WWWmmmWm
River buffaloc.-603G>A8377240.66040.33960.45280.3768
c.-605A>C1671700.95280.04720.09070.1030
c.609C>T178600.98280.01720.03410.8940
c.617G>A1423660.86780.13220.23070.1450
c.621C>T1711120.95980.04020.07770.0089
c.633G>A8080240.65520.34480.45450.7148
c.867A>C12917380.7500 0.2500 0.38460.0005
c.878T>C36171310.2417 0.7583 0.35770.0001
c.987C>A1774930.3000 0.7000 0.43080.7405
Swamp
buffalo
c.-603G>A231520.76250.23750.36680.0211
c.-605A>C36400.96250.03750.07310.0400
c.504T>C38020.94120.05880.08160.0000
c.507T>C38020.94120.05880.08160.0000
c.581T>A38020.94120.05880.08160.0000
c.594T>C38020.94120.05880.08160.0000
c.609C>T31720.85290.14710.25850.1488
c.702G>A38020.94120.05880.08160.0000
c.716G>A38020.94120.05880.08160.0000
c.778A>G38020.94120.05880.08160.0000
c.819T>C38020.94120.05880.08160.0000
c.842G>A38020.94120.05880.08160.0000
c.867A>C38020.94120.05880.08160.0000
c.878T>C38020.94120.05880.08160.0000
1 The p-value of the Hardy–Weinberg equilibrium test.
Table 7. The haplotypes of the buffalo SCD gene and their frequencies.
Table 7. The haplotypes of the buffalo SCD gene and their frequencies.
HaplotypeAllelesActual FrequencyExpected Frequency
Buffalo_hap1TTTTCACGGGATGATC0.0549 0.0195
Buffalo_hap2TTTTCACGGGATGATA0.0797 0.0173
Buffalo_hap3TTTTCACGGGATGACC0.0201 0.0124
Buffalo_hap4TTTTCACGGGATGCTC0.0094 0.0064
Buffalo_hap5TTTTCACGGGATGCCA0.0060 0.0079
Buffalo_hap6TTTTCACAGGATGATC0.2698 0.0725
Buffalo_hap7TTTTCACAGGATGATA0.0671 0.0365
Buffalo_hap8TTTTCACAGGATGCTC0.0193 0.0195
Buffalo_hap9TTTTCACAGGATGCTA0.0115 0.0128
Buffalo_hap10TTTTCACAGGATGCCC0.1413 0.0621
Buffalo_hap11TTTTCATAGGATGATC0.0089 0.0074
Buffalo_hap12TTTTCGCGGGATGATC0.1960 0.0078
Buffalo_hap13TTTTCGCGGGATGATA0.0053 0.0053
Buffalo_hap14TTTTCGCAGGATGATC0.0032 0.0027
Buffalo_hap15TTTTCGTGGGATGATC0.0147 0.0035
Buffalo_hap16TTTTTGCGGGATGATC0.0378 0.0021
Buffalo_hap17CCACCGCGAAGCACCC0.0094 0.0005
Table 8. Association between SNP genotypes in the promoter region of the buffalo SCD gene and lactation traits.
Table 8. Association between SNP genotypes in the promoter region of the buffalo SCD gene and lactation traits.
PopulationSNPGenotypeMilk Yield (kg/d)Milk Fat Rate (%)Milk Protein Rate (%)Lactose Rate (%)
River buffaloc.-603G>AGG (83) 5.4567 ± 0.34016.3540 ± 0.23114.2387 ± 0.09495.0844 ± 0.0556
GA (76)5.8084 ± 0.37856.7888 ± 0.25714.3900 ± 0.10565.0355 ± 0.0618
AA (25) 5.5943 ± 0.65556.2468 ± 0.44534.2324 ± 0.18295.1578 ± 0.1071
c.-605A>CAA (166)5.5179 ± 0.2462 A6.5361 ± 0.17344.2965 ± 0.07025.0827 ± 0.0409
AC (18) 7.6644 ± 0.7629 B6.4773 ± 0.53734.0449 ± 0.21755.1626 ± 0.1266
Note: Different uppercase letters indicate a highly significant difference (p < 0.01).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dao, W.; Fan, X.; Liang, J.; Chen, T.; Chang, Z.; Zhang, Y.; Miao, Y. Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals 2024, 14, 3191. https://doi.org/10.3390/ani14223191

AMA Style

Dao W, Fan X, Liang J, Chen T, Chang Z, Zhang Y, Miao Y. Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals. 2024; 14(22):3191. https://doi.org/10.3390/ani14223191

Chicago/Turabian Style

Dao, Wenbin, Xinyang Fan, Jianping Liang, Tao Chen, Zaoshang Chang, Yongyun Zhang, and Yongwang Miao. 2024. "Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis" Animals 14, no. 22: 3191. https://doi.org/10.3390/ani14223191

APA Style

Dao, W., Fan, X., Liang, J., Chen, T., Chang, Z., Zhang, Y., & Miao, Y. (2024). Molecular and Functional Analysis of the Stearoyl-CoA Desaturase (SCD) Gene in Buffalo: Implications for Milk Fat Synthesis. Animals, 14(22), 3191. https://doi.org/10.3390/ani14223191

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop